LipidBank - Vitamin D

No	Structure	COMMON NAME	NAME	DATA No	INFORMANT	SYMBOL	FORMULA	MOL.WT(ave)	Download	BIOOGICAL ACTIVITY	PHYSICAL AND CHEMICAL PROPERTIES						SPECTRAL DATA					CHROMATOGRAM DATA	SOURCE	CHEMICAL SYNTHESIS	METABOLISM	GENETIC INFORMATION	NOTE	REFERENCES
No	Structure	COMMON NAME	NAME	DATA No	INFORMANT	SYMBOL	FORMULA	MOL.WT(ave)	Download	BIOOGICAL ACTIVITY	MELTING POINT	BOILING POINT	DENSITY	REFRACTIVE INDEX	OPTICAL ROTATION	SOLUBILITY	UV SPECTRA	IR SPECTRA	NMR SPECTRA	MASS SPECTRA	OTHER SPECTRA	CHROMATOGRAM DATA	SOURCE	CHEMICAL SYNTHESIS	METABOLISM	GENETIC INFORMATION	NOTE	REFERENCES
1		1a-hydroxy-20-oxo-19,22,23,24,25,26,27-heptanorvitamin D₃ / 1a-hydroxy-20-oxo-19,22,23,24,25,26,27-heptanorcholecalciferol	(7E)-(1R,3R)-1,3-dihydroxy-19-nor-9,10-seco-5,7-pregnadien-20-one	VVD0001	Sachiko Yamada	1a-OH-20-oxo-19,22,23,24,25,26,27-heptanor-D₃	C₂₀H₃₀O₃	318.450		Had no affinity for progesterone receptor in MCF-7. (Ref. 0304)							lmax (EtOH) (nm) 243, 251.5, 261 (Ref. 0304)		¹H-NMR (d, CDCl₃) 0.51 (3H, s, 18-CH₃), 2.14 (3H, s, 21-CH₃), 4.06 (1H, m, 3a-H), 4.13 (1H, m, 1b-H), 5.88 (1H, d, J = 11.3 Hz, 7-H), 6.29 (1H, d, J = 11.3 Hz, 6-H) (Ref. 0304)	m/z 318 (M⁺, 85), 300 (5), 282 (2), 275 (35) 239 (41), 133 (100), 95 (100) (Ref. 0304)				From corresponding C-22 aldehyde via oxidative decarbonylation. (Ref. 0304)				[0304]
2		20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ / 20-oxo-22,23,24,25,26,27-hexanorcholecalciferol	(5Z,7E)-(3S)-3-dihydroxy-9,10-seco-5,7,10(19)-pregnatrien-20-one	VVD0002	Sachiko Yamada	20-oxo-22,23,24,25,26,27-hexanor-D₃	C₂₁H₃₀O₂	314.462		Had significant affinity for progesterone receptor in MCF-7. (Ref. 0304)							lmax (EtOH) (nm) 264, lmin (nm) 228 (Ref. 0304)		¹H-NMR (d, CDCl₃) 0.51 (3H, s, 18-CH₃), 2.13 (3H, s, 21-CH₃), 4.20 (1H, m, 3a-H), 4.45 (1H, m, 1b-H), 4.98 (1H, br s, 19E-H), 5.33 (1H, br s, 19Z-H), 6.04 (1H, d, J = 11.3 Hz, 7-H), 6.36 (1H, d, J = 11.3 Hz, 6-H) (Ref. 0304)	m/z 330 (M⁺, 31), 312 (21), 183 (95), 134 (100) (Ref. 0304)				From corresponding C-22 aldehyde via oxidative decarbonylation. (Ref. 0304)				[0304]
3		1a-hydroxy-20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ / 1a-hydroxy-20-oxo-22,23,24,25,26,27-hexanorcholecalciferol	(5Z,7E)-(1S,3R)-1,3-dihydroxy-9,10-seco-5,7,10(19)-pregnatrien-20-one	VVD0003	Sachiko Yamada	1a-OH-20-oxo-22,23,24,25,26,27-hexanor-D₃	C₂₁H₃₀O₃	330.461		Had no affinity for progesterone receptor in MCF-7. (Ref. 0304) Effects of the compound given at the doses of 0.2 or 1.0mg/kg on the primary immune response in BALB/C mice immunized with 1 10⁷ sheep red blood cells were shown in comparison with 1a-hydroxyvitamin D₃ (0.2mg/kg). The binding affinity with chick intestinal cytosolic receptor was 1/10,000 compared to 1a,25-(OH)₂D₃. no calcemic activity of the compound (125mg/kg, 5, i.v.) was observed. (Ref. 0211)					[a] 9.20 (c = 1.00 in EtOH) (Ref. 0211)		lmax (EtOH) (nm) 264, lmin (nm) 228 (Ref. 0304)		¹H-NMR (d, CDCl₃) 0.51 (3H, s, 18-CH₃), 2.13 (3H, s, 21-CH₃), 3.95 (1H, m, 3a-H), 4.81 (1H, br s, 19E-H), 5.06 (1H, br s, 19Z-H), 6.06 (1H, d, J = 11.2 Hz, 7-H), 6.22 (1H, d, J = 11.2 Hz, 6-H) (Ref. 0304) ¹H-NMR (d, CDCl₃) 0.51 (3H, s), 2.13 (3H, s), 2.23-2.37 (1H, m), 2.52-2.73 (3H, m), 2.84 (1H, br d, J = 12.8 Hz), 3.26 (2H, br s), 4.15-4.28 (1H, br), 4.36-4.47 (1H, br), 4.99 (1H, t, J = 1.4 Hz), 5.33 (1H, t, J = 1.4 Hz), 6.04 (1H, d, J = 11.4 Hz), 6.36 (1H, d, J = 11.4 Hz) (Ref. 0211)	m/z 314 (M⁺, 23), 296 (2.4), 281 (15), 271 (1.5) 253 (4.6), 136 (33), 118 (73), 43 (100) (Ref. 0304)	HRMS Calcd 330.2195, Found 330.2176 (Ref. 0211)			From corresponding C-22 aldehyde via oxidative decarbonylation. (Ref. 0304) Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method. (Ref. 0211)				[0211] / [0304]
4		1a,21-dihydroxy-20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ / 1a,21-dihydroxy-20-oxo-22,23,24,25,26,27-hexanorcholecalciferol	(5Z,7E)-(1S,3R)-1,3,21-trihydroxy-9,10-seco-5,7,10(19)-pregnatrien-20-one	VVD0005	Sachiko Yamada	1a,21-(OH)₂-20-oxo-22,23,24,25,26,27-hexanor-D₃	C₂₁H₃₀O₄	346.460		The binding affinity for chick intestinal cytosolic receptor was less than 1/100,000 compared to 1a,25-(OH)₂D₃. (Ref. 0211)					[a] 2.81 (c = 0.07 in EtOH) (Ref. 0211)		lmax (EtOH) (nm) 262 (Ref. 0211)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 2.52-2.68 (2H, m), 2.87 (1H, d, J = 12.0 Hz), 3.26 (2H, br s), 4.12-4.34 (3H, m), 4.38-4.49 (1H, m), 4.98 (1H, t, J = 1.7 Hz), 5.33 (1H, t, J = 1.7 Hz), 6.05 (1H, d, J = 10.8 Hz), 6.34 (1H, d, J = 10.8 Hz) (Ref. 0211)	m/z 346 (M⁺), 134 (100%) (Ref. 0211)	HRMS Calcd 346.2144, Found 346.2146 (Ref. 0211)			Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method. (Ref. 0211)				[0211]
5		1a,17a,21-trihydroxy-20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ / 1a,17a,21-trihydroxy-20-oxo-22,23,24,25,26,27-hexanorcholecalciferol	(5Z,7E)-(1S,3R,17R)-1,3,17,21-tetrahydroxy-9,10-seco-5,7,10(19)-pregnatrien-20-one	VVD0006	Sachiko Yamada	1a,17a,21-(OH)₃-20-oxo-22,23,24,25,26,27-hexanor-D₃	C₂₁H₃₀O₅	362.460		The binding affinity for chick intestinal cytosolic receptor was less than 1/100,000 compared to 1a,25-(OH)₂D₃. (Ref. 0211)							lmax (EtOH) (nm) 264 (Ref. 0211)		¹H-NMR (d, CDCl₃) 0.58 (3H, s), 2.35 (1H, dd, J = 12.5 and 6.3 Hz), 2.55-2.96 (4H, m), 3.10 (1H, t, J = 4.9 Hz), 4.21-4.31 (1H, m), 4.35 (1H, dd, J = 20.0 and 4.9 Hz), 4.38-4.51 (1H, m), 4.66 (1H, t, J = 20.0 and 4.9 Hz), 5.01 (1H, t, J = 1.5 Hz), 5.35 (1H, t, J = 1.5 Hz), 6.09 (1H, d, J = 11.4 Hz), 6.38 (1H, d, J = 11.4 Hz) (Ref. 0211)					Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method. (Ref. 0211)				[0211]
6		(20S)-1a,20-dihydroxy-22,23,24,25,26,27-hexanorvitamin D₃ / (20S)-1a,20-dihydroxy-22,23,24,25,26,27-hexanorcholecalciferol	(5Z,7E)-(1S,3R,20S)-9,10-seco-5,7,10(19)-pregnatriene-1,3,20-triol	VVD0007	Sachiko Yamada	1a,20S-(OH)₂-22,23,24,25,26,27-hexanor-D₃	C₂₁H₃₂O₃	332.477		The antiproliferation activity towards HL-60 was <1/217 of 22-oxacalcitriol (OCT). The binding affinity for bovine thymus vitamin D receptor was 1/929 of OCT. (Ref. 0213)					[a] 55.10 (c = 0.01 in EtOH) (Ref. 0212)		lmax (EtOH) (nm) 263, lmin (nm) 227 (Ref. 0212)	(neat) 3375, 2920, 2865, 1050 cm^-¹ (Ref. 0212)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 1.23 (3H, d, J = 6.6 Hz), 2.33 (1H, dd, J = 6.0 and 13.1 Hz), 2.61 (1H, dd, J = 2.9 and 13.1 Hz), 2.85 (1H, dd, J = 2.9 and 10.8 Hz), 3.25-3.57 (4H, m), 3.62-3.76 (1H, m), 4.17-4.31 (1H, m), 4.37-4.51 (1H, m), 5.00 (1H, s), 5.33 (1H, s), 6.04 (1H, d, J = 11.7 Hz), 6.37 (1H, d, J = 11.7Hz) (Ref. 0212)	m/z 332 (M⁺), 134 (100%) (Ref. 0212)	Colorless foam. (Ref. 0213) HRMS Calcd 332.2351, Found 332.2369 (Ref. 0212)	1)Flash column chromatography with CH₂Cl₂-EtOH (10 : 1). 2)Fash column chromatography with AcOEt. 3)Flash column chromatography with CH₂Cl₂-EtOH (10 : 1). (Ref. 0213)		Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0212/0213)				[0212] / [0213]
7		1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-22-oxo-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-1,3-dihydroxy-9,10-seco-23,24-dinor-5,7,10(19)-cholatrien-22-one	VVD0008	Sachiko Yamada	1a-OH-22-oxo-pentanor-D₃	C₂₂H₃₂O₃	344.488		HL-60 human promyelocytes differentiation: ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 7.5 10^-⁷ M, 8.2 10^-⁷ M and 8.5 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)														From C(22) ester precursor. (Ref. 0228)				[0228]
8		(6RS)-22-oxo-23,24,25,26,27-pentanorvitamin D₃ 6,19-sulfur dioxide adduct / (6RS)-22-oxo-23,24,25,26,27-pentanorcholecalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6RS)-3-hydroxy-6,19-epithio-23,24-dinor-9,10-seco-5(10),7-choladien-22-al S,S-dioxide	VVD0009	Sachiko Yamada	22-oxo-23,24,25,26,27-pentanor-D₃ 6,19-sulfur dioxide adduct	C₂₂H₃₂O₄S	392.553											¹H-NMR (d, CDCl₃) (a 1:1 mixture of C6) epimers) 0.62 and 0.70 (1:1, 3 H, s, H-18), 1.14 and 1.15 (1:1, 3 H, d, J = 6.9 Hz, H-21), 3.68 (2 H, br, H-19), 4.09 (1 H, m, H-3), 4.57 and 4.66 (1:1, 1 H, d, J = 9.9 Hz, H-6), 4.76 and 4.79 (1:1, 1 H, d, J = 9.9 Hz, H-7), 9.58 and 9.60 (1:1, 1H, d, J = 3.0 Hz, CHO). (Ref. 0334)					From vitamin D₂ sulfur dioxide adduct by ozonolysis. (Ref. 0334)				[0334]
9		1a-hydroxy-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0010	Sachiko Yamada	1a-OH-23,24,25,26,27-pentanor-D₃	C₂₂H₃₄O₂	330.504		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazolium reduction, phagocytic activity, and nonspecific acid esterase activity are 1.8 10^-⁷ M, 1.9 10^-⁷ M and 1.7 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)														Prepared via 3,5-cyclovitamin D intermediate. (Ref. 0228)				[0228]
10		22-hydroxy-23,24,25,26,27-pentanorvitmin D₃ / 22-hydroxy-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(3S)-23,24-dinor-9,10-seco-5,7,10(19)-cholatrien-3-ol	VVD0011	Sachiko Yamada	22-OH-23,24,25,26,27-pentanor-D₃	C₂₂H₃₄O₂	330.504																From vitamin D₂ via ozonolysis of its sulfur dioxide adduct. (Ref. 0334)				[0334]
11		1a,22-dihydroxy-23,24,25,26,27-pentanorvitamin D₃ / 1a,22-dihydroxy-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3,22-triol	VVD0012	Sachiko Yamada	1a,22-(OH)₂-23,24,25,26,27-pentanor-D₃	C₂₂H₃₄O₃	346.504		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazolium reduction, phagocytic activity, and nonspecific acid esterase activity are 1.4 10^-⁶ M, 1.8 10^-⁶ M and 2.0 10^-⁶ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)														From C(22) ester precursor. (Ref. 0228)				[0228]
12		(6RS)-22-hydroxy-23,24,25,26,27-pentanorvitamin D₃ 6,19-sulfur dioxide adduct / (6RS)-22-hydroxy-23,24,25,26,27-pentanorcholecalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6RS)-6,19-epithio-23,24-dinor-9,10-seco-5(10),7-choladiene-3,22-diol S,S-dioxide	VVD0013	Sachiko Yamada	22-OH-23,24,25,26,27-pentanor-D₃ 6,19-sulfur dioxide adduct	C₂₂H₃₄O₄S	394.569											¹H-NMR (d, CDCl₃, 270MHz) 0.59 and 0.68 (1:1) (3H, s, 18-H), 1.07 (3H, d, J = 6.4 Hz, 21-H), 3.67 (2H, m, 19-H), 4.11 (1H, m, 3-H) (Ref. 0334)					From vitamin D₂ sulfur dioxide adduct by ozonolysis followed by reduction. (Ref. 0334)				[0334]
13		1a-hydroxy-24,25,26,27-tetranorvitamin D₃ 23-carboxylic acid / calcitroic acid	(5Z,7E)-(1S,3R)-1,3-dihydroxy-24-nor- 9,10-seco-5,7,10(19)-cholatrien-23-oic acid	VVD0014	Sachiko Yamada	1a-OH-24,25,26,27-tetranor-D₃ 23-carboxylic acid	C₂₃H₃₄O₄	374.514		Bone Mineral Mobilization and Intestinal Calcium Transport Activity of Calcitroic Acid. (Ref. 0072)	122-126 C (Ref. 0074)						lmax (nm) (emax) 262 (18000), lmin (nm) (emin) 226 (10000) (Ref. 0074) Me-ester : lmax (nm) (emax) 264 (18000) (Ref. 0071)		¹H-NMR (d, CDCl₃) 6.43, 6.06 (2H, ABq, J = 11 Hz, 6-, 7-H), 5.56 (1H, br s, 19E-H), 5.04 (1H, br s, 19Z-H), 4.46 (1H, m, 1b-H), 4.26 (1H, m, 3a-H), 2.80 (1H, m, 9b-H), 0.99 (3H, d, J = 6 Hz, 21-H), 0.59 (3H, s, 18-H) (Ref. 0074) Me-ester : ¹H-NMR (d, CDCl₃) 0.58 (3H, s, 18-CH₃), 0.99 (3H, d, J = 5.9 Hz, 21-CH₃), 3.67 (3H, s, COOCH₃), 4.23 (1H, m, 3a-H), 4.43 (1H, m, 1b-H), 5.00 (1H, s, 19(Z)-H), 5.33 (1H, s, 19(E)-H), 6.02 (1H, d, J = 11.0 Hz, 7-H), 6.38 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0071)	Me-ester : m/z 388, 370, 352 , 152, 134, 287, 269, 251. Spectrum (Ref. 0070)		HPLC : (Ref. 0070/0073)	Isolation from rat liver. (Ref. 0070) Isolation and identification from vitamin D supplemented rat kidney homogenates incubated with 24,25-(OH)₂D₃. (Ref. 0118)	From C(22)-steroid carboxylic acid via one-carbon homologation, conversion to tetranor-vitamin D₃ 23-carboxylic acid and 1a-hydroxylation of the corresponding 3,5-cyclovitamin D. (Ref. 0071) From 3b-acetoxypregn-7-ene-22-carboxaldehyde. (Ref. 0074)	A final catabolite produced from the active vitamin D₃ metabolite, 1,25-(OH)₂D₃, via 24-hydroxylation pathway.(Ref. 0034/0065/0066/0067/0068/0069/0070/0073)			[0034] / [0065] / [0066] / [0067] / [0068] / [0069] / [0070] / [0071] / [0072] / [0073] / [0074] / [0118]
14		1a-hydroxy-24,25,26,27-tetranorvitamin D₃ / 1a-hydroxy-24,25,26,27-tetranorcholecalciferol	(5Z,7E)-(1S,3R)-24-nor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0015	Sachiko Yamada	1a-OH-23,24,25,26,27-tetranor-D₃	C₂₃H₃₆O₂	344.531		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazolium reduction, phagocytic activity, and nonspecific acid esterase activity are 2.3 10^-⁷ M, 2.5 10^-⁷ M and 2.7 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)														Prepared via 3,5-cyclovitamin D intermediate. (Ref. 0228)				[0228]
15		(22R)-22-hydroxy-24,25,26,27-tetranorvitmin D₃ / (22R)-22-hydroxy-24,25,26,27-tetranorcholecalciferol	(5Z,7E)-(3S,22R)- 24-nor-9,10-seco-5,7,10(19)-cholatriene-3,22-diol	VVD0016	Sachiko Yamada	22R-OH-24,25,26,27-tetranor-D₃	C₂₃H₃₆O₂	344.531											¹H-NMR (d, CDCl₃, 270MHz) 0.57 (3H, s, 18-H), 0.93 (3H, d, J = 6.6 Hz, 21-H), 1.04 (3H, d, J = 6.6 Hz, 23-H), 3.93 (2H, m, 3- and 22-H), 4.82 and 5.05 (each 1H, m, 19-H), 6.04 and 6.23 (each 1H, d, J = 11.5 Hz, 6- and 7-H) (Ref. 0334)					From vitamin D₂ sulfur dioxide adduct via ozonolysis followed by Grignard reaction. (Ref. 0334)				[0334]
16		(22S)-22-hydroxy-24,25,26,27-tetranorvitmin D₃ / (22S)-22-hydroxy-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(3S,22S)- 24-nor-9,10-seco-5,7,10(19)-cholatriene-3,22-diol	VVD0017	Sachiko Yamada	22S-OH-24,25,26,27-tetranor-D₃	C₂₃H₃₆O₂	344.531									(EtOH) lmax (nm) 265, lmin (nm) 212 (Ref. 0334)		¹H-NMR (d, CDCl₃, 270MHz) 0.55 (3H, s, 18-H), 0.93 (3H, d, J = 6.9 Hz, 21-H), 1.16 (3H, d, J = 6.4 Hz, 23-H), 3.95 (2H, m, 3- and 22-H), 4.82 and 5.05 (each 1H, m, 19-H), 6.04 and 6.23 (each 2H, d, J = 11.4 Hz, 6- and 7-H) (Ref. 0334)	m/z 344 (M⁺, 75.7), 326 (93.7), 311 (23.6), 271 (15.6), 253 (41.1), 136 (96.7), 118 (100) (Ref. 0334)				From vitamin D₂ sulfur dioxide adduct via ozonolysis followed by Grignard reaction. (Ref. 0334)				[0334]
17		(5E)-(22R)-22-hydroxy-24,25,26,27-tetranorvitmin D₃ / (5E)-(22R)-22-hydroxy-24,25,26,27-tetranorcholecalciferol	(5E,7E)-(3S,22R)- 24-nor-9,10-seco-5,7,10(19)-cholatriene-3,22-diol	VVD0018	Sachiko Yamada	(5E)-22R-OH-24,25,26,27-tetranor-D₃	C₂₃H₃₆O₂	344.531											¹H-NMR (d, CDCl₃, 270MHz) 0.59 (3H, s, 18-H), 0.93 (3H, d, J = 6.6 Hz, 21-H), 1.04 (3H, d, J = 6.3 Hz, 23-H), 3.89 (1H, m, 3-H), 3.93 (1H, m, 22-H), 4.69 and 4.98 (each 1H, s, 19-H), 5.88 and 6.54 (each 1H, d, J = 11.6 Hz, 6- and 7-H) (Ref. 0334)	m/z 344 (M⁺, 63.4), 326 (100), 308 (23.1), 271 (14.2), 253 (40.0), 251 (37.5) (Ref. 0334)				From vitamin D₂ sulfur dioxide adduct via ozonolysis followed by Grignard reaction. (Ref. 0334)				[0334]
18		(5E)-(22S)-22-hydroxy-24,25,26,27-tetranorvitmin D₃ / (5E)-(22S)-22-hydroxy-24,25,26,27-tetranorcholecalciferol	(5E,7E)-(3S,22S)- 24-nor-9,10-seco-5,7,10(19)-cholatriene-3,22-diol	VVD0019	Sachiko Yamada	(5E)-22S-OH-24,25,26,27-tetranor-D₃	C₂₃H₃₆O₂	344.531											¹H-NMR (d, CDCl₃, 270MHz) 0.57 (3H, s, 18-H), 0.93 (3H, d, J = 6.8 Hz, 21-H), 1.17 (3H, d, J = 6.4 Hz, 23-H), 3.89 (1H, m, 3-H), 3.97 (1H, dq, J = 6.4 and 1.4 Hz, 22-H), 4.69 and 4.98 (each 1H, s, 19-H), 5.88 and 6.55 (each 1H, d, J = 11.6 Hz, 6- and 7-H) (Ref. 0334)	m/z 344 (M⁺, 63.4), 326 (100), 308 (23.1), 271 (14.2), 253 (40.0), 251 (37.5) (Ref. 0334)				From vitamin D₂ sulfur dioxide adduct via ozonolysis followed by Grignard reaction. (Ref. 0334)				[0334]
19		23-hydroxy-24,25,26,27-tetranorvitamin D₃ / 23-hydroxy-24,25,26,27-tetranorcholecalciferol	(5Z,7E)-(3S)-24-nor-9,10-seco-5,7,10(19)-cholatriene-3,23-diol	VVD0020	Sachiko Yamada	23-OH-24,25,26,27-tetranor-D₃	C₂₃H₃₆O₂	344.531												m/z 344 (M⁺), 326, 311, 285, 271, 253, 211, 136, 118. Spectrum (Ref. 0105)		HPLC : (Ref. 0105)	Isolation and identification : By perfusing kidneys from vitamin D₃ replete rats with 24,25-(OH)₂D₃. (Ref. 0105)	From 22-bromo-23,24-dinor-5,7-choladien-3-ol ether via one carbon homologation and photochemical transformation. (Ref. 0105)				[0105]
20		1a,23-dihydroxy-24,25,26,27-tetranorvitamin D₃ / 1a,23-dihydroxy-24,25,26,27-tetranorcholecalciferol	(5Z,7E)-(1S,3R)-24-nor-9,10-seco-5,7,10(19)-cholatriene-1,3,23-triol	VVD0021	Sachiko Yamada	1a,23-(OH)₂-24,25,26,27-tetranor-D₃	C₂₃H₃₆O₃	360.530		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazolium reduction, phagocytic activity, and nonspecific acid esterase activity are 3.0 10^-⁶ M, 2.0 10^-⁶ M and 2.0 10^-⁶ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)							lmax (nm) 265, lmin (nm) 228 (Ref. 0069)			tris-TMS-ether: Spectrum (Ref. 0069)		HPLC : (Ref. 0069)		From 1,23,25-(OH)₃-24-oxo-D₃, which was produced enzymatically from 1,24,25-(OH)₃D₃, by NaIO₄ oxidation followed by NaBH₄ reduction. (Ref. 0069)	1,23-(OH)₂-Tetranor-D₃ is metabolized to 1-OH-tetranor-D₃ 23-carboxylic acid (calcitroic acid). (Ref. 0070/0073)			[0069] / [0070] / [0073] / [0228]
21		cholacalcioic acid / 25,26,27-trinorvitamin D₃ 24-carboxylic acid / 25,26,27-trinorcholecalciferol 24-carboxylic acid	(5Z,7E)-(3S)-3-hydroxy-9,10-seco-5,7,10(19)-cholatrien-24-oic acid	VVD0022	Sachiko Yamada	25,26,27-trinor-D₃ 24-carboxylic acid	C₂₄H₃₆O₃	372.541									Me-ester : lmax (nm) 264, lmin (nm) 229 (Ref. 0118)			Me-ester : m/z 386 (M⁺), 368, 327, 353, 271, 253, 136, 118 (Ref. 0118)			Isolation and identification from vitamin D supplemented rat kidney homogenates incubated with 24,25-(OH)₂D₃. (Ref. 0118)					[0118]
22		1a-hydroxy-25,26,27-trinorvitamin D₃ 24-carboxylic acid	(5Z,7E)-(1S,3R)-1,3-dihydroxy-9,10-seco-5,7,10(19)-cholatrien-24-oic acid	VVD0023	Sachiko Yamada	1a-OH-25,26,27-trinor-D₃ 24-carboxylic acid	C₂₄H₃₆O₄	388.540			117-120 C (Ref. 0074)						lmax (nm) (e) 263 (18200) , lmin (nm) (e) 227 (10400) (Ref. 0074)		¹H-NMR (d, CDCl₃) 6.42, 6.04 (2H, ABq, J = 11.6 Hz, 6-, 7-H), 5.35 (1H, bs, 19E-H), 5.03 (1H, bs, 19Z-H), 4.46 (1H, m, 1b-H), 4.25 (1H, m, 3a-H), 2.80 (1H, m, 9b-H), 0.95 (3H, d, J = 5.5 Hz, 21-H), 0.55 (3H, s, 18-H) (Ref. 0074)					From methyl-3b-hydroxy-chola-1,5,7-triene-24-oate. (Ref. 0074)				[0074]
23		1a,24-dihydroxy-25,26,27-trinorvitamin D₃ / 1a,24-dihydroxy-25,26,27-trinorcholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19)-cholatriene-1,3,24-triol	VVD0024	Sachiko Yamada	1a,24-(OH)₂-25,26,27-trinor-D₃	C₂₄H₃₈O₃	374.557		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazolium reduction, phagocytic activity, and nonspecific acid esterase activity are 7.0 10^-⁷ M, 6.0 10^-⁷ M and 1.0 10^-⁶ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)																		[0228]
24		26,26,26-trifluoro-25-hydroxy-27-norvitamin D₃ / 26,26,26-trifluoro-25-hydroxy-27-norcholecalciferol	(5Z,7E)-(3S)-26,26,26-trifluoro-27-nor-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0025	Sachiko Yamada	26,26,26-F₃-25-OH-27-nor-D₃	C₂₅H₃₇F₃O₂	426.555									lmax (nm) 264, lmin (nm) 228 (Ref. 0201)			m/z 440 (M⁺), 425, 422, 408, 271, 253, 136, 118 (Ref. 0201)								[0201]
25		1a-hydroxy-26,27-dinorvitamin D₃ 25-carboxylic acid / 1a-hydroxy-26,27-dinorcholecalciferol 25-carboxylic acid	(5Z,7E)-(1S,3R)-1,3-dihydroxy-25-homo-9,10-seco-5,7,10(19)-cholatrien-25-oic acid	VVD0026	Sachiko Yamada	1a-OH-26,27-dinor-D₃ 25-carboxylic acid	C₂₅H₃₈O₄	402.567			97-101 C (Ref. 0074)						lmax (nm) (e) 264 (18300) , lmin (nm) (e) 228 (10300) (Ref. 0074)		¹H-NMR (d, CDCl₃) 6.42, 6.04 (2H, ABq, J = 11.6 Hz, 6-, 7-H), 5.35 (1H, br s, 19E-H), 5.03 (1H, br s, 19Z-H), 4.45 (1H, m, 1b-H), 4.25 (1H, m, 3a-H), 2.81 (1H, m, 9b-H) (Ref. 0074)	m/z 416 (M⁺), 398 (M⁺-H₂O), 380 (M⁺-2H₂O), 269, 251, 134, 105 (Ref. 0074)				From methyl-3b-hydroxy-25-homo-chola-1,5,7-trien-25-oate. (Ref. 0074)				[0074]
26		1a-hydroxy-21-nor-20-oxavitamin D₃ / 1a-hydroxy-21-nor-20-oxacholecalciferol	(5Z,7E)-(1S,3R)-21-nor-20-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0027	Sachiko Yamada	1a-OH-20-oxa-21-nor-D₃	C₂₅H₄₀O₃	388.583							[a] -30.2 (c = 0.86 in EtOH) (Ref. 0207)		(EtOH) lmax (nm) 262, lmin (nm) 227 (Ref. 0207)		¹H-NMR (d, CDCl₃) 0.62 (3H, s), 0.86 (3H, d, J = 0.8 Hz), 0.89 (3H, d, J = 0.8 Hz), 3.35-3.56 (3H, m), 4.15-4.32 (1H, m), 4.38-4.51 (1H, m), 5.00 (1H, t, J = 1.6 Hz), 5.32 (1H, t, J = 1.6 Hz), 6.00 (1H, d, J = 12.0 Hz), 6.38 (1H, d, J = 12.0 Hz) (Ref. 0207)	m/z 388 (M⁺), 134 (100%) (Ref. 0207)	Colorless crystals (Ref. 0207)			Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method. (Ref. 0207)				[0207]
27		1a,25-dihydroxy-23,24-dinorvitamin D₃ / 1a,25-dihydroxy-23,24-dinorcholecalciferol	(5Z,7E)-(1S,3R)-23,24-dinor-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0028	Sachiko Yamada	1a,25-(OH)₂-23,24-dinor-D₃	C₂₅H₄₀O₃	388.583		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazolium reduction, phagocytic activity and nonspecific acid esterase activity are 2.4 10^-⁶ M, 2.0 10^-⁶ M and 2.1 10^-⁶ M respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M respectively. (Ref. 0228)																		[0228]
28		1a,25-dihydroxy-26,27-dinorvitamin D₃ / 1a,25-dihydroxy-26,27-dinorcholecalciferol	(5Z,7E)-(1S,3R)-26,27-dinor-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0029	Sachiko Yamada	1a,25-(OH)₂-26,27-dinor-D₃	C₂₅H₄₀O₃	388.583		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazolium reduction, phagocytic activity, and nonspecific acid esterase activity are 1.0 10^-⁶ M, 1.2 10^-⁶ M and 1.0 10^-⁶ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)																		[0228]
29		1a,25-dihydroxy-21-nor-20-oxavitamin D₃ / 1a,25-dihydroxy-21-nor-20-oxacholecalciferol	(5Z,7E)-(1S,3R)-21-nor-20-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0030	Sachiko Yamada	1a,25-(OH)₂-20-oxa-21-nor-D₃	C₂₅H₄₀O₄	404.583		Differentiation inducing activity of HL-60 (ED50): 4.0 10^-⁸ M (1,25-(OH)₂D₃, 8.3 10^-⁹ M); Binding affinity for chick intestinal receptor: 1/1000 of 1,25-(OH)₂D₃. Calcemic activity at a dose of 500mg/kg in normal mice, 8.96 0.13 (1.25-(OH)₂D₃, 11.04 0.12 at 10mg/kg). (Ref. 0209)					[a] -44.6 (c = 0.56 in EtOH) (Ref. 0207)		lmax (EtOH) (nm) 262, lmin (nm) 227 (Ref. 0207)		¹H-NMR (d, CDCl₃) 0.63 (3H, s), 1.23 (6H, s), 3.51 (3H, m), 4.17-4.29 (1H, m), 4.34-4.49 (1H, m), 4.98 (1H, t, J = 1.6 Hz), 5.31 (1H, t, J = 1.6 Hz), 5.99 (1H, d, J = 12.0 Hz), 6.36 (1H, d, J = 12.0 Hz) (Ref. 0207)	m/z 404 (M⁺), 83 (100%) (Ref. 0207)	Colorless crystals (Ref. 0207)			Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method. (Ref. 0209)				[0207] / [0209]
30		1a,25-dihydroxy-24-nor-22-oxavitamin D₃ / 1a,25-dihydroxy-24-nor-22-oxacholecalciferol	(5Z,7E)-(1S,3R)-24-nor-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0031	Sachiko Yamada	1a,25-(OH)₂-22-oxa-24-nor-D₃	C₂₅H₄₀O₄	404.583		The activity inducing differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro was compared with 1,25-(OH)₂D₃. Figure (Ref. 0203)							(EtOH) lmax (nm) 263, lmin (nm) 227(Ref. 0203)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 1.16 (3H, d, J = 6.2 Hz), 1.19 (6H, s), 3.04 (1H, d, J = 8.4 Hz), 3.24-3.48 (1H, br), 3.39 (1H, d, J = 8.4 Hz), 4.20-4.32 (1H, br), 4.40-4.52 (1H, br), 4.99 (1H, s), 5.33 (1H, s), 6.03 (1H, d, J = 11.4 Hz), 6.37 (1H, d, J = 11.4 Hz) (Ref. 0203)	m/z 404 (M⁺), 72 (100%) (Ref. 0203)	Colorless foam. (Ref. 0203)	1)Flash column chromatography with CH₂Cl₂/EtOH (12.5 : 1), 2)Flash column chromatography with AcOEt/n-hexane (6 : 1), 3)Preparative TLC developed four times with CH₂Cl₂/EtOH (12.5 : 1) (Ref. 0203)		Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-(2-hydroxy-2-methylpropyloxy)pregna-5,7-diene by photochemical method. (Ref. 0203)				[0203]
31		1a-hydroxy-24-methylsulfonyl-25,26,27-trinorvitamin D₃ / 1a-hydroxy-24-methylsulfonyl-25,26,27-trinorcholecalciferol	(5Z,7E)-(1S,3R)-24-methylsulfonyl-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0032	Sachiko Yamada	24-methylsulfonyl-1a-OH-25,26,27-trinor-D₃	C₂₅H₄₀O₄S	436.649											¹H-NMR (d, CD₂Cl₂) 6.34 and 5.98 (2H, AB pattern, J = 11.2 Hz, 6- and 7-H), 5.29 (1H, br s, 19E-H), 4.94 (1H, br s, 19Z-H), 4.35 (1H, m, 1-H), 4.15 (1H, m, 3-H), 2.88 - 2.97 (2H, m, 24-H), 2.84 (3H, s, SO₂CH₃), 0.94 (3H, d, J = 6.4 Hz, 21C-CH₃), 0.53 (3H, s, 18C-CH₃) (Ref. 0195) ¹³C-NMR (d, CD₂Cl₂) 148.6 (C), 143.2 (C), 134.1 (C), 125.0 (CH), 117.0 (CH), 111.8 (C-19), 71.2 (CH), 67.2 (CH), 56.7, 56.6, 55.7, 53.5, 46.3, 45.8, 43.4, 40.9, 36.2, 35.0, 29.4, 28.0, 23.9, 22.6, 19.7, 18.8, 12.1 (Ref. 0195)									[0195]
32		1,25-dihydroxy-2,4-dinor-1,3-secovitamin D₃ / 1,25-dihydroxy-2,4-dinor-1,3-secocholecalciferol	(5Z,7E)-A-dinor-(1,2)-(9,10)-diseco-5,7,10(19)-cholestatriene-1,2,25-triol	VVD0034	Sachiko Yamada	1,25-(OH)₂-2,4-dinor-1,3-seco-D₃	C₂₅H₄₂O₃	390.599		Affinity for chick intestinal receptor: 2% of 1,25-(OH)₂D₃ effect. (Ref. 0359)																		[0359]
33		25,26-epoxy-1a-hydroxy-23,23,24,24-tetradehydro-19-norvitamin D₃ / 25,26-epoxy-1a-hydroxy-23,23,24,24-tetradehydro-19-norcholecalciferol	(7E)-(1R,3R)-25,26-epoxy-19-nor-9,10-seco-5,7-cholestadien-23-yne-1,3-diol	VVD0035	Sachiko Yamada	25,26-epoxy-1a-OH-23,23,24,24-tetradehydro-19-nor-D₃	C₂₆H₃₈O₃	398.578		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 20% and 1%, respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63), and breast carcinoma (MCF-7) cells : 12%, 4% and 20%, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium, and duodenal calbindin in rachitic chicks : all < 1%. (Ref. 0240)														By epoxidation of the corresponding olefinic precursor which was constructed from Inhoffen-Lythgoe diol. (Ref. 0240)				[0240]
34		(22E,24E)-1a,26-dihydroxy-22,23,24,25-tetradehydro-27-norvitamin D₃ / (22E,24E)-1a,26-dihydroxy-22,23,24,25-tetradehydro-27-norcholecalciferol	(5Z,7E,22E,24E)-(1S,3R)-27-nor-9,10-seco-5,7,10(19),22,24-cholestapentaene-1,3,26-triol	VVD0036	Sachiko Yamada	(22E,24E)-1a,26-(OH)₂-22,23,24,25-tetradehydro-27-nor-D₃	C₂₆H₃₈O₃	398.578		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, < 80% ; Induction of differentiation of U 937 cells, < 5%. (Ref. 0288>														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by Wittig reaction, reduction, photoisomerization and deprotection. (Ref. 0288)				[0288]
35		(17E)-1a,25-dihydroxy-17,20-didehydro-21-norvitamin D₃ / (17E)-1a,25-dihydroxy-17,20-didehydro-21-norcholecalciferol	(5Z,7E,17E)-(1S,3R)-21-nor-9,10-seco-5,7,10(19),17-cholestatetraene-1,3,25-triol	VVD0037	Sachiko Yamada	(17E)-1a,25-(OH)₂-17,20-didehydro-21-nor-D₃	C₂₆H₄₀O₃	400.594																From 4-hydroxyhydrindanone via introduction of the side chain and A-ring fragments. (Ref. 0315)				[0315]
36		(17Z)-1a,25-dihydroxy-17,20-didehydro-21-norvitamin D₃ / (17Z)-1a,25-dihydroxy-17,20-didehydro-21-norcholecalciferol	(5Z,7E,17Z)-(1S,3R)-21-nor-9,10-seco-5,7,10(19),17-cholestatetraene-1,3,25-triol	VVD0038	Sachiko Yamada	(17Z)-1a,25-(OH)₂-17,20-didehydro-21-nor-D₃	C₂₆H₄₀O₃	400.594																From 4-hydroxyhydrindanone via introduction of the side chain and A-ring fragments. (Ref. 0315)				[0315]
37		(24R,25S)-25,26-epoxy-1a,24-dihydroxy-27-norvitamin D₃ / (24R,25S)-25,26-epoxy-1a,24-dihydroxy-27-norcholecalciferol	(5Z,7E)-(1S,3R,24R,25S)-25,26-epoxy-27-nor-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0039	Sachiko Yamada	25S,26-epoxy-1a,24R-(OH)₂-27-nor-D₃	C₂₆H₄₀O₄	416.593		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein: 3% and 21%, respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60) and osteosarcoma (MG-63) cells: both < 1%. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks: all < 1%. (Ref. 0240)														By Sharpless kinetic epoxidation of the corresponding olefinic precursor. (Ref. 0243)				[0240] / [0243]
38		(24S,25R)-25,26-epoxy-1a,24-dihydroxy-27-norvitamin D₃ / (24S,25R)-25,26-epoxy-1a,24-dihydroxy-27-norcholecalciferol	(5Z,7E)-(1S,3R,24S,25R)-25,26-epoxy-27-nor-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0040	Sachiko Yamada	25R,26-epoxy-1a,24S-(OH)₂-27-nor-D₃	C₂₆H₄₀O₄	416.593		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 2% and 5%, respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60) and osteosarcoma (MG-63) cells : both < 1%. Elevation of serum calcium, serum osteocalcin, bone calcium, and duodenal calbindin in rachitic chicks: all < 1%. (Ref. 0240)														By Sharpless kinetic epoxidation of the corresponding olefinic precursor. (Ref. 0243)				[0240] / [0243]
39		1a,25-dihydroxy-24-oxo-22-oxavitamin D₃ / 1a,25-dihydroxy-24-oxo-22-oxacholecalciferol	(5Z,7E)-(1S,3R)-1,3,25-trihydroxy-22-oxa-9,10-seco-5,7,10(19)-cholestatrien-24-one	VVD0041	Sachiko Yamada	1a,25-(OH)₂-24-oxo-22-oxa-D₃	C₂₆H₄₀O₅	432.593		Antiproliferative activity (HL-60) was the same as that of 22-oxacalcitriol (OCT). The binding affinity for bovine thymus vitamin D receptor was 1/2 of OCT. (Ref. 0213)							lmax (EtOH) (nm) 263, lmin (nm) 227 (Ref. 0213)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 1.21 (3H, d, J = 6.3 Hz), 1.40 (6H, s), 4.18-4.27 (1H, m), 4.22 and 4.43 (each 1H, d, J = 16.3 Hz), 4.39-4.48 (1H, m), 5.00 (1H, s), 5.33 (1H, s), 6.03 (1H, d, J = 12.0 Hz), 6.37 (1H, d, J = 12.0 Hz) (Ref. 0213)	m/z 432 (M⁺), 59 (100%) (Ref. 0213)	Colorless oil. (Ref. 0213)	Preparative TLC developed with AcOEt. (Ref. 0213)		Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0213)				[0213]
40		25-hydroxy-3-deoxy-2-oxavitamin D₃ / 25-hydroxy-3-deoxy-2-oxacholecalciferol	(5Z,7E)-2-oxa-9,10-seco-5,7,10(19)-cholestatrien-25-ol	VVD0042	Sachiko Yamada	3-deoxy-25-OH-2-oxa-D₃	C₂₆H₄₂O₂	386.610																From 25,26-dehydro-8-enol triflate upper half and ring A precursor, 2-methyll-3-ethynyl-2,3-dehydro-d-butyrolactone. Coupling of the two precursors followed by catalytic partial hydrogenation and DIBAL reduction afforded 1,3-dihydroxy-2-nor-1,2-seco-vitamin D after spontaneous 1,7-hydrogen shift which by A ring cyclization and oxymercuration-demercuration (25-hydroxy introduction) afforded the title compound. (Ref. 0330)				[0330]
41		1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃ / 1a,25-dihydroxy-3-deoxy-3-thiacholecalciferol	(5Z,7E)-(1R)-9,10-seco-3-thia-5,7,10(19)-cholestatriene-1,25-diol	VVD0043	Sachiko Yamada	3-deoxy-3-thia-1a,25-(OH)₂D₃	C₂₆H₄₂O₂S	418.676		Biological activity (% of 1,25-(OH)₂D₃ effect): Intestinal calcium absorption and bone calcium mobilization in vitamin D deficient, rachitic chicks : 20% and <10%, respectively. Ability to bind to chick intestinal receptor: 14.5%. (Ref. 0281)									¹H-NMR (d) 0.53 (3H, s, 18C-CH₃), 0.93 (3H, d, J = 6.3 Hz, 21C-CH₃), 1.22 (6H, s, 26- and 27-C-2CH₃), 2.75-2.85 (2H, m, 2- and 9b-H), 3.06 (1H, dd, J = 13.4 and 2.3 Hz, 2-H,), 3.12 and 3.33 (2H, AB pattern, J = 12.9 Hz, 24-H), 4.36 (1H, m, 1-H), 4.90 (1H, s, 19-H), 5.29 (1H, s, 19-H), 5.93 and 6.43 (2H, AB pattern, J = 11.2 Hz, 6- and 7-H) (Ref. 0281)					Synthesis of the title compound and its 1b-epimer was achieved starting from CD-fragment and enantiomerically pure A-ring fragments, trimethylsilylenynes, which were prepared from 4-methylthiacyclohexane-3,5-dione. (Ref. 0281)				[0281]
42		1b,25-dihydroxy-3-deoxy-3-thiavitamin D₃ / 1b,25-dihydroxy-3-deoxy-3-thiacholecalciferol	(5Z,7E)-(1S)-9,10-seco-3-thia-5,7,10(19)-cholestatriene-1,25-diol	VVD0044	Sachiko Yamada	3-deoxy-3-thia-1b,25-(OH)₂D₃	C₂₆H₄₂O₂S	418.676		Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption and bone calcium mobilization in vitamin D deficient, rachitic chicks: <20% and <10%, respectively. Ability to bind to chick intestinal receptor : 1.23%. (Ref. 0281)									¹H-NMR (d) 0.53 (3H, s, 18C-CH₃), 0.93 (3H, d, J = 6.0 Hz, 21C-CH₃), 1.22 (6H, s, 26-, 27-C-2CH₃), 2.65-2.90 (3H, m, 2- and 9b-H), 3.08 (1H, dd, J = 13.2 and 2.1 Hz, 2-H), 3.10 and 3.35 (2H, two d, AB pattern, J = 12.9 Hz, 24-H), 4.36 (1H, m, 1-H), 4.91 (1H, br s, 19-H), 5.30 (1H, br s, 19-H), 5.96 and 6.43 (2H, two d, AB pattern, J = 11.2 Hz, 6-, 7-H) (Ref. 0281)					Synthesis of the title compound and its 1a-epimer was achieved starting from CD-fragment and enantiomerically pure A-ring fragments, trimethylsilylenynes, which were prepared from 4-methylthiacyclohexane-3,5-dione. (Ref. 0281)				[0281]
43		(5Z)-1,25-dihydroxy-3-thiavitamin D₃ / (5Z)-1,25-dihydroxy-3-thiacholecalciferol	(5Z,7E)-(1R)-9,10-seco-3-thia-5,7,10(19)-cholestatriene-1,25-diol	VVD0045	Sachiko Yamada	(5Z)-3-thia-1,25-(OH)₂D₃	C₂₆H₄₂O₂S	418.676		Affinity for chicken intestinal recepto : 0.1% of 1,25-(OH)₂D₃ effect. Inhibitory effect of a series of 3-thiavitamin D derivatives on 25-OHD₃ 1a-hydroxylase was evaluated. (Ref. 0306)							(100% EtOH) lmax (nm) (emax) 268 (18300) (Ref. 0306)		¹H-NMR (d, CDCl₃, 300MHz) 0.56 (3H, s, 18C-CH₃), 0.94 (3H, d, J = 6.3 Hz, 21C-CH₃), 1.22 (6H, s, 26C- and 27C-CH₃), 2.75-2.90 (2H, m, 2- and 9b-H), 3.08 (1H, dd, J = 13.2, 2.3 Hz, 2-H), 3.25 and 3.44 (2H, AB pattern, J = 13.5 Hz, 4-H₂), 4.39 (1H, m, 1-H), 4.99 (1H, s, 19-H), 5.01 (1H, distorted d, J = 1.8 Hz, 19-H), 5.79 and 6.41 (2H, AB pattern, J = 11.5 Hz, 6- and 7-H) (Ref. 0306)	m/z 418 (34, M⁺), 400 (7, M⁺-H₂O), 385 (20), 372 (10), 354 (5), 342 (2), 318 (4), 289 (7), 271 (15), 246 (14), 213 (7), 189 (9), 175 (14), 154 (base, A-ring portion due to C₇- and C₈-cleavage), 135 (68), 121 (12), 108 (66), 95 (31), 81 (22), 69 (13), 59 (16) (Ref. 0306)				From corresponding 5E-vitamin D (1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃) by iodine catalyzed isomerization followed by HPLC separation. (Ref. 0306)				[0306]
44		1a-hydroxy-22-oxavitamin D₃ / 1a-hydroxy-22-oxacholecalciferol	(5Z,7E)-(1S,3R)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0046	Sachiko Yamada	1a-OH-22-oxa-D₃	C₂₆H₄₂O₃	402.610							[a] -30.2 (c = 0.86 in EtOH) (Ref. 0208)		lmax (EtOH) (nm) 262 (Ref. 0208)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 0.89 (3H, d, J = 6.7 Hz), 0.90 (3H, d, J = 6.7 Hz), 1.16 (3H, d, J = 6.2 Hz), 2.32 (1H, dd, J = 13.6 and 6.8 Hz), 2.60 (1H, dd, J = 13.6 and 3.4 Hz), 2.84 (1H, dd, J = 12.2 and 3.4 Hz), 3.10-3.30 (2H, m), 3.48-3.62 (1H, m), 4.14-4.28 (1H, m), 4.38-4.50 (1H, m), 4.99 (1H, t, J = 1.6 Hz), 5.32 (1H, t, J = 1.6 Hz), 6.02 (1H, d, J = 11.4 Hz), 6.37 (1H, d, J = 11.4 Hz) (Ref. 0208)	m/z 402 (M⁺), 71 (100%) (Ref. 0208)	Colorless glass (Ref. 0208)			Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method. (Ref. 0208)				[0208]
45		25-hydroxy-23-oxavitamin D₃ / 25-hydroxy-23-oxacholecalciferol	(5Z,7E)-(3S)-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0047	Sachiko Yamada	25-OH-23-oxa-D₃	C₂₆H₄₂O₃	402.610		Affinity for chick intestinal receptor: 6% of 1,25-(OH)₂D₃. (Ref. 0359)																		[0359]
46		1a,25-dihydroxy-24-norvitamin D₃ / 1a,25-dihydroxy-24-norcholecalciferol	(5Z,7E)-(1S,3R)-24-nor-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0048	Sachiko Yamada	1a,25-(OH)₂-24-nor-D₃	C₂₆H₄₂O₃	402.610		HL-60 human promyelocytes differentiation: ED50 in nitro blue tetrazolium reduction, phagocytic activity and nonspecific acid esterase activity are 1.5 10^-⁷ M, 1.2 10^-⁷ M and 1.6 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228) Biological activity (% of 1,25-(OH)₂D₃effect) : Intestinal calcium absorption in chick, 2.0% ; Bone calcium mobilization in chick, 2.0% ; Competitive binding to the vitamin D receptor in chick intetine, 1.0% ; Inhibition of clonal growth of human leukemia cells (HL-60), ED50 was not reached. (Ref. 0238)																		[0228] / [0238]
47		1a,25-dihydroxy-19-norprevitamin D₃ / 1a,25-dihydroxy-19-norprecholecalciferol	(6Z)-(1S,3R)-19-nor-9,10-seco-5(10),6,8-cholestatriene-1,3,25-triol	VVD0049	Sachiko Yamada	1a,25-(OH)₂-19-norpre-D₃	C₂₆H₄₂O₃	402.610		Biological activity : The affinity of the title compound for the intestinal vitamin D receptor and plasma vitamin D binding protein was 1 and 6% of that of 1,25-(OH)₂D₃, respectively. The in vitro effects on human promyeloid leukemia (HL-60 cell) differentiation and osteocalcin secretion by human osteosarcoma (MG-63) cells by the title compound were poor (2%). This compound showed no in vivo calcemic effects. (Ref. 0222)														Lower-half of the vitamin, silyl protected 1-ethynyl-1-cyclohexene-3S,5R-diol, was synthesized from shikimic acid in 8 steps in 25% overall yield. Palladium catalyzed coupling of the lower-half with upper-half (25-hydroxy-des-AB-cholest-8-en-8-yl triflate) yielded 6,7-didehydroprevitamin D which by partial hydrogenation followed by deprotection afforded the target vitamin, 1,25-(OH)₂-19-norpre-D₃. (Ref. 0230)				[0222] / [0230]
48		1a,25-dihydroxy-21-norvitamin D₃ / 1a,25-dihydroxy-21-norcholecalciferol	(5Z,7E)-(1S,3R)-21-nor-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0050	Sachiko Yamada	1a,25-(OH)₂-21-nor-D₃	C₂₆H₄₂O₃	402.610		Differentiation inducing activity of HL-60 (ED50):2.9 10^-⁸ M (1,25-(OH)₂D₃: 8.3 10^-⁹ M). Binding affinity for chick intestinal receptor: 1/10 of 1a,25-(OH)₂D₃. Calcemic activity at the dose of 500 mg/kg in normal mice ; 9.68 0.15 (1.25-(OH)₂D₃ ; 11.04 0.12 at 10mg/kg). (Ref. 0209)							lmax (EtOH) (nm) 262, lmin (nm) 227 (Ref. 0209)	(neat) 3380, 1470, 1450, 1375, 1060 cm^-¹ (Ref. 0209)	¹H-NMR (d) 0.44 (3H, s), 1.21 (6H, s), 1.25 (3H, br s), 4.14-4.28 (1H, br), 4.34-4.47 (1H, br), 5.00 (1H, s), 5.33 (1H, s), 6.01 (1H, d, J = 11.0 Hz), 6.38 (1H, d, J = 11.0 Hz) (Ref. 0209)	m/z 402 (M⁺), 134 (100%) (Ref. 0209)		Preparative TLC devbeloped twice with CH₂Cl₂-EtOH (50 : 7) (Ref. 0209)		Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method. (Ref. 0209)				[0209]
49		1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃ 3-oxide / 1a,25-dihydroxy-3-deoxy-3-thiacholecalciferol 3-oxide	(5E,7E)-(1R,3R)-1,25-dihydroxy-9,10-seco-3-thia-5,7,10(19)-cholestatriene 3-oxide	VVD0051	Sachiko Yamada	3-deoxy-3-thia-1a,25-(OH)₂ 3-oxide	C₂₆H₄₂O₃S	434.676		Affinity for chicken intestinal receptor : 27.0% of 1,25-(OH)₂D₃ effect. Inhibitory effect on 25-OHD₃ 1a-hydroxylase activity was evaluated. (Ref. 0306)							lmax (100% EtOH) (nm) (e) 268 (17500) (Ref. 0306)		¹H-NMR (d, CDCl₃, 300MHz) 0.53 (3H, s, 18C-CH₃), 0.94 (3H, d, J = 6.0 Hz, 21C-CH₃), 1.22 (6H, s, 26C- and 27C-CH₃), 2.80 (1H, br d, J = 11.7 Hz, 9b-H), 3.00 (1H, dd, J = 12.8, 9.2 Hz, 2-H), 3.20 (1H, d with fine structure, J = 12.8 Hz, 2-H), 3.55 and 3.65 (2H, AB pattern, J = 13.0 Hz, 4-H₂), 4.81 (1H, m, 1-H), 5.14 (1H, s, 19-H), 5.49 (1H, s, 19-H), 5.97 and 6.57 (2H, AB pattern, J = 11.1 Hz, 6- and 7-H) (Ref. 0306)	m/z 434 (3, M⁺), 416 (13, M⁺-H₂O), 399 (7), 381 (5), 367 (9), 350 (11), 323 (6), 305 (3), 287 (5), 239 (8), 225 (5), 213 (7), 197 (7), 185 (9), 171 (10), 159 (15), 145 (22), 133 (21), 119 (30), 107 (28), 95 (40), 81 (42), 69 (58), 59 (base) (Ref. 0306)				From corresponding 3-thiavitamin D (1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃) by oxidation with mCPBA followed by separation of epimers at S-3 by HPLC. (Ref. 0306)				[0306]
50		(5E)-(3S)-1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃ 3-oxide / (5E)-(3S)-1a,25-dihydroxy-3-deoxy-3-thiacholecalciferol 3-oxide	(5E,7E)-(1R,3S)-1,25-dihydroxy-9,10-seco-3-thia-5,7,10(19)-cholestatrien 3-oxide	VVD0052	Sachiko Yamada	(5E)-3-deoxy-3S-thia-1a,25-(OH)₂D₃ 3-oxide	C₂₆H₄₂O₃S	434.676		Affinity for chicken intestinal receptor : 0.8% of 1,25-(OH)₂D₃ effect. Inhibitory effect on 25-OHD₃ 1a-hydroxylase activity was evaluated. (Ref. 0306)							lmax (100% EtOH) (nm) (e) 272 (18000) (Ref. 0306)		¹H-NMR (d, CDCl₃, 300MHz) 0.53 (3H, s, 18C-CH₃), 0.93 (3H, d, J = 6.3 Hz, 21C-CH₃), 1.21 (6H, s, 26C- and 27C-CH₃), 2.76 (1H, dd, J = 14.0, 2.0 Hz, 2-H), 2.85 (1H, br d, J = 13.5 Hz, 9b-H), 3.47 (1H, ddd, J = 14.0, 3.0 Hz, 2-H), 3.60 and 3.80 (2H, AB pattern, J = 13.2 Hz, 4-H₂ ; the 3.80 signal was further split, d, J = 2.7 Hz), 4.62 (1H, m, 1-H), 5.08 (1H, d, J = 1.8 Hz, 19-H), 5.37 (1H, d, J = 1.8 Hz, 19-H), 6.05 and 6.72 (2H, AB pattern, J = 11.1 Hz, 6- and 7-H) (Ref. 0306)	m/z 434 (25, M⁺), 416 (52, M⁺-H₂O), 398 (50), 383 (24), 367 (31), 341 (93), 325 (77), 309 (25), 287 (23), 269 (28), 239 (27), 213 (58), 185 (55), 171 (68), 145 (62), 119 (base), 105 (30), 95 (57), 81 (53), 69 (78), 59 (56) (Ref. 0306)				From corresponding 3-thiavitamin D (1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃) by mCPBA oxidation followed by HPLC separation from 3-epimer. (Ref. 0306)				[0306]
51		(5Z)-1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃ 3-oxide / (5Z)-1a,25-dihydroxy-3-deoxy-3-thiacholecalciferol 3-oxide	(5Z,7E)-(1R,3R)-1,25-dihydroxy-9,10-seco-3-thia-5,7,10(19)-cholestatriene 3-oxide	VVD0053	Sachiko Yamada	(5Z)-3-deoxy-3-thia-1a,25-(OH)₂D₃ 3-oxide	C₂₆H₄₂O₃S	434.676		Affinity for chicken intestinal receptor : 3.7% of 1,25-(OH)₂D₃ effect. Inhibitory effect on 25-OHD₃ 1a-hydroxylase activity was evaluated. (Ref. 0306)							lmax (100% EtOH) (nm) (e) 272 (18000) (Ref. 0306)		¹H-NMR (d, CDCl₃, 300MHz) 0.56 (3H, s, 18C-CH₃), 0.94 (3H, d, J = 6.3 Hz, 21C-CH₃), 1.22 (6H, s, 26C- and 27C- CH₃), 2.85 (1H, br d, J = 12.6 Hz, 9b-H), 3.10 (1H, dd, J = 12.8, 3.0 Hz, 2-H), 3.30 (1H, ddd, J = 12.8, 7.3, 1.3 Hz, 2-H), 3.63 and 4.03 (2H, AB pattern, J = 13.1 Hz, 4-H₂), 4.88 (1H, m, 1-H), 5.16 (1H, br s, 19-H), 5.26 (1H, br s, 19-H), 5.86 and 6.78 (2H, AB pattern, J = 11.5 Hz, 6- and 7-H) (Ref. 0306)	m/z 434 (19, M⁺), 416 (48, M⁺-H₂O), 399 (21), 367 (25), 350 (55), 335 (11), 287 (19), 267 (13), 239 (32), 185 (26), 145 (63), 107 (83), 95 (base), 81 (97), 69 (11), 59 (16) (Ref. 0306)				From corresponding (5E)-vitamin D (1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃ 3-oxide) by geometrical isomerization catalyzed by iodine. (Ref. 0306)				[0306]
52		(5Z)-(3S)-1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃ 3-oxide / (5Z)-(3S)-1a,25-dihydroxy-3-deoxy-3-thiacholecalciferol 3-oxide	(5Z,7E)-(1R,3S)-1,25-dihydroxy-9,10-seco-3-thia-5,7,10(19)-cholestatrien 3-oxide	VVD0054	Sachiko Yamada	(5Z)-3-deoxy-3S-thia-1a,25-(OH)₂D₃ 3-oxide	C₂₆H₄₂O₃S	434.676		Affinity for chicken intestinal receptor : 0.9% of 1,25-(OH)₂D₃ effect. Inhibitory effect on 25-OHD₃ 1a-hydroxylase activity was evaluated. (Ref. 0306)							lmax (100% EtOH) (nm) (e) 270 (17800) (Ref. 0306)		¹H-NMR (d, CDCl₃, 300MHz) 0.57 (3H, s, 18C-CH₃), 0.94 (3H, d, J = 6.0 Hz, 21C-CH₃), 1.22 (6H, s, 26C- and 27C-CH₃), 2.77 (1H, dd, J = 13.9, 2.8 Hz, 2-H), 2.85 (1H, br d, J = 12.6 Hz, 9b-H), 3.40 (1H, d, J = 14.0 Hz, 4-H), 3.50 (1H, ddd, J = 13.9, 4.2, 2.6 Hz, 2-H), 4.30 (1H, dd, J = 14.0, 2.3 Hz, 4-H), 4.64 (1H, m, 1-H), 4.80 (1H, d, J = 10.2 Hz ; this has been assigned to the OH), 5.10 (1H, s, 19-H), 5.21 (1H, d, J = 1.2 Hz, 19-H), 5.86 and 6.96 (2H, AB pattern, J = 11.4 Hz, 6- and 7-H) (Ref. 0306)	m/z 434 (5, M⁺), 416 (11, M⁺-H₂O), 399 (5), 367 (9), 350 (14), 335 (4), 287 (6), 267 (5), 239 (8), 211 (6), 185 (9), 133 (25), 105 (32), 95 (46), 81 (49), 69 (64), 59 (base) (Ref. 0306)				From corresponding 3-thiavitamin D (1a,25-dihydroxy-3-deoxy-3-thiavitamin D₃) by mCPBA oxidation followed by iodine catalyzed isomerization. (Ref. 0306)				[0306]
53		1a,25-dihydroxy-22-thiavitamin D₃ / 1a,25-dihydroxy-22-thiacholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0055	Sachiko Yamada	22-thia-1a,25-(OH)₂D₃	C₂₆H₄₂O₃S	434.676									lmax (EtOH) (nm) 264, lmin (nm) 227 (Ref. 0215)	(neat) 3380, 2920, 1440, 1370, 1050 cm^-¹ (Ref. 0215)	¹H-NMR (d, CDCl₃, 200MHz) 0.58 (3H, s), 1.25 (6H, s), 1.39 (3H, d, J = 6.6 Hz), 2.63 (2H, t, J = 7.8 Hz), 4.17-4.30 (1H, br), 4.35-4.48 (1H, br), 5.00 (1H, s), 5.33 (1H, s), 6.01 (1H, d, J = 11.1 Hz), 6.37 (1H, d, J = 11.1 Hz) (Ref. 0215)		HRMS Calcd 434.2855, Found 434.2829 (Ref. 0215)			Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
54		1a,25-dihydroxy-22-thia-20-epivitamin D₃ / 1a,25-dihydroxy-22-thia-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0056	Sachiko Yamada	22-thia-1a,25-(OH)₂-20-epi-D₃	C₂₆H₄₂O₃S	434.676									lmax (EtOH) (nm) 264, lmin (nm) 227 (Ref. 0215)	(neat) 3390, 2920, 1450, 1380, 1060 cm^-¹ (Ref. 0215)	¹H-NMR (d, CDCl₃, 200MHz) 0.62 (3H, s), 1.25 (6H, s), 1.30 (3H, d, J = 6.6 Hz), 2.61 (2H, t, J = 8.3 Hz), 4.13-4.30 (1H, br), 4.36-4.48 (1H, br), 5.00 (1H, s), 5.33 (1H, s), 6.02 (1H, d, J = 11.1 Hz), 6.37 (1H, d, J = 11.1 Hz) (Ref. 0215)		HRMS Calcd 434.2855, Found 434.2837 (Ref. 0215)			Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
55		1a,25-dihydroxy-23-thiavitamin D₃ / 1a,25-dihydroxy-23-thiacholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-23-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0057	Sachiko Yamada	23-thia-1a,25-(OH)₂D₃	C₂₆H₄₂O₃S	434.676		Differentiation inducing activity of HL-60 was shown in comparison with 1,25-(OH)₂D₃. (Ref. 0210)							lmax (EtOH) (nm) 263, lmin (nm) 227 (Ref. 0210)		¹H-NMR (d, CDCl₃) 0.56 (3H, s), 1.10 (3H, d, J = 6.2 Hz), 1.28 (6H, s), 2.53-2.89 (2H, m), 2.63 (2H, s), 4.09-4.29 (1H, br), 4.36-4.49 (1H, br), 4.99 (1H, s), 5.32 (1H, s), 6.01 (1H, d, J = 11.4 Hz), 6.37 (1H, d, J = 11.4 Hz) (Ref. 0210)	m/z 434 (M⁺), 134 (100%) (Ref. 0210)		1)flash column chromatography using CH₂Cl₂-EtOH (5 : 0.3), 2)Preparative TLC developed twice with CH₂Cl₂-EtOH (10 : 1) (Ref. 0210)		Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method. (Ref. 0210)				[0210]
56		(24R)-1a,24-dihydroxy-22-oxavitamin D₃ / (24R)-1a,24-dihydroxy-22-oxacholecalciferol	(5Z,7E)-(1S,3R,24R)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0058	Sachiko Yamada	1a,24R-(OH)₂-22-oxa-D₃	C₂₆H₄₂O₄	418.609		The activity to induce differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : ED50 = 9.17 10^-⁹ M [ED50 of 1,25-(OH)₂D₃ : 3.76 10^-⁹ M, ED50 of OCT : 1.16 10^-⁹ M] the binding affinity for the chick embryonic intestinal 1,25-(OH)₂D₃ receptor : 0.016, 1,25-(OH)₂D₃ : 1, OCT : 0.17 (Ref. 0206)					[a] 46.00 (c = 0.1 in EtOH) (Ref. 0206)		lmax (EtOH) (nm) 263, lmin (nm) 227 (Ref. 0206)	(neat) 3390, 1470, 1450, 1375, 1055 cm^-¹ (Ref. 0206)	¹H-NMR (d, CDCl₃) 0.53 (3H, s), 0.90 (3H, d, J = 6.8 Hz), 0.97 (3H, d, J = 6.8 Hz), 1.18 (3H, d, J = 6.0 Hz), 3.08 (1H, t, J = 8.8 Hz), 3.20-3.32 (1H, m), 3.36-3.48 (1H, m), 3.67 (1H, dd, J = 3.0 and 9.1 Hz), 4.17-4.28 (1H, br), 4.37-4.48 (1H, br), 4.99 (1H, s), 5.33 (1H, s), 6.02 (1H, d, J = 11.4 Hz), 6.37 (1H, d, J = 11.4 Hz) (Ref. 0206)	m/z 418 (M⁺), 87 (100%) (Ref. 0206)	HRMS Calcd 418.3083, Found 418.3080 (Ref. 0206)			Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-[2(R)-hydroxy-3-methylbutyloxy]pregna-5,7-diene by photochemical method. (Ref. 0206)				[0206]
57		(24R)-1a,24-dihydroxy-22-oxa-20-epivitamin D₃ / (24R)-1a,24-dihydroxy-22-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,24R)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0059	Sachiko Yamada	1a,24R-(OH)₂-20-epi-22-oxa-D₃	C₂₆H₄₂O₄	418.609		The activity to induce differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : ED50 = 2.40 10^-⁸ M [ED50 of 1,25-(OH)₂D₃ : 3.76 10^-⁹ M, ED50 of OCT : 1.16 10^-⁹ M] the binding affinity for the chick embryonic intestinal 1,25-(OH)₂D₃ receptor : 0.16, 1,25-(OH)₂D₃ : 1, OCT : 0.17 (Ref. 0206)					[a] -30.68 (c = 0.365 in EtOH) (Ref. 0206)		(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0206)	(neat) 3400, 1450, 1370, 1110, 1060 cm^-¹ (Ref. 0206)	¹H-NMR (d, CDCl₃) 0.57 (3H, s), 0.91 (3H, d, J = 6.8 Hz), 0.98 (3H, d, J = 6.8 Hz), 1.10 (3H, d, J = 6.2 Hz), 3.23-3.40 (2H, m), 3.40-3.53 (2H, m), 4.16-4.28 (1H, br), 4.37-4.48 (1H, br), 4.99 (1H, s), 5.31 (1H, s), 5.99 (1H, d, J = 11.4 Hz), 6.38 (1H, d, J = 11.4 Hz) (Ref. 0206)	m/z 418 (M⁺), 87 (100%) (Ref. 0206)	HRMS Calcd 418.3083, Found 418.3080 (Ref. 0206)			Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(R)-[2(R)-hydroxy-3-methylbutyloxy]pregna-5,7-diene by photochemical method. (Ref. 0206)				[0206]
58		(24S)-1a,24-dihydroxy-22-oxavitamin D₃ / (24S)-1a,24-dihydroxy-22-oxacholecalciferol	(5Z,7E)-(1S,3R,24S)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0060	Sachiko Yamada	1a,24S-(OH)₂-22-oxa-D₃	C₂₆H₄₂O₄	418.609		The activity to induce differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation: ED50 = 1.37 10^-⁹ M [ED50 of 1,25-(OH)₂D₃ : 3.76 10^-⁹ M, ED50 of OCT : 1.16 10^-⁹ M] the binding affinity for the chick embryonic intestinal 1,25-(OH)₂D₃ receptor : 0.34, 1,25-(OH)₂D₃ : 1, OCT : 0.17. (Ref. 0206)					[a] 56.0 (c = 0.1 in EtOH) (Ref. 0206)		(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0206)	(neat) 3390, 1470, 1450, 1370, 1050 cm^-¹ (Ref. 0206)	¹H-NMR (d, CDCl₃) 0.53 (3H, s), 0.90 (3H, d, J = 6.8 Hz), 0.97 (3H, d, J = 6.6 Hz), 1.17 (3H, d, J = 6.2 Hz), 3.22-3.36 (2H, m), 3.36-3.49 (2H, m), 4.16-4.28 (1H, br), 4.37-4.48 (1H, br), 5.00 (1H, s), 5.34 (1H, s), 6.02 (1H, d, J = 11.4 Hz), 6.37 (1H, d, J = 11.4 Hz) (Ref. 0206)	m/z 418 (M⁺), 87 (100%) (Ref. 0206)	HRMS Calcd 418.3083, Found 418.3078 (Ref. 0206)			Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-[2(S)-hydroxy-3-methylbutyloxy]pregna-5,7-diene by photochemical method. (Ref. 0206)				[0206]
59		(24S)-1a,24-dihydroxy-22-oxa-20-epivitamin D₃ / (24S)-1a,24-dihydroxy-22-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,24S)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0061	Sachiko Yamada	1a,24S-(OH)₂-20-epi-22-oxa-D₃	C₂₆H₄₂O₄	418.609		The activity to induce differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : ED50 = 4.68 10^-⁸ M [ED50 of 1,25-(OH)₂D₃ : 3.76 10^-⁹ M, ED50 of OCT : 1.16 10^-⁹ M] the binding affinity for the chick embryonic intestinal 1,25-(OH)₂D₃ receptor : 0.003, 1,25-(OH)₂D₃ : 1, OCT : 0.17 (Ref. 0206)					[a] -24.24 (c = 0.165 in EtOH) (Ref. 0206)		(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0206)	(neat) 3390, 1450, 1370, 1055 cm^-¹ (Ref. 0206)	¹H-NMR (d, CDCl₃) 0.57 (3H, s), 0.90 (3H, d, J = 6.8 Hz), 0.97 (3H, d, J = 6.8 Hz), 1.10 (3H, d, J = 6.2 Hz), 3.10 (1H, t, J = 8.6 Hz), 3.24-3.35 (1H, m), 3.35-3.48 (1H, m), 3.61 (1H, dd, J = 3.0 and 9.1 Hz), 4.15-4.27 (1H, br), 4.26-4.34 (1H, br), 4.97 (1H, s), 5.30 (1H, s), 5.97 (1H, d, J = 11.4 Hz), 6.36 (1H, d, J = 11.4 Hz) (Ref. 0206)	m/z 418 (M⁺), 87 (100%) (Ref. 0206)	HRMS Calcd 418.3083, Found 418.3124 (Ref. 0206)			Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(R)-[2(S)-hydroxy-3-methylbutyloxy]pregna-5,7-diene by photochemical method. (Ref. 0206)				[0206]
60		1a,25-dihydroxy-22-oxavitamin D₃ / 1a,25-dihydroxy-22-oxacholecalciferol	(5Z,7E)-(1S,3R)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0062	Sachiko Yamada	1a,25-(OH)₂-22-oxa-D₃	C₂₆H₄₂O₄	418.609		The activity inducing differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : ED50 of OCT : 4.90 10^-⁹ M, ED50 of 1,25(OH)₂D₃ : 1.70 10^-⁸ M. the binding affinity for the chick embryonic intestinal 1,25-(OH)₂D₃ receptor : 12.5%, 1,25-(OH)₂D₃ : 100%. (Ref. 0203)							(EtOH) lmax (nm) 262, lmin (nm) 227 (Ref. 0203)	(KBr) 3390, 1370, 1145, 1085, 1050 cm^-¹ (Ref. 0203)	¹H-NMR (d, CDCl₃) 0.54 (3H, s), 1.18 (3H, d, J = 6.3 Hz), 1.23 (6H, s), 2.31 (1H, dd, J = 13.7, 6.6 Hz), 2.60 (1H, dd, J = 13.7, 3.4 Hz), 2.82 (1H, dd, J = 12.0, 1.7 Hz), 3.25 (1H, quintet, J = 6.3 Hz), 3.47 (1H, dt, J = 9.1, 5.4 Hz), 3.75-3.91 (2H, m), 4.16-4.30 (1H, m), 4.36-4.50 (1H, m), 4.98 (1H, t, J = 1.4 Hz), 5.32 (1H, t, J = 1.4 Hz), 6.02 (1H, d, J = 11.4 Hz), 6.36 (1H, d, J = 11.4 Hz) (Ref. 0208)	m/z 418 (M⁺), 69 (100%) (Ref. 0208)	colorless glass (Ref. 0208)	1) Flash column chromatography with CH₂Cl₂/EtOH (12.5 : 1), 2) Flash column chromatography with AcOEt/n-hexane (6 : 1) (Ref. 0203)		Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-(3-hydroxy-3-methylbutyloxy)pregna-5,7-diene by photochemical method. (Ref. 0203)	Metabolism of the title compound was studied in four cultured cell models representing liver, keratinocyte and osteoblast, and 24-hydroxylated and 26-hydroxylated derivatives as well as the side-chain cleaved molecules, hexanor-1a,20-dihydroxyvitamin D₃ and hexanor-20-oxo-1a-hydroxyvitamin D₃ were identified. (Ref. 0323)			[0203] / [0208] / [0323]
61		1a,25-dihydroxy-22-oxa-20-epivitamin D₃ / 1a,25-dihydroxy-22-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0063	Sachiko Yamada	1a,25-(OH)₂-20-epi-22-oxa-D₃	C₂₆H₄₂O₄	418.609		The activity to induce differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : ED50 = 1.46 10^-⁹ M [ED50 of 1,25-(OH)₂D₃ : 3.76 10^-⁹ M, ED50 of OCT: 1.16 10^-⁹ M] the binding affinity for the chick embryonic intestinal 1,25-(OH)₂D₃ receptor : 0.08, 1,25-(OH)₂D₃ : 1, OCT : 0.17 (Ref. 0206)					[a] -66.0 (c = 0.1 in EtOH) (Ref. 0206)		(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0206)	(neat) 3390, 1455, 1370, 1060 cm^-¹ (Ref. 0206)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 1.13 (3H, d, J = 6.0 Hz), 1.23 (6H, s), 3.16-3.32 (1H, m), 3.36-3.58 (1H, m), 3.70-3.90 (1H, m), 4.13-4.27 (1H, m), 4.34-4.48 (1H, br), 4.99 (1H, s), 5.30 (1H, s), 5.99 (1H, d, J = 11.6 Hz), 6.38 (1H, d, J = 11.6 Hz) (Ref. 0206)	m/z 418 (M⁺), 69 (100%) (Ref. 0206)	HRMS Calcd 418.3083, Found 418.3058 (Ref. 0206)			Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(R)-(3-hydroxy-3-methylbutyloxy)pregna-5,7-diene by photochemical method. (Ref. 0206)				[0206]
62		1b,25-dihydroxy-22-oxavitamin D₃ / 1b,25-dihydroxy-22-oxacholecalciferol	(5Z,7E)-(1R,3R)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0064	Sachiko Yamada	1b,25-(OH)₂-22-oxa-D₃	C₂₆H₄₂O₄	418.609		The antiproliferation activity on HL-60 was 0.003 [1.25-(OH)₂D₃ : 1]. The binding affinity for both vitamin D receptor and vitamin D binding protein was 0.7% of the effect of a,25-(OH)₂D₃. (Ref. 0214)							(EtOH) lmax (nm) 263, lmin (nm) 221 (Ref. 0214)		¹H-NMR (d, CDCl₃) 0.54 (3H, s), 1.19 (3H, d, J = 5.9 Hz), 1.24 (6H, s), 3.21-3.34 (1H, m), 3.43-3.55 (1H, m), 3.79-3.89 (1H, m), 4.05-4.15 (1H, m), 4.31-4.40 (1H, m), 5.00 (1H, s), 5.29 (1H, s), 6.06 (1H, d, J = 10.9 Hz), 6.44 (1H, d, J = 10.9 Hz) (Ref. 0214)	m/z 418 (M⁺), 69 (100%) (Ref. 0214)	HRMS Calcd 418.3083, Found 418.3112 (Ref. 0214)			Synthesis from OCT by inversion of the 1a-hydroxy group. (Ref. 0214)				[0214]
63		1a,25-dihydroxy-23-oxavitamin D₃ / 1a,25-dihydroxy-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0065	Sachiko Yamada	1a,25-(OH)₂-23-oxa-D₃	C₂₆H₄₂O₄	418.609		Activity of inducing HL-60 cell differentiation was compared with 1,25-(OH)₂D₃. (Ref. 0210)							lmax (EtOH) (nm) 263, lmin (nm) 227 (Ref. 0210)		¹H-NMR (d, CDCl₃) 0.57 (3H, s), 1.05 (3H, d, J = 6.2 Hz), 1.21 (6H, s), 3.11-3.47 (4H, m), 4.03-4.27 (1H, br), 4.35-4.47 (1H, br), 4.99 (1H, s), 5.35 (1H, s), 6.00 (1H, d, J = 11.4 Hz), 6.36 (1H, d, J = 11.4 Hz) (Ref. 0210)	m/z 418 (M⁺), 59 (100%) (Ref. 0210)		1)Flash column chromatography using CH₂Cl₂-EtOH (5 : 0.3), 2)Preparative TLC developed twice with CH₂Cl₂-EtOH (10 : 1) (Ref. 0210)		Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method.(Ref. 0210)				[0210]
64		1a,25-dihydroxy-22-oxa-[2b-³H]vitamin D₃ / 1a,25-dihydroxy-22-oxa-[2b-³H]cholecalciferol	(5Z,7E)-(1S,3R)-22-oxa-[2b-³H]-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0066	Sachiko Yamada	1a,25-(OH)₂-22-oxa-[2b-³H]-D₃	C₂₆H₄₁₃H₁O₄	793.563													15.0 Ci/mmol (Ref. 0218)			Synthesis by photochemical method from the [2b-³H]-5,7-diene. (Ref. 0218/0219)				[0218] / [0219]
65		1a,25-dihydroxy-20-oxa-[26,26,26-³H₃]vitamin D₃ / 1a,25-dihydroxy-20-oxa-[26,26,26-³H₃]cholecalciferol	(5Z,7E)-(1S,3R)-22-oxa-[26,26,26-³H₃]-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0067	Sachiko Yamada	1a,25-(OH)₂-22-oxa-[26,26,26-³H₃]-D₃	C₂₆H₃₉₃H₃O₄	775.420													86.5 Ci/mmol (Ref. 0218)			Synthesis by photochemical method from the [26,26,26-³H₃]-5,7-diene. (Ref. 0218)				[0218]
66		(20S)-1a,20,25-trihydroxy-24-norvitamin D₃/(20S)-1a,20,25-trihydroxy-24-norcholecalciferol	(5Z,7E)-(1S,3R,20S)-24-nor-9,10-seco-5,7,10(19)-cholestatriene-1,3,20,25-tetrol	VVD0068	Sachiko Yamada	1a,20S,25-(OH)₃-24-nor-D₃	C₂₆H₄₂O₄	418.609		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : <4% ; Binding for the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : <0.1% ; Calcemic activity : not determined. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by photochemical isomerization and deprotection. (Ref. 0279)				[0279]
67		(24R)-1a,24,25-trihydroxy-22-oxavitamin D₃ / (24R)-1a,24,25-trihydroxy-22-oxacholecalciferol	(5Z,7E)-(1S,3R,24R)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,24,25-tetrol	VVD0069	Sachiko Yamada	1a,24R,25-(OH)₃-22-oxa-D₃	C₂₆H₄₂O₅	434.609		The antiproliferation activity towards HL-60 was 1/2 of 22-oxacalcitriol (OCT). The binding affinity for bovine thymus vitamin D receptor was 1/3 of OCT. (Ref. 0213)					[a] 44.0 (c = 0.29 in EtOH) (Ref. 0212)		(EtOH) lmax (nm) 262, lmin (nm) 227 (Ref. 0212)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 1.19 (3H, d, J = 6.1 Hz), 1.22 (3H, s), 1.24 (3H, s), 3.26-3.32 (1H, m),3.37-3.47 (2H, m), 3.73-3.82 (1H, m), 4.16-4.27 (1H, m), 4.38-4.45 (1H, m), 4.99 (1H, s), 5.33 (1H, s), 6.02 (1H, d, J = 11.5 Hz), 6.37 (1H, d, J = 11.5 Hz) (Ref. 0212)	m/z 434 (M⁺), 134 (100%) (Ref. 0212)	Colorless foam. (Ref. 0213) HRMS Calcd 434.3032, Found 434.3023 (Ref. 0212)	Preparative TLC developed twice with AcOEt. (Ref. 0213)		Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0212/0213)				[0212] / [0213]
68		(24S)-1a,24,25-trihydroxy-22-oxavitamin D₃ / (24S)-1a,24,25-trihydroxy-22-oxacholecalciferol	(5Z,7E)-(1S,3R,24S)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,24,25-tetrol	VVD0070	Sachiko Yamada	1a,24S,25-(OH)₃-22-oxa-D₃	C₂₆H₄₂O₅	434.609		The antiproliferation activity towards HL-60 was 1/3 of 22-oxacalcitriol (OCT). The binding affinity for bovine thymus vitamin D receptor was 1/22 of OCT. (Ref. 0213)					[a] 29.0 (c = 0.19 in EtOH) (Ref. 0212)		(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0212)		¹H-NMR (d, CDCl₃) 0.54 (3H, s), 1.19 (3H, d, J = 5.8 Hz), 1.22 (3H, s), 1.25 (3H, s), 3.22-3.29 (1H, m),3.34-3.46 (2H, m), 3.76 (1H, br d, J = 6.3 Hz), 4.14-4.25 (1H, m), 4.37-4.44 (1H, m), 4.99 (1H, s), 5.33 (1H, s), 6.02 (1H, d, J = 11.0 Hz), 6.37 (1H, d, J = 11.0 Hz) (Ref. 0212)	m/z 434 (M⁺), 134 (100%) (Ref. 0212)	Colorless foam. (Ref. 0213) HRMS Calcd 434.3032, Found 434.3039 (Ref. 0212)	1)Preparative TLC developed twice with AcOEt. 2)Preparative TLC developed twice with CH₂Cl₂-EtOH (10 : 1). (Ref. 0213)		Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0212/0213)				[0212] / [0213]
69		(25R)-1a,25,26-trihydroxy-22-oxavitamin D₃ / (25R)-1a,25,26-trihydroxy-22-oxacholecalciferol	(5Z,7E)-(1S,3R,25R)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25,26-tetrol	VVD0071	Sachiko Yamada	1a,25R,26-(OH)₃-22-oxa-D₃	C₂₆H₄₂O₅	434.609		The antiproliferation activity towards HL-60 was 1/9 of 22-oxacalcitriol (OCT). The binding affinity for bovine thymus vitamin D receptor was 1/25 of OCT. (Ref. 0213)					[a] 49.35 (c = 0.08 in EtOH) (Ref. 0212)		(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0212)	(neat) 3375, 2920, 2865, 1050 cm^-¹ (Ref. 0212)	¹H-NMR (d, CDCl₃) 0.53 (3H, s), 1.18 (3H, s), 1.20 (3H, d, J = 7.3 Hz), 3.25-3.57 (4H, m), 3.81-3.93 (1H, m), 4.23 (1H, br s), 4.43 (1H, br s), 4.42 (1H, br s), 4.99 (1H, s), 5.33 (1H, s), 6.02 (1H, d, J = 11.6 Hz), 6.37 (1H, d, J = 11.6 Hz) (Ref. 0212)	m/z 434 (M⁺), 85 (100%) (Ref. 0212)	Colorless foam. (Ref. 0213) HRMS Calcd 434.3032, Found 434.3048 (Ref. 0212)	1)Preparative TLC developed twice with AcOEt-EtOH (25 : 1). 2)Preparative TLC developed with CH₂Cl₂-EtOH (20 : 3). (Ref. 0213)		Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0212/0213)				[0212] / [0213]
70		(25S)-1a,25,26-trihydroxy-22-oxavitamin D₃ / (25S)-1a,25,26-trihydroxy-22-oxacholecalciferol	(5Z,7E)-(1S,3R,25S)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25,26-tetrol	VVD0072	Sachiko Yamada	1a,25S,26-(OH)₃-22-oxa-D₃	C₂₆H₄₂O₅	434.609		The antiproliferation activity towards HL-60 was 1/7 of 22-oxacalcitriol (OCT). The binding affinity for bovine thymus vitamin D receptor was 1/30 of OCT. (Ref. 0213)					[a] 65.85 (c = 0.09 in EtOH) (Ref. 0212)		(EtOH) lmax (nm) 264, lmin (nm) 227 (Ref. 0212)	(neat) 3385, 2920, 2865, 1050, 730 cm^-¹ (Ref. 0212)	¹H-NMR (d, CDCl₃) 0.54 (3H, s), 1.19 (3H, s), 1.19 (3H, d, J = 5.9 Hz), 3.21-3.34 (1H, m), 3.42 (2H, s), 3.44-3.61 (1H, m), 3.69-3.81 (1H, m), 4.22 (1H, br s), 4.43 (1H, br s), 5.00 (1H, s), 5.33 (1H, s), 6.02 (1H, d, J = 11.2 Hz), 6.37 (1H, d, J = 11.2 Hz) (Ref. 0212)	m/z 434 (M⁺), 85 (100%) (Ref. 0212)	Colorless foam. (Ref. 0213) HRMS Calcd 434.3032, Found 434.3048 (Ref. 0212)	1)Preparative TLC developed twice with AcOEt-EtOH (25 : 1). 2)Preparative TLC developed with CH₂Cl₂-EtOH (20 : 3). (Ref. 0213)		Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0212/0213)				[0212] / [0213]
71		25-azavitamin D₃ / 25-azacholecalciferol	(5Z,7E)-(3S)-25-aza-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0073	Sachiko Yamada	25-aza-D₃	C₂₆H₄₃NO	385.626									(EtOH) lmax (nm) 265 (Ref. 0360)		¹H-NMR (d, CDCl₃) 6.24 and 6.03 (2 H, AB, J = 11Hz, H-6 and -7), 5.05 (1 H, m, H-19), 4.82 (1 H, m, H-19), 3.95 (1 H, tt, J = 7.4 and 3.7 Hz, H-3), 2.31 (6 H, s, H-26 and 27), 0.93 (3 H, J = 6 Hz, H-21), 0.54 (3 H, s, H-18) (Ref. 0360)	m/z (rel. intensity) 385 (M⁺, 15), 370 (3), 352 (1), 84 (10), 71 (4), 58 (100) (Ref. 0360)				From C(22) tosyloxysteroid via reaction sith dimethyl acetamide as key step. (Ref. 0369)				[0360] / [0369]
72		1a,25-dihydroxy-23-azavitamin D₃ / 1a,25-dihydroxy-23-azacholecalciferol	(5Z,7E)-(1S,3R)-23-aza-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0074	Sachiko Yamada	23-aza-1a,25-(OH)₂D₃	C₂₆H₄₃NO₃	417.625		Differentiation inducing activity of HL-60 was shown in comparison with 1,25-(OH)₂D₃. (Ref. 0210)							(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0210)		¹H-NMR (d, CDCl₃) 0.57 (3H, s), 1.02 (3H, d, J = 6.2 Hz), 1.23 (6H, s), 2.51 (2H, s), 4.11-4.28 (1H, br),4.31-4.50 (1H, br), 4.99 (1H, s), 5.32 (1H, s), 6.01 (1H, d, J = 11.4 Hz), 6.37 (1H, d, J = 11.4 Hz) (Ref. 0210)	m/z 417 (M⁺), 43 (100%) (Ref. 0210)		Preparative TLC developed with CH₂Cl₂-EtOH (3 : 1). (Ref. 0210)		Synthesis from dehydroepiandrostertone via 5,7-diene compound by photochemical method. (Ref. 0210)				[0210]
73		1a-hydroxy-24-(dimethylphosphoryl)-25,26,27-trinorvitamin D₃ / 1a-hydroxy-24-(dimethylphosphoryl)-25,26,27-trinorcholecalciferol	(5Z,7E)-(1S,3R)-24-(dimethylphosphoryl)-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0075	Sachiko Yamada	24-(dimethylphosphoryl)-1a-OH-25,26,27-trinor-D₃	C₂₆H₄₃O₃P	434.592		Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption in chick, 0.3% ; Bone calcium mobilization in chick, 0.15% ; Competitive binding to the vitamin D receptor in chick intestine, 0.35% ; Inhibition of clonal growth of human leukemia cells (HL-60), ED50 was not reached. (Ref. 0238)					[a]_D +33.1 (c = 0.95 in CH₂Cl₂) (Ref. 0283)		(EtOH) lmax (nm) (e) 265 (14700), 212 (12700) (Ref. 0283)	(Film) 3380, 2940, 2890, 1650, 1305, 1235, 1060 cm^-¹ (Ref. 0283)	¹H-NMR (d, CD₂Cl₂, 500MHz) 6.34 (1H, d, J = 11.3 Hz), 6.02 (1H, d, J = 11.3 Hz), 5.29 (1H, m), 4.95 (1H, m), 4.36 (1H, dd, J = 4.3 and 7.9 Hz), 4.15 (1H, m), 2.83 (1H, m), 2.54 (1H, m), 2.26 (1H, dd, J = 6.5 and 13.3 Hz), 2.01-1.46 (16H, m), 1.42 (6H, d, J = 12.5 Hz), 1.36-1.16 (6H, m), 0.95 (3H, d, J = 6.5 Hz), 0.55 (3H, s) (Ref. 0283) ³¹P-NMR (d, CD₂Cl₂, 18.8MHz) 43.90 (Ref. 0283)					By Wittig-Horner coupling of upper half of the title compound with lower half phosphine oxide. (Ref. 0283)				[0238] / [0283]
74		24-(dimethoxyphosphoryl)-25,26,27-trinorvitamin D₃ / 24-(dimethoxyphosphoryl)-25,26,27-trinorcholecalciferol	(5Z,7E)-(3S)-24-(dimethoxyphosphoryl)-9,10-seco-5,7,10(19)-cholatrien-3-ol	VVD0076	Sachiko Yamada	24-(dimethoxyphosphoryl)-25,26,27-trinor-D₃	C₂₆H₄₃O₄P	450.591							[a]_D +27.0 (c = 0.73 in CH₂Cl₂) (Ref. 0283)		(EtOH) lmax (nm) (emax) 264 (14700) (Ref. 0283)	(Film) 3400, 2950, 2890, 1640, 1233, 1060, 1035 cm^-¹ (Ref. 0283)	¹H-NMR (d, d₆-acetone, 250MHz) 6.25 (1H, d, J = 11.2 Hz), 6.08 (1H, d, J = 11.2 Hz), 5.03 (1H, m), 4.75 (1H, m), 3.78 (1H, m), 3.64 (6H, d, J = 10.7 Hz), 2.91-1.04 (26H, m), 0.97 (3H, d, J = 6.0 Hz), 0.58 (3H, s) (Ref. 0283) ³¹P-NMR (d, d₆-acetone, 18.8MHz) 35.56 (Ref. 0283)					By Wittig-Horner coupling of upper half of the title compound with lower half phosphine oxide. The upper half was prepared from CD-ring 24-iodide by reaction with trimethylphosphite. (Ref. 0283)				[0283]
75		1a-hydroxy-24-(dimethoxyphosphoryl)-25,26,27-trinorvitamin D₃ / 1a-hydroxy-24-(dimethoxyphosphoryl)-25,26,27-trinorcholecalciferol	(5Z,7E)-(1S,3R)-24-(dimethoxyphosphoryl)-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0077	Sachiko Yamada	24-(dimethoxyphosphoryl)-1a-OH-25,26,27-trinor-D₃	C₂₆H₄₃O₅P	466.590		Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption in chick, 0.2% ; Bone calcium mobilization in chick, 0.13% ; Competitive binding to the vitamin D receptor in chick intestine, 6.98% ; Inhibition of clonal growth of human leukemia cells (HL-60), ED50 was not reached. (Ref. 0238)					[a]_D +38.3 (c = 0.98 in CH₂Cl₂) (Ref. 0283)		(EtOH) lmax (nm) (e) 264 (18100), 211 (17000) (Ref. 0283)	(Film) 3390, 2944, 2890, 1645, 1235, 1054, 1030 cm^-¹ (Ref. 0283)	¹H-NMR (d, d₆-acetone, 250MHz) 6.30 (1H, d, J = 11.1 Hz), 6.10 (1H, d, J = 11.1 Hz), 5.32 (1H, m), 4.87 (1H, m), 3.69 (6H, d, J = 10.7 Hz), 2.51 (1H, m), 2.29 (1H, m), 2.06-1.20 (22H, m), 0.97 (3H, d, J = 6.0 Hz), 0.92-0.90 (1H, m), 0.59 (3H, s) (Ref. 0283) ³¹P-NMR (d, d₆-acetone, 18.8MHz) 35.69 (Ref. 0283)					By Wittig-Horner coupling of upper half of the title compound with lower half phosphine oxide. The upper half was prepared from CD-ring 24-iodide by reaction with trimethylphosphite. (Ref. 0283)				[0238] / [0283]
76		1a,25-dihydroxy-19-norvitamin D₃ / 1a,25-dihydroxy-19-norcholecalciferol	(7E)-(1R,3R)-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0078	Sachiko Yamada	1a,25-(OH)₂-19-nor-D₃	C₂₆H₄₄O₃	404.626		The affinity of the title compound for the intestinal vitamin D receptor and plasma vitamin D binding protein was 30% and 20% of that of 1,25-(OH)₂D₃, respectively. The in vitro effects on human promyeloid leukemia (HL-60 cell) differentiation and osteocalcin secretion by human osteosarcoma (MG-63) cells by the title compound were nearly identical to those of 1,25-(OH)₂D₃. The in vivo calcemic effects was less than 10% of that of 1,25-(OH)₂D₃. (Ref. 0222)																		[0222]
77		1,25-dihydroxy-2-nor-1,2-secovitamin D₃ / 1,25-dihydroxy-2-nor-1,2-secocholecalciferol	(5Z,7E)-A-nor-(1,2)-(9,10)-diseco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0079	Sachiko Yamada	1,25-(OH)₂-2-nor-1,3-seco-D₃	C₂₆H₄₄O₃	404.626																From 25,26-dehydro-8-enol triflate CD ring synthon and ring A precursor, 2-methyll-3-ethynyl-2,3-dehydro-d-butyrolactone. Coupling of the two precursors was followed by catalytic partial hydrogenation, oxymercuration-demercuration (25-hydroxy introduction), and DIBAL reduction afforded the title compound after spontaneous 1,7-hydrogen shift. (Ref. 0330)				[0330]
78		26,26,26,27,27,27-hexadeuterio-1a-fluoro-25-hydroxy-16,17,23,23,24,24-hexadehydrovitamin D₃ / 26,26,26,27,27,27-hexadeuterio-1a-fluoro-25-hydroxy-16,17,23,23,24,24-hexadehydrocholecalciferol	(5Z,7E)-(1S,3R)-26,26,26,27,27,27-hexadeuterio-1-fluoro-9,10-seco-5,7,10(19),16-cholestatetraen-23-yne-3,25-diol	VVD0080	Sachiko Yamada	1a-F-25-OH-16,17,23,23,24,24-hexadehydro-[26,26,26,27,27,27-²H]D₃	C₂₇H₃₁D₆FO₂	418.532		Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption in chick, 0.5% ; Bone calcium mobilization in chick, 0.2% ; Competitive binding to the vitamin D receptor in chick intetine, 5.3%, and HL-60 cells, 9.2% ; Inhibition of clonal growth of human leukemia cells (HL-60), 571%. (Ref. 0238) Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption in chick, 0.2% ; Bone calcium mobilization in chick, 0.02% ; Competitive binding to the vitamin D receptor in chick intetine, 26%, and in human leukemia (HL-60) cells, 55% ; Inhibition of clonal growth of HL-60 cells, 52% ; Differentiation of HL-60 cells, 103%. (Ref. 0239)																		[0238] / [0239]
79		1a,26,26,26,27,27,27-heptafluoro-25-hydroxy-16,17,23,23,24,24-hexadehydrovitamin D₃ / 1a,26,26,26,27,27,27-heptafluoro-25-hydroxy-16,17,23,23,24,24-hexadehydrocholecalciferol	(5Z,7E)-(1S,3R)-1,26,26,26,27,27,27-heptafluoro-9,10-seco-5,7,10(19),16-cholestatetraen-23-yne-3,25-diol	VVD0081	Sachiko Yamada	1a,26,26,26,27,27,27-F₇-25-OH-16,17,23,23,24,24-hexadehydro-D₃	C₂₇H₃₁F₇O₂	520.523		Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption in chick, 0.5% ; Bone calcium mobilization in chick, 0.2% ; Competitive binding to the vitamin D receptor in chick intetine, 5.3%, and HL-60 cells, 9.2% ; Inhibition of clonal growth of human leukemia cells (HL-60), 571%. (Ref. 0238)																		[0238]
80		26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxy-16,17,23,23,24,24-hexadehydrovitamin D₃ / 26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxy-16,17,23,23,24,24-hexadehydrocholecalciferol	(5Z,7E)-(1S,3R)-26,26,26,27,27,27-hexadeuterio-9,10-seco-5,7,10(19),16-cholestatetraen-23-yne-1,3,25-triol	VVD0082	Sachiko Yamada	[26,26,26,27,27,27-²H]-1a,25-(OH)₂-16,17,23,23,24,24-hexadehydro-D₃	C₂₇H₃₂D₆O₃	416.541		Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption in chick, 0.4% ; Bone calcium mobilization in chick, 1.2% ; Competitive binding to the vitamin D receptor in chick intetine, 86%, and in human leukemia (HL-60) cells, 46% ; Inhibition of clonal growth of HL-60 cells, 233% ; Differentiation of HL-60 cells, 300%. (Ref. 0239)																		[0239]
81		26,26,26,27,27,27-hexafluoro-25-hydroxy-16,17,23,23,24,24-hexadehydrovitamin D₃ / 26,26,26,27,27,27-hexafluoro-25-hydroxy-16,17,23,23,24,24-hexadehydrocholecalciferol	(5Z,7E)-(3S)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19),16-cholestatetraen-23-yne-3,25-diol	VVD0083	Sachiko Yamada	26,26,26,27,27,27-F₆-25-OH-16,17,23,23,24,24-hexadehydro-D₃	C₂₇H₃₂F₆O₂	502.532		Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption in chick, 0.13 ; Bone calcium mobilization in chick, 2.0 ; Competitive binding to the vitamin D receptor in chick intetine, 0.58, and HL-60 cells, 2.03 ; Inhibition of clonal growth of human leukemia cells (HL-60), 72. (Ref. 0238)																		[0238]
82		26,26,26,27,27,27-hexafluoro-1a,25-dihydroxy-16,17,23,23,24,24-hexadehydrovitamin D₃ / 26,26,26,27,27,27-hexafluoro-1a,25-dihydroxy-16,17,23,23,24,24-hexadehydrocholecalciferol	(5Z,7E)-(1S,3R)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19),16-cholestatetraen-23-yne-1,3,25-triol	VVD0084	Sachiko Yamada	26,26,26,27,27,27-F₆-1a,25-(OH)₂-16,17,23,23,24,24-hexadehydro-D₃	C₂₇H₃₂F₆O₃	518.532		Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption in chick, 6.7% ; Bone calcium mobilization in chick, 10.4% ; Competitive binding to the vitamin D receptor in chick intetine, 45%, and HL-60 cells, 31% ; Inhibition of clonal growth of human leukemia cells (HL-60), 8000%. (Ref. 0238)																		[0238]
83		26,26,26,27,27,27-hexafluoro-25-hydroxy-23,23,24,24-tetradehydrovitamin D₃ / 26,26,26,27,27,27-hexafluoro-25-hydroxy-23,23,24,24-tetradehydrocholecalciferol	(5Z,7E)-(3S)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,25-diol	VVD0086	Sachiko Yamada	26,26,26,27,27,27-F₆-25-OH-23,23,24,24-tetradehydro-D₃	C₂₇H₃₄F₆O₂	504.548		(% of 1,25-(OH)₂D₃ effect) Affinity for chick intestinal receptor: 0.18%; Affinity for human vitamin D binding protein: 470%. (Ref. 0359)																		[0359]
84		26,26,26,27,27,27-hexafluoro-1a,25-dihydroxy-23,23,24,24-tetradehydrovitamin D₃ / 26,26,26,27,27,27-hexafluoro-1a,25-dihydroxy-23,23,24,24-tetradehydrocholecalciferol	(5Z,7E)-(1S,3R)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,25-triol	VVD0087	Sachiko Yamada	26,26,26,27,27,27-F₆-1a,25-(OH)₂-23,23,24,24-tetradehydro-D₃	C₂₇H₃₄F₆O₃	520.547		Cell differentiation: 10 times as active as 1,25-(OH)₂D₃ ; hypercalcemic activity: 2 times as active as 1,25-(OH)₂D₃. (Ref. 0356)																		[0356]
85		(22E)-26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R)-26,26,26,27,27,27-hexadeuterio-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0088	Sachiko Yamada	(22E)-1a,25-(OH)₂-22,23-didehydro-[26,26,26,27,27,27-²H]D₃	C₂₇H₃₆D₆O₃	420.573
86		24,24,26,26,26,27,27,27-octadeuterio-1a,25-dihydroxyvitamin D₃ / 24,24,26,26,26,27,27,27-octadeuterio-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-24,24,26,26,26,27,27,27-octadeuterio-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0089	Sachiko Yamada	1a,25-(OH)₂-[24,24,26,26,26,27,27,27-²H]D₃	C₂₇H₃₆D₈O₃	424.573		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 106 ; Bone calcium mobilization in rat, 147 ; Competitive binding to rat intestinal vitamin D receptor, 100 ; Differentiation of human leukemia cells (HL-60), 100. (Ref. 0237)																		[0237]
87		(22E)-26,26,26,27,27,27-hexafluoro-25-hydroxy-22,23-didehydrovitamin D₃ / (22E)-26,26,26,27,27,27-hexafluoro-25-hydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(3S)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19),22-cholestatetraene-3,25-diol	VVD0090	Sachiko Yamada	26,26,26,27,27,27-F₆-25-OH-22,23-didehydro-D₃	C₂₇H₃₆F₆O₂	506.564									(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0197)			m/z 506, 473, 271, 253, 136, 118 (Ref. 0197)				The provitamin D constructed from hexafluoro C(5) side chain sulfone and C(22)-steroid aldehyde was converted to the title vitamin D compound by photochemical method. (Ref. 0197)				[0197]
88		(22E)-26,26,26,27,27,27-hexafluoro-1a,25-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-26,26,26,27,27,27-hexafluoro-1a,25-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0091	Sachiko Yamada	(22E)-26,26,26,27,27,27-F₆-1a,25-(OH)₂-22,23-didehydro-D₃	C₂₇H₃₆F₆O₃	522.563		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 221 ; Bone calcium mobilization in rat, 110 ; Competitive binding to rat intestinal vitamin D receptor, 62 ; Differentiation of human leukemia cells (HL-60), 3000. (Ref. 0237)																		[0237]
89		(23E)-26,26,26,27,27,27-hexafluoro-1a,25-dihydroxy-23,24-didehydrovitamin D₃ / (23E)-26,26,26,27,27,27-hexafluoro-1a,25-dihydroxy-23,24-didehydrocholecalciferol	(5Z,7E,23E)-(1S,3R)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19),23-cholestatetraene-1,3,25-triol	VVD0092	Sachiko Yamada	(23E)-26,26,26,27,27,27-F₆-1a,25-(OH)₂-23,24-didehydro-D₃	C₂₇H₃₆F₆O₃	522.563		Differentiation of HL-60 cells: 10 times more potent than 1,25-(OH)₂D₃.(Ref. 0356)																		[0356]
90		26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxyvitamin D₃ / 26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-26,26,26,27,27,27-hexadeuterio-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0093	Sachiko Yamada	1a,25-(OH)₂-[26,26,26,27,27,27-²H]D₃	C₂₇H₃₈D₆O₃	422.589		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 92 ; Bone calcium mobilization in rat, 64 ; competitive binding to rat intestinal vitamin D receptor, 100 ; differentiation of human leukemia cells (HL-60), 100. (Ref. 0237) Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for rat intestinal receptor : 100 ; Calf intestinal receptor: 100; Intestinal calcium absorption, 92 ; Bone calcium mobilization, 64. (Ref. 0329)									¹H-NMR (d, CD₂Cl₂) 6.33 and 5.98 (2H, AB pattern, d, J = 12.4 Hz, 6- and 7-H), 5.26 (1H, m, 19E-H), 4.93 (1H, br s, 19Z-H), 4.34 (1H, m, 1-H), 4.13 (1H, m, 3-H), 0.90 (3H, d, J = 6.2 Hz, 21C-CH₃), 0.51 (3H, s, 18C-CH₃) (Ref. 0195) ¹³C-NMR (d, CD₂Cl₂) 148.7 (C), 143.5 (C), 133.9 (C), 125.1 (CH), 117.6 (CH), 111.8 (C-19), 71.2 (CH), 70.8, 67.2 (CH), 57.1, 56.8, 46.3, 45.8, 44.8, 43.5, 40.9, 36.9, 36.5, 29.4, 28.0, 24.0, 22.6, 21.2, 19.0, 12.1 (Ref. 0195)					The upper half was synthesized from CD-ring 8,22-diol 22-tosylate via introduction of acetylene unit, reaction with acetone-d₆, catalytic hydrogenation, and oxidation. Wittig-Horner coupling of the upper half synthon with ring A phosphine oxide afforded the title compound. (Ref. 0329) From protected 1a-hydroxy-26,27-dinorvitamin D₃ 25-carboxylate via reaction with CD₃MgI. (Ref. 0195)				[0195] / [0237] / [0329]
91		1a-fluoro-25-hydroxy-16,17,23,23,24,24-hexadehydrovitamin D₃ / 1a-fluoro-25-hydroxy-16,17,23,23,24,24-hexadehydrocholecalciferol	(5Z,7E)-(1S,3R)-1-fluoro-9,10-seco-5,7,10(19),16-cholestatetraen-23-yne-3,25-diol	VVD0094	Sachiko Yamada	1a-F-25-OH-16,17,23,23,24,24-hexadehydro-D₃	C₂₇H₃₇FO₂	412.580		Biological activity (% of 1,25-(OH)₂D₃ effect) : Intestinal calcium absorption in chick, 0.03 ; Bone calcium mobilization in chick, 0.08 ; Competitive binding to the vitamin D receptor in chick intetine, 24, and in human leukemia (HL-60) cells, 35 ; Inhibition of clonal growth of HL-60 cells, 61 ; Differentiation of HL-60 cells, 417. (Ref. 0239)																		[0239]
92		26,26,26,27,27,27-hexafluoro-1aa-hydroxyvitamin D₃ / 26,26,26,27,27,27-hexafluoro-1aa-hydroxycholecalciferol	(5Z,7E)-(1S,3R)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0095	Sachiko Yamada	26,26,26,27,27,27-F₆-1a-OHD₃	C₂₇H₃₈F₆O₂	508.580		Biological activity (% of 1,25-(OH)₂D₃ effect) : Binding affinity for chick intestinal and HL-60 cell receptor : both 1.4. Inhibition of proliferation and induction of differentiation of HL-60 cells : 100. (Ref. 0247)																		[0247]
93		26,26,26,27,27,27-hexafluoro-25-hydroxyvitamin D₃ / 26,26,26,27,27,27-hexafluoro-25-hydroxycholecalciferol	(5Z,7E)-(3S)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0096	Sachiko Yamada	26,26,26,27,27,27-F₆-25-OHD₃	C₂₇H₃₈F₆O₂	508.580		The title compound was equipotent with 25-OHD₃ in stimulating intestinal calcium transport, bone calcium mobilization, bone mineralization, epiphyseal plate calcification, and elevation of serum inorganic phosphorus. Bilateral nephrectomy eliminates the response of intestine and bone to this compound suggesting that this compound must be 1a-hydroxylated to be functional. (Ref. 0305)							(EtOH) lmax (nm) (emax) 264 (18000) lmin (nm) (emin) 227.5 (8600) (Ref. 0200)			m/z 508 (M⁺), 493, 490, 476, 271, 253, 136, 118 (Ref. 0200)				From 24-tosyloxy-5-cholene derivative via reaction of 24-sulfone with trifluoroacetone as key step. (Ref. 0200)				[0200] / [0305]
94		6,19-epidioxy-26,26,26,27,27,27-hexafluoro-25-hydroxy-6,19-dihydrovitamin D₃ / 6,19-epidioxy-26,26,26,27,27,27-hexafluoro-25-hydroxy-6,19-dihydrocholecalciferol	(7E)-(3S)-6,19-epidioxy-26,26,26,27,27,27-hexafluoro-9,10-seco-5(10),7-cholestadiene-3,25-diol	VVD0097	Sachiko Yamada	6,19-epidioxy-26,26,26,27,27,27-F₆-25-OH-6,19-dihydro-D₃	C₂₇H₃₈F₆O₄	540.579		Binding affinity for the vitamin D receptor in HL-60 cells : 1/1500 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : 1/30 as active as 1,25-(OH)₂D₃. (Ref. 0339)										m/z 540 (M⁺), 522, 508, 504, 402, 384, 371, 330, 285 (Ref. 0339)				As a major product by the reaction of 26,26,26,27,27,27-hexafluoro-25-hydroxyvitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0339)				[0339]
95		26,26,26,27,27,27-hexafluoro-1a,24-dihydroxyvitamin D₃ / 26,26,26,27,27,27-hexafluoro-1a,24-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0098	Sachiko Yamada	26,26,26,27,27,27-F₆-1a,24-(OH)₂D₃	C₂₇H₃₈F₆O₃	524.579		Biological activity (% of 1,25-(OH)₂D₃ effect) : Binding affinity for chick intestinal and HL-60 cell receptor : 66 and 100, respectively. Inhibition of proliferation and induction of differentiation of HL-60 cells : 1000. (Ref. 0247)																		[0247]
96		26,26,26,27,27,27-hexafluoro-1a,25-dihydroxyvitamin D₃ / 26,26,26,27,27,27-hexafluoro-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0099	Sachiko Yamada	26,26,26,27,27,27-F₆-1a,25-(OH)₂D₃	C₂₇H₃₈F₆O₃	524.579		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 229 ; Bone calcium mobilization in rat, 137 ; Competitive binding to rat intestinal vitamin D receptor, 82 ; Differentiation of human leukemia cells (HL-60), 2000. (Ref. 0237) Biological activity (% of 1,25-(OH)₂D₃ effect) : Binding affinity for chick intestinal and HL-60 cell receptor : 33 and 100, respectively. Inhibition of proliferation and induction of differentiation of HL-60 cells : 1000. (Ref. 0247) The activity to induce vitamin D 24-hyddroxylase in HL-60 cells : 4 times as potent as 1,25-(OH)₂D₃. (Ref. 0269)							lmax (nm) 264.5, lmin (nm) 228 (Ref. 0287)			m/z 524 (M⁺), 506, 488, 473, 462, 383, 287, 269, 251, 152, 134 (Ref. 0287)				From cholenic acid via reaction of 24-sulfone derivative with hexafluoroacetone as key step. (Ref. 0287)	Metabolism of 26,27-F₆-1,25-(OH)₂D₃ in vitamin D-deficient rat was studied and 26,26,26,27,27,27-hexafluoro-1,23S,25-trihydroxyvitamin D₃ was idenfified as major metabolite found in intestine (Ref. 0270) In HL-60 cells pre-treated with 10^-⁹ M 26,27-F₆-1,25-(OH)₂D₃, 26,27-F₆-1,25-(OH)₂[1b-³H]D₃ was mainly metabolized to 26,26,26,27,27,27-hexafluoro-1,23S,25-trihydroxyvitamin D₃. (Ref. 0269)			[0237] / [0247] / [0269] / [0270] / [0287]
97		(23S)-26,26,26,27,27,27-hexafluoro-1a,23,25-trihydroxyvitamin D₃ / (23S)-26,26,26,27,27,27-hexafluoro-1a,23,25-trihydroxycholecalciferol	(5Z,7E)-(1S,3R,23S)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,23,25-tetrol	VVD0100	Sachiko Yamada	26,26,26,27,27,27-F₆-1a,23S,25-(OH)₃D₃	C₂₇H₃₈F₆O₄	540.579		Binding affinity for chick intestinal receptor: 2-3 times less active than 1,25-(OH)₂ D₃ ; Intestinal calcium transport: comparable to 1,25-(OH)₂ D₃.. (Ref. 0270)										TMS ether: spectrum (Ref. 0270)		HPLC: (Ref. 0270)			Major intestinal metabolite produced from 26,27-F₆ -1,25-(OH)₂ D₃ . (Ref. 0270)			[0270]
98		25-hydroxy-16,17,23,23,24,24-hexadehydrovitamin D₃ / 25-hydroxy-16,17,23,23,24,24-hexadehydrocholecalciferol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19),16-cholestatetraen-23-yne-3,25-diol	VVD0101	Sachiko Yamada	25-OH-16,17,23,23,24,24-hexadehydro-D₃	C₂₇H₃₈O₂	394.589		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 72 ; Bone calcium mobilization in rat, 0 ; Competitive binding to rat intestinal vitamin D receptor, 0.07 ; Differentiation of human leukemia cells (HL-60), 1. (Ref. 0237)																		[0237]
99		(22E)-1a-hydroxy-24-oxo-26,27-cyclo-22,23-didehydrovitamin D₃ / (22E)-1a-hydroxy-24-oxo-26,27-cyclo-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R)-1,3-dihydroxy-26,27-cyclo-9,10-seco-5,7,10(19),22-cholestatetraen-24-one	VVD0102	Sachiko Yamada	(22E)-1a-OH-24-oxo-22,23-didehydro-26,27-cyclo-D₃	C₂₇H₃₈O₃	410.589																From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via Wittig-Horner coupling with side chain fragment, followed by photochemical isomerization and deprotection. (Ref. 0289)	Isolated as a metabolite produced from 1a,24S-dihydroxy-26,27-cyclo-22,23-didehydrovitamin D₃ (calcipotriol, MC903). (Ref. 0322)			[0289] / [0322]
100		24,25-epoxy-1a-hydroxy-22,22,23,23-tetradehydrovitamin D₃ / 24,25-epoxy-1a-hydroxy-22,22,23,23-tetradehydrocholecalciferol	(5Z,7E)-(1S,3R)-24,25-epoxy-9,10-seco-5,7,10(19)-cholestatrien-22-yne-1,3-diol	VVD0103	Sachiko Yamada	24,25-epoxy-1a-OH-22,22,23,23-tetradehydro-D₃ / 24,25-epoxy-1a-OH-22-yne-D₃	C₂₇H₃₈O₃	410.589		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 2 and 5 respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 3, 100 and 20, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : all <1. (Ref. 0240)														By epoxidation of the corresponding olefinic precursor which was constructed from Inhoffen-Lythgoe diol. (Ref. 0240)				[0240]
101		25,26-epoxy-1a-hydroxy-23,23,24,24-tetradehydrovitamin D₃ / 25,26-epoxy-1a-hydroxy-23,23,24,24-tetradehydrocholecalciferol	(5Z,7E)-(1S,3R)-25,26-epoxy-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3-diol	VVD0104	Sachiko Yamada	25,26-epoxy-1a-OH-23,23,24,24-tetradehydro-D₃ / 25,26-epoxy-1a-OH-23-yne-D₃	C₂₇H₃₈O₃	410.589		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 30 and 6 respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 240, 150 and 127, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : 1, 2, 0.4 and 2 ,respectively. (Ref. 0240)														By epoxidation of the corresponding olefinic precursor which was constructed from Inhoffen-Lythgoe diol. (Ref. 0240)				[0240]
102		25,26-epoxy-1a-hydroxy-23,23,24,24-tetradehydro-20-epivitamin D₃ / 25,26-epoxy-1a-hydroxy-23,23,24,24-tetradehydro-20-epicholecalciferol	(5Z,7E)-(1S,3R,20S)-25,26-epoxy-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3-diol	VVD0105	Sachiko Yamada	25,26-epoxy-1a-OH-23,23,24,24-tetradehydro-20-epi-D₃ / 25,26-epoxy-1a-OH-23-yne-20-epi-D₃	C₂₇H₃₈O₃	410.589		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 30 and 0, respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63), and breast carcinoma (MCF-7) cells : 2000, 3000 and 4000, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium, and duodenal calbindin in rachitic chicks : 3, 1, 1 and 1, respectively. (Ref. 0240)														By epoxidation of the corresponding olefinic precursor which was constructed from Inhoffen-Lythgoe diol. (Ref. 0240)				[0240]
103		1a,25-dihydroxy-16,17,23,23,24,24-hexadehydrovitamin D₃ / 1a,25-dihydroxy-16,17,23,23,24,24-hexadehydrocholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19),16-cholestatetraen-23-yne-1,3,25-triol	VVD0106	Sachiko Yamada	1a,25-(OH)₂-16,17,23,23,24,24-hexadehydro-D₃	C₂₇H₃₈O₃	410.589		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 10000 ; Intestinal calcium absorption in rat, 53 ; Bone calcium mobilization in rat, 0 ; Competitive binding to rat intestinal vitamin D receptor, 51; Differentiation of human leukemia cells (HL-60), 1000. (Ref. 0237) Biological activity (% of 1,25-(OH)₂D₃ effect ) : Intestinal calcium absorption in chick, 3.3 ; Bone calcium mobilization in chick, 2 ; Competitive binding to the vitamin D receptor in chick intetine, 75, and HL-60 cells, 79. (Ref. 0238) Survival of BALB/c mice received myeloid leukemic cells (WEHI 3BD+): Mice treated with the title compound (1.6 mg q.o.d.) had a significantly longer survival, with the last mouse dying of leukemia on day 50. (Ref. 0328)														By Wittig-horner coupling of upper CD-ring plus side chain part and the lower A-ring phophine oxide. The 16-ene CD-side chain part was synthesized from a 1-ethylideneperhydroindan derivative via ene reaction with 4-hydroxy-4-methylpentynal derivative as the key step. (Ref. 0358)				[0237] / [0238] / [0328] / [0358]
104		1a,25-dihydroxy[26,26,26,27,27,27-³H₆]vitamin D₃ / 1a,25-dihydroxy[26,26,26,27,27,27-³H₆]cholecalciferol / [26,26,26,27,27,27-³H₆]calcitriol	(5Z,7E)-(1S,3R)-[26,26,26,27,27,27-³H₆]-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0107	Sachiko Yamada	1a,25-(OH)₂-[26,26,26,27,27,27-³H₆]D₃ / [26,26,26,27,27,27-³H₆]calcitriol	C₂₇H₃₈T₆O₃	428.589									lmax (95% EtOH) (nm) 262 (Ref. 0235)			m/z 428 (M⁺), 410 (M⁺-H₂O, 9), 392 (M⁺-2H₂O, 10), 287 (M⁺-side chain, 3), 285 (287-2H, 4), 269 (287-H₂O, 5), 267 (285-H₂O, 3), 152 (ring A plus carbons 6 and 7, 29), 134 (152-H₂O, 100), 71 [(C³H₃)₂ C-OH]⁺, 100]; spectrum (Ref. 0235)		HPLC comparisons of 1a,25-(OH)₂[26,27-³H]D₃, prepared by chemical or enzymatic synthesis, to authentic unlabeled 1a,25-(OH)₂D₃. The UV peak of unlabeled 1a,25-(OH)₂D₃ was distinguishable from that of 1a,25-(OH)₂[26,27-³H]D₃.(Ref. 0235)		From 26,27-dinorvitamin D₃ 25-carboxylic acid via 1a-hydroxylation through 3,5-cyclovitamin D followed by treatment with [³H]methylmagnesium bromide [80 Ci/mmol) (Ref. 0235)				[0235]
105		(22E)-(25R)-26,26,26-trideuterio-1a,25-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(25R)-26,26,26-trideuterio-1a,25-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,25R)-26,26,26-trideuterio-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0108	Sachiko Yamada	(22E)-1a,25R-(OH)₂-22,23-didehydro-[26,26,26-²H]D₃	C₂₇H₃₉D₃O₃	417.597		Affinity for chick intestinal receptor: 133% of the effect of 1,25-(OH)₂D₃. (Ref. 0359)																		[0359]
106		(22E)-(25S)-26,26,26-trideuterio-1a,25-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(25S)-26,26,26-trideuterio-1a,25-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,25S)-26,26,26-trideuterio-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0109	Sachiko Yamada	(22E)-1a,25S-(OH)₂-22,23-didehydro-[26,26,26-²H]D₃	C₂₇H₃₉D₃O₃	417.597		Affinity for chick intestinal receptor: 125% of the effect of 1,25-(OH)₂D₃. (Ref. 0359)																		[0359]
107		9,9,14,19,19-pentadeuterio-1a,25-dihydroxyvitamin D₃ / 9,9,14,19,19-pentadeuterio-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-9,9,14,19,19-pentadeuterio-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0110	Sachiko Yamada	1a,25-(OH)₂-[9,9,14,19,19-²H]D₃	C₂₇H₃₉D₅O₃	421.597		The activities of the title compound in binding to the chick and pig intestinal nuclear 1,25-(OH)₂D₃ receptors, in inducing differentiation of HL-60 cell, and inhibiting proliferation and inducing the production of osteocalcin in MG-63 cells were approximately same as those of 1,25-(OH)₂D₃. (Ref. 0226)														Convergent synthesis by combining upper-half fragment (9,14-dideuterio-25-hydroxy-des-AB-cholest-8-en-8-yl triflate) with lower-half fragment (silyl protected 19,19,19-trideuterio-1-ethynyl-2-methyl-1-cyclohexen-3S,5R-diol). The lower-half was synthesized starting from (S)-(+)-carvone and the upper half from Inhoffen-Lythgoe diol obtained by ozonolysis of vitamin D₂. (Ref. 0231)				[0226] / [0231]
108		9,14,19,19,19-pentadeuterio-1a,25-dihydroxyprevitamin D₃ / 9,14,19,19,19-pentadeuterio-1a,25-dihydroxyprecholecalciferol	(6Z)-(1S,3R)-9,14,19,19,19-pentadeuterio-9,10-seco-5(10),6,8-cholestatriene-1,3,25-triol	VVD0111	Sachiko Yamada	1a,25-(OH)₂-pre-[9,14,19,19,19-²H]D₃	C₂₇H₃₉D₅O₃	421.597		The title compound was as active as 1,25-(OH)₂D₃ in two nongenomic systems, transcaltachia as measured in the perfused chick kidney intestine and ⁴⁵Ca²⁺ uptake through voltage-gated Ca²⁺ channels in ROS 17/2.8 cells. This compound was significantly less active both in binding in vitro to the plasma vitamin D-binding protein (7%) and to the chick (10%) and pig (4%) intestinal nuclear 1,25-(OH)₂D₃ receptors generating genomic biological responses in vivo (induction of plasma levels of osteocalcin, <5%) or in culture cells (inhibition of HL-60 cell differentiation, <5% ; inhibition of MG-63 proliferation, <2% ; and induction of osteocalcin, <2%). (Ref. 0226)														Convergent synthesis by combining upper-half synthon (9,14-dideuterio-25-hydroxy-des-AB-cholest-8-en-8-yl triflate) with lower-half synthon (silyl protected 19,19,19-trideuterio-1-ethynyl-2-methyl-1-cyclohexen-3S,5R-diol). The lower-half was synthesized starting from (S)-(+)-carvone and the upper half synthon from Inhoffen-Lythgoe diol obtained by ozonolysis of vitamin D₂. (Ref. 0231)				[0226] / [0231]
109		(22E)-(25R)-26,26,26-trifluoro-1a,25-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(25R)-26,26,26-trifluoro-1a,25-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,25R)-26,26,26-trifluoro-9,10-seco-5,7,10(19),22-cholestatetraene-1,25-diol	VVD0112	Sachiko Yamada	(22E)-26,26,26-F₃-1a,25R-(OH)₂-22,23-didehydro-D₃	C₂₇H₃₉F₃O₃	468.592		(% of 1,25-(OH)₂D₃ effect) Affinity for chick intestinal receptor: 57% (Ref. 0359); Induction of differentiation of HL-60 cells: 300% (Ref. 0356)																		[0356] / [0359]
110		(22E)-(25S)-26,26,26-trifluoro-1a,25-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(25S)-26,26,26-trifluoro-1a,25-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,25S)-26,26,26-trifluoro-9,10-seco-5,7,10(19),22-cholestatetraene-1,25-diol	VVD0113	Sachiko Yamada	(22E)-26,26,26-F₃-1a,25S-(OH)₂-22,23-didehydro-D₃	C₂₇H₃₉F₃O₃	468.592		(% of 1,25-(OH)₂D₃ effect) Affinity for chick intestinal receptor: 40% (Ref. 0359); Induction of differentiation of HL-60 cells: 4000% (Ref. 0356)																		[0356] / [0359]
111		calicoferol A	(22E)-(8S)-3-hydroxy-9,10-seco-1,3,5(10),22-cholestatetraen-9-one	VVD0114	Sachiko Yamada	calicoferol A	C₂₇H₄₀O₂	396.605		Toxic against brine shrimp larvae. (Ref. 0317)													Isolated from a gorgonian of the genus Calicogorgia. (Ref. 0318)					[0317] / [0318]
112		25-hydroxy-16,17,23,24-tetradehydrovitamin D₃ / 25-hydroxy-16,17,23,24-tetradehydrocholecalciferol	(5Z,7E,23E)-(3S)-9,10-seco-5,7,10(19),16,23-cholestapentaene-3,25-diol	VVD0115	Sachiko Yamada	25-OH-16,17,23,24-tetradehydro-D₃	C₂₇H₄₀O₂	396.605		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Competitive binding to rat intestinal vitamin D receptor, 0.12 ; Differentiation of human leukemia cells (HL-60), 0.5. (Ref. 0237)																		[0237]
113		(23Z)-25-hydroxy-16,17,23,24-tetradehydrovitamin D₃ / (23Z)-25-hydroxy-16,17,23,24-tetradehydrocholecalciferol	(5Z,7E,23Z)-(3S)-9,10-seco-5,7,10(19),16,23-cholestapentaene-3,25-diol	VVD0116	Sachiko Yamada	(23Z)-25-OH-16,17,23,24-tetradehydro-D₃	C₂₇H₄₀O₂	396.605		Affinity for rat intestinal receptor: 0.8%. (Ref. 0358)														From CD-ring plus side chain fragment and A-ring phosphine oxide by Wittig-Horner coupling. (Ref. 0358)				[0358]
114		25-hydroxy-23,23,24,24-tetradehydrovitamin D₃ / 25-hydroxy-23,23,24,24-tetradehydrocholecalciferol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19)-cholestatrien-23-yne-3,25-diol	VVD0117	Sachiko Yamada	25-OH-23,23,24,24-tetradehydro-D₃	C₂₇H₄₀O₂	396.605		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 71 ; Bone calcium mobilization in rat, 0 ; Competitive binding to rat intestinal vitamin D receptor, 0.06 ; Differentiation of human leukemia cells (HL-60), 1. (Ref. 0237)																		[0237]
115		1a-hydroxy-24-oxo-26,27-cyclovitamin D₃ / 1a-hydroxy-24-oxo-26,27-cyclocholecalciferol	(5Z,7E)-(1S,3R)-1,3-dihydroxy-26,27-cyclo-9,10-seco-5,7,10(19)-cholestatrien-24-one	VVD0118	Sachiko Yamada	1a-OH-24-oxo-26,27-cyclo-D₃	C₂₇H₄₀O₃	412.605		(% of 1,25-(OH)₂ D₃effect) Affinity for calf thymus receptor: 0.5%; Transcriptional activity: 12.5%. (Ref. 0322)												HPLC chart. (Ref. 0322)			Produced as a metabolite of 1a,24S-dihydroxy-26,27-cyclo-22,23-didehydrovitamin D₃ (Calcipotriol, VVD0121) and further metabolized to 23-hydroxylated compound. (Ref. 0322)			[0322]
116		(22E)-25-hydroxy-24-oxo-22,23-didehydrovitamin D₃ / (22E)-25-hydroxy-24-oxo-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(3S)-3,25-dihydroxy-9,10-seco-5,7,10(19),22-cholestatetraen-24-one	VVD0119	Sachiko Yamada	(22E)-25-OH-24-oxo-22,23-didehydro-D₃	C₂₇H₄₀O₃	412.605									(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0193)			high resoultion MS: m/z 412.2989 (Ref. 0193)				From Ergosterol via side chain introduction to 5,7-diene protected C(22)-aldehyde. (Ref. 0193)				[0193]
117		(22E)-(24R)-1a,24-dihydroxy-26,27-cyclo-22,23-didehydrovitamin D₃ / (22E)-(24R)-1a,24-dihydroxy-26,27-cyclo-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,24R)-26,27-cyclo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24-triol	VVD0120	Sachiko Yamada	(22E)-1a,24R-(OH)₂-26,27-cyclo-22,23-didehydro-D₃	C₂₇H₄₀O₃	412.605			Et₂O-hexane :143-145 C (Ref. 0289)						lmax (nm) (emax) 264 (17000) (Ref. 0289)		¹H-NMR (d, CDCl₃) 0.15-0.65 (4H, m), 0.56 (3H, s), 0.75-1.10 (1H, m), 1.05 (3H, d, J = 7.0 Hz), 3.47 (1H, m), 4.2 (1H, m), 4.4 (1H, m), 4.99 (1H, m), 5.31 (1H, m), 5.50 (2H, m), 5.99 and 6.36 (each 1H, d, J = 11.0 Hz) (Ref. 0289)	m/z 412 (M⁺, 5), 394 (8), 379 (1), 376 (5), 287 (5), 285 (6), 283 (7), 269 (10), 267 (5), 265 (4), 251 (10), 152 (27), 134 (100) (Ref. 0289)				From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via Wittig-Horner coupling with side chain fragment, reduction, separation of 24-epimers, photochemical isomerization and deprotection. (Ref. 0289)				[0289]
118		(22E)-(24S)-1a,24-dihydroxy-26,27-cyclo-22,23-didehydrovitamin D₃ / (22E)-(24S)-1a,24-dihydroxy-26,27-cyclo-22,23-didehydrocholecalciferol / Calcipotriol	(5Z,7E,22E)-(1S,3R,24S)-26,27-cyclo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24-triol	VVD0121	Sachiko Yamada	(22E)-1a,24S-(OH)₂-26,27-cyclo-22,23-didehydro-D₃	C₂₇H₄₀O₃	412.605		Activity relative to 1,25-(OH)₂D₃ (defined 100%) : Affinity for the receptor in U937 cells (human histiocytic lymphoma cell line) : 200 ; Antiproliferative effects on U937 cells : 200 ; Induction of differentiation of U937 cells : 100 ; Calciuric effect: <0.5. (Ref. 0309) This compound named calcipotriol (Leo laboratory code MC903) is the first active vitamin D analog to receive governmental approval to be used as an anti-proliferative agent in the treatment of psoriasis. (Ref. 0327)	(Methyl formate) 166-158 C (Ref. 0289)						lmax (nm) (e) 264 (17200) (Ref. 0289)		¹H-NMR (d, CDCl₃) 0.15-0.65 (4H, m), 0.56 (3H, s), 0.75-1.10 (1H, m), 1.05 (3H, d, J = 7.0 Hz), 3.45 (1H, m), 4.2 (1H, m), 4.4 (1H, m), 4.99 (1H, m), 5.31 (1H, m), 5.47 (2H, m), 5.99 (1H, d, J = 11.0 Hz), 6.36 (1H, d, J = 11.0 Hz) (Ref. 0289)	m/z 412 (M⁺, 6), 394 (8), 379 (2), 376 (5), 287 (5), 285 (7), 283 (8), 269 (11), 267 (6), 265 (4), 251 (12), 152 (26), 134 (100) (Ref. 0289)				From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D3 via Wittig-Horner coupling with side chain fragment, reduction, separation of 24-epimers, photochemical isomerization and deprotection. (Ref. 0289)	The in vitro metabolism of the title compound (calcipotriol) was studied in two keratinocyte cell models. Calcipotriol was initially converted into the 24-ketone and its 22,23-dihydro-derivative. Further metabolites such as two 23-epimeric 23-hydroxylated 22,23-dihydro-24-oxo-derivatives, two 23,24-dihydroxy-derivatives and side chain-cleavage products, tetranor-1,23-(OH)₂D₃ and calcitroic acid. (Ref. 0322)			[0289] / [0309] / [0322] / [0327]
119		(22E)-(24R)-1a,24-dihydroxy-26,27-cyclo-22,23-didehydro-20-epivitamin D₃ / (22E)-(24R)-1a,24-dihydroxy-26,27-cyclo-22,23-didehydro-20-epicholecalciferol	(5Z,7E,22E)-(1S,3R,20S,24R)-26,27-cyclo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24-triol	VVD0122	Sachiko Yamada	(22E)-1a,24R-(OH)₂-20-epi-22,23-didehydro-26,27-cyclo-D₃ / (22E)-1a,24R-(OH)₂-20-epi-22-ene-26,27-cyclo-D₃	C₂₇H₄₀O₃	412.605		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U 937 cells, 130% ; Induction of differentiation of U 937 cells, 100% ; Calciuric effects on normal rats, <1%. (Ref. 0284)														From protected (5E)-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by Wittig-Horner reaction followed by reduction, dye-sensitized photoisomerization and deprotection. (Ref. 0284)				[0284]
120		(22E)-(24S)-1a,24-dihydroxy-26,27-cyclo-22,23-didehydro-20-epivitamin D₃ / (22E)-(24S)-1a,24-dihydroxy-26,27-cyclo-22,23-didehydro-20-epicholecalciferol	(5Z,7E,22E)-(1S,3R,20S,24S)-26,27-cyclo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24-triol	VVD0123	Sachiko Yamada	(22E)-1a,24S-(OH)₂-20-epi-22,23-didehydro-26,27-cyclo-D₃ / (22E)-1a,24S-(OH)₂-20-epi-22-ene-26,27-cyclo-D₃	C₂₇H₄₀O₃	412.605		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U 937 cells, 60% ; Induction of differentiation of U 937 cells, 10% ; Calciuric effects on normal rats, <1%. (Ref. 0284)														From protected (5E)-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by Wittig-Horner reaction followed by reduction, dye-sensitized photoisomerization and deprotection. (Ref. 0284)				[0284]
121		(23E)-1a,25-dihydroxy-16,17,23,24-tetradehydrovitamin D₃ / (23E)-1a,25-dihydroxy-16,17,23,24-tetradehydrocholecalciferol	(5Z,7E,23E)-(1S,3R)-9,10-seco-5,7,10(19),16,23-cholestapentaene-1,3,25-triol	VVD0124	Sachiko Yamada	1a,25-(OH)₂-16,17,23,24-tetradehydro-D₃	C₂₇H₄₀O₃	412.605		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Competitive binding to rat intestinal vitamin D receptor, 80 ; Differentiation of human leukemia cells (HL-60), 300. (Ref. 0237)																		[0237]
122		(23Z)-1a,25-dihydroxy-16,17,23,24-tetradehydrovitamin D₃ / (23Z)-1a,25-dihydroxy-16,17,23,24-tetradehydrocholecalciferol	(5Z,7E,23Z)-(1S,3R)-9,10-seco-5,7,10(19),16,23-cholestapentaene-1,3,25-triol	VVD0125	Sachiko Yamada	(23Z)-1a,25-(OH)₂-16,17,23,24-tetradehydro-D₃ / (23Z)-1a,25-(OH)₂-16,23-diene-D₃	C₂₇H₄₀O₃	412.605		(% of 1,25-(OH)₂D₃ effect) Affinity for rat intestinal receptor: 145%; Affinity for human vitmin D binding protein: 17%; HL-60 cell differentiation: 100. (Ref. 0359)																		[0359]
123		(22R)-1a,25-dihydroxy-22,23,23,24-tetradehydrovitamin D₃ / (22R)-1a,25-dihydroxy-22,23,23,24-tetradehydrocholecalciferol	(5Z,7E)-(1S,3R,22R)-9,10-seco-5,7,10(19),22,23-cholestapentaene-1,3,25-triol	VVD0126	Sachiko Yamada	(22R)-1a,25-(OH)₂-22,23,23,24-tetradehydro-D₃	C₂₇H₄₀O₃	412.605		(% of 1,25-(OH)₂D₃ effect) Affinity for chick intestinal receptor: 52%; Affinity for human vitmin D binding protein: 48%. (Ref. 0359)																		[0359]
124		(22S)-1a,25-dihydroxy-22,23,23,24-tetradehydrovitamin D₃ / (22S)-1a,25-dihydroxy-22,23,23,24-tetradehydrocholecalciferol	(5Z,7E)-(1S,3R,22S)-9,10-seco-5,7,10(19),22,23-cholestapentaene-1,3,25-triol	VVD0127	Sachiko Yamada	(22S)-1a,25-(OH)₂-22,23,23,24-tetradehydro-D₃	C₂₇H₄₀O₃	412.605		(% of 1,25-(OH)₂D₃ effect) Affinity for chick intestinal receptor: 21%; Affinity for human vitmin D binding protein: 25%. (Ref. 0359)																		[0359]
125		1a,25-dihydroxy-23,23,24,24-tetradehydrovitamin D₃ / 1a,25-dihydroxy-23,23,24,24-tetradehydrocholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,25-triol	VVD0128	Sachiko Yamada	1a,25-(OH)₂-23,23,24,24-tetradehydro-D₃	C₂₇H₄₀O₃	412.605		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 95 ; Bone calcium mobilization in rat, 15 ; Competitive binding to rat intestinal vitamin D receptor, 39 ; Differentiation of human leukemia cells (HL-60), 300. (Ref. 0237)																		[0237]
126		(22E,24E)-1a,26a-dihydroxy-22,23,24,25-tetradehydro-26a-homo-27-norvitamin D₃ / (22E,24E)-1a,26a-dihydroxy-22,23,24,25-tetradehydro-26a-homo-27-norcholecalciferol	(5Z,7E,22E,24E)-(1S,3R)-26a-homo-27-nor-9,10-seco-5,7,10(19),22,24-cholestapentaene-1,3,26a-triol	VVD0129	Sachiko Yamada	(22E,24E)-1a,26a-(OH)₂-22,23,24,25-tetradehydro-26a-homo-27-nor-D₃	C₂₇H₄₀O₃	412.605		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 300% ; Induction of differentiation of U 937 cells, 200% ; Calciuric activity, 1%. (Ref. 0288)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by Wittig reaction, reduction, photoisomerization and deprotection. (Ref. 0288)				[0288]
127		(23R,25R)-25-hydroxyvitamin D₃ 26,23-lactone / (23R,25R)-25-hydroxycholecalciferol 26,23-lactone	(5Z,7E)-(3S,23R,25R)-3,25-dihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-lactone	VVD0130	Sachiko Yamada	25R-OHD₃ 26,23R-lactone	C₂₇H₄₀O₄	428.604									lmax (nm) 265 (Ref. 0117)		¹H-NMR (d, CDCl₃, 400MHz) 6.23, 6.02 (2H, AB q, J = 10 Hz, 6-, 7-H), 5.04, 4.81 (2H, m, 19-H), 4.77 (1H, m, 23-H), 3.96 (1H, m, 3a-H), 1.52 (3H, s, 27-H), 1.02 (3H, d, J = 6 Hz, 21-H), 0.57 (3H, s, 18-H) (Ref. 0117)	m/z 428 (M⁺, 98), 413 (M⁺-Me, 6), 411 (6), 410 (M⁺-H₂O, 22), 395 (M⁺-H₂O-Me, 100), 369 (28), 253 (54) (Ref. 0117)				Synthesis from C(22) steroid aldehyde via iodolactonization of 22-ene-26-carboxylic acid as a key step. (Ref. 0117/0122) Stereoselective synthesis of 23-epimers of 25R-OHD₃ 26,23-lactones from C(22)-steroid aldehyde and chiral side chain synthon prepared from (R)-citramalic acid. (Ref. 0113)				[0113] / [0117] / [0122]
128		(23S,25R)-25-hydroxyvitamin D₃ 26,23-lactone / (23S,25R)-25-hydroxycholecalciferol 26,23-lactone	(5Z,7E)-(3S,23S,25R)-3,25-dihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-lactone	VVD0131	Sachiko Yamada	25R-OHD₃ 26,23S-lactone	C₂₇H₄₀O₄	428.604		Dose-response of 25-OHD₃-26,23-lactone on intestinal calcium transport and bone calcium mobilization in vitamin D-deficient rats on a low calcium diet.: Table (Ref. 0112) Effect of prior dosing of 25-OHD₃-26,23-lactone on intestinal calcium transport and bone calcium mobilizing activity of 1,25-(OH)2D3 in vitamin D-deficient rats.: Table (Ref. 0112) Ability of 25-OHD₃ and 25-OHD₃-26,23 lactone stereoisomers to competitively inhibit binding of 25-OH[³H]D₃ to the 4.2s rat plasma vitamin D binding protein and competitively inhibit 1,25-(OH)₂[³H]D₃ binding to the 3.7s 1,25-(OH)₂D₃ cytosol receptor: Table (Ref. 0119)							lmax (nm) 264, lmin (nm) 229 (Ref. 0111) lmax(nm) 265, lmin (nm) 228 (Ref. 0115)	(CCl₄) 1784 cm^-¹ (Ref. 0115)	¹H-NMR (d, CDCl₃) spectrum (Ref. 0111) ¹H-NMR (d, CDCl₃) 6.28 (1H, d, J = 11.8 Hz, C-6), 6.03 (1H, d, J = 10.7 Hz, C-7), 5.05 (1H, m, C-19E), 4.82 (1H, m, C-19Z), 4.44 (1H, m, C-23), 3.96 (1H, m, C-3), 1.49 (3H, s, C-27), 1.03 (3H, d, J = 5.2 Hz, C-21), 0.56 (3H, s, C-18) (Ref. 0115) ¹H-NMR (d, CDCl₃, 400 MHz) 6.22, 6.03 (2H), 5.05 (1H), 4.82 (1H), 4.43 (1H), 3.95 (1H), 1.51 (3H), 1.03 (3H), 0.56 (3H) (Ref. 0117)	m/z 428 (27.6, M⁺), 410 (4.1, M⁺-H₂O), 395 (12.0, M⁺-H₂O-CH₃), 271 (4.5, M⁺-side chain), 253 (9.3, M⁺-side chain-H₂O), 136 (100, A ring+C₆+C₇⁺ : A ring fragment⁺) 118 (94, A ring fragment⁺-H₂O) spectrum (Ref. 0111) m/z 428.2919 (calcd, 428.2926) (26%, M⁺), 410 (2%, M⁺-H₂O), 395 (9%, M⁺-H₂O-CH₃). 271 (1%, M⁺-side chain), 253 (8%, M⁺-side chain-H₂O), 136 [100%, (A ring+C₆+C₇)⁺], 118 [83%, (A ring+C₆+C₇)⁺-H₂O] (Ref. 0115) m/z 428 (97, M⁺), 413 (10), 411 (9), 410 (25), 395 (100), 369 (28), 253 (22) (Ref. 0117)	CD : four isomers (23S,25S) [q]₂₃₀ = 3.04 10³, (23R,25R) [q]₂₃₀ = 4.95 10⁴, (23S,25R) [q]₂₂₅ = -8.08 10², (23R,25S) [q]₂₂₅ = -3.7 10³.; spectra (Ref. 0114)	HPLC : (Ref. 0114)	Isolation and Identification from blood plasma of Chickens given either maintenance leueles or large doses of vitamin D₃. (Ref. 0111) Isolation and identification from vitamin D supplemented rat kidney homogenates incubated with 24,25-(OH)₂D₃. (Ref. 0118)	Stereoselective synthesis starting with C(22)-steroid aldehyde and chiral C(5)-side chain synthon (Ref. 0113/0123) and determination of the stereochemistry at C(23) and C(25) of natural metabolite.(Ref. 0113) Synthesis of four diastereomers at C(23) and C(25) of 25-OHD₃ 26,23-lactone from C(22) steroid and the determination of the stereochemistry of the natural product. (Ref. 0114) Synthesis of four diastereomers at C(23) and C(25) of 25-OHD₃ 26,23-lactone from 3b-acetoxy-24-nor-5,7-choladien-23-carboxylic acid ester. (Ref. 0115) Synthesis of four diastereomers at C(23) and C(25) of 25-OHD₃ 26,23-lactone from C(22) steroid aldehyde via vinylation and orthoester claisen rearrangement as a key step. The stereochemistries at C(23) and C(25) were determined by X-ray analysis. (Ref. 0116/0117) All four possible stereoisomers of 25-OHD₃ 26,23-lactone were synthesized from norcholadienoic acid. (Ref. 0121)	The role of kidney in the production of 25-OHD₃ 26,23-lactone and 1,25-(OH)₂D₃ 26,23-lactone was demonstrated. (Ref. 0120)			[0111] / [0112] / [0113] / [0114] / [0115] / [0116] / [0117] / [0118] / [0119] / [0120] / [0121] / [0123]
129		(23R,25S)-25-hydroxyvitamin D₃ 26,23-lactone / (23R,25S)-25-hydroxycholecalciferol 26,23-lactone	(5Z,7E)-(3S,23R,25S)-3,25-dihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-lactone	VVD0132	Sachiko Yamada	25S-OHD₃ 26,23R-lactone	C₂₇H₄₀O₄	428.604									lmax (nm) 265 (Ref. 0117/0123)	(CHCl₃) 1772 cm^-¹ (Ref. 0123)	¹H-NMR (d, CDCl₃, 400MHz) 6.22, 6.03 (2H, AB q, J = 10 Hz, 6-, 7-H), 5.04, 4.80 (2H, m, 19-H), 4.45 (1H, m, 23-H), 3.94 (1H, m, 3a-H), 1.51 (3H, s, 27-H), 1.01 (3H, d, J = 6 Hz, 21-H), 0.56 (3H, s, 18-H). (Ref. 0117) ¹H-NMR (d, CDCl₃) 0.57 (3H, s, 18-H), 1.01 (3H, d, J = 6 Hz, 21-H), 1.50 (3H, s, 27-H), 3.97 (1H, m, 3a-H), 4.45 (1H, m, 23-H), 4.83 (1 H, br s, H-19), 5.06 (1 H, br s, H-19), 6.13 (2 H, ABq, J = 11 Hz, H-6 and 7). (Ref. 0123)	m/z 428 (M⁺, 98), 413 (M⁺-Me, 7), 411 (6), 410 (M⁺-H₂O, 21), 395 (M⁺-H₂O-Me, 100), 369 (34), 253 (54) (Ref. 0117) m/z 428 (M⁺), 410, 395, 369, 136, 118. (Ref. 0123)				Stereoselective synthesis of 25S-OHD₃ 26,23-lactone from C(22)-steroid aldehyde and chiral side chain synthon prepared from (S)-citramalic acid. (Ref. 0123) Synthesis from C(22) steroid aldehyde via iodolactonization of 22-ene-26-carboxylic acid as a key step. (Ref. 0117)				[0117] / [0123]
130		(23S,25S)-25-hydroxyvitamin D₃ 26,23-lactone / (23S,25S)-25-hydroxycholecalciferol 26,23-lactone	(5Z,7E)-(3S,23S,25S)-3,25-dihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-lactone	VVD0133	Sachiko Yamada	25S-OHD₃ 26,23S-lactone	C₂₇H₄₀O₄	428.604									lmax (nm) 265 (Ref. 0117)		¹H-NMR (d, CDCl₃, 400MHz) 6.22, 6.02 (2H, AB q, J = 10 Hz, 6-, 7-H), 5.04, 4.80 (2H, m, 19-H), 4.72 (1H, m, 23-H), 3.95 (1H, m, 3a-H), 1.52 (3H, s, 27-H), 1.03 (3H, d, J = 6 Hz, 21-H), 0.57 (3H, s, 18-H) (Ref. 0117)	m/z 428 (M⁺, 100), 413 (M⁺-Me, 8), 411 (7), 395 (M⁺-H₂O-Me, 71), 369 (15), 253 (10) (Ref. 0117)				Synthesis from C(22) steroid aldehyde via iodolactonization of 22-ene-26-carboxylic acid as a key step. (Ref. 0117)				[0117]
131		(22E)-(24R,25R)-25,26-epoxy-1a,24-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(24R,25R)-25,26-epoxy-1a,24-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,24R,25R)-25,26-epoxy-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24-triol	VVD0134	Sachiko Yamada	(22E)-25R,26-epoxy-1a,24R-(OH)₂-22,23-didehydro-D₃ / (22E)-25R,26-epoxy-1a,24R-(OH)₂-22-ene-D₃	C₂₇H₄₀O₄	428.604		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 8 and 2 respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 30, 140 and 22, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : 1, 3, 2 and 1, respectively. (Ref. 0240)														By Sharpless kinetic epoxidation of the corresponding olefinic precursor. (Ref. 0243)				[0240] / [0243]
132		(22E)-(24S,25S)-25,26-epoxy-1a,24-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(24S,25S)-25,26-epoxy-1a,24-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,24S,25S)-25,26-epoxy-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24-triol	VVD0135	Sachiko Yamada	(22E)-25S,26-epoxy-1a,24S-(OH)₂-22,23-didehydro-D₃ / (22E)-25S,26-epoxy-1a,24S-(OH)₂-22-ene-D₃	C₂₇H₄₀O₄	428.604		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 8 and 3 respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 15, 100 and 65, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : all 1. (Ref. 0240)														By Sharpless kinetic epoxidation of the corresponding olefinic precursor. (Ref. 0243)				[0240] / [0243]
133		(23S,25R)-25-hydroxyvitamin D₃ 26,23-peroxylactone / (23S,25R)-25-hydroxycholecalciferol 26,23-peroxylactone	(5Z,7E)-(3S,23S,25R)-3,25-dihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-peroxylactone	VVD0136	Sachiko Yamada	25R-OHD₃ 26,23S-peroxylactone	C₂₇H₄₀O₅	444.604									lmax (nm) 264, lmin (nm) 228; spectrum (Ref. 0135)	1733 cm^-¹; spectrum(Ref. 0135)		m/z 444 (M⁺), 412 (M⁺-O₂), 400 (M⁺-CO₂), 372 (M⁺C₃H₄O₂), 354 (372-H₂O), 339 (354-CH₃ and 372-OOH), 313 (M⁺C₅H₇O₄), 271 (M⁺-side chain), 253 (M⁺-side chain-H₂O), 136 (A ring+C₆+C₇)⁺, 118 (A ring⁺-H₂O); spectrum(Ref. 0135)		HPLC: (Ref. 0135)	Isolated and identification : From the serum of rats given large doses of vitamin D₃. (Ref. 0135)					[0135]
134		(23R,25R)-1a,25-dihydroxyvitamin D₃ 26,23-lactone / (23R,25R)-1a,25-dihydroxycholecalciferol 26,23-lactone	(5Z,7E)-(1S,3R,23R,25R)-1,3,25-trihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-lactone	VVD0137	Sachiko Yamada	1a,25R-(OH)₂D₃ 26,23R-lactone	C₂₇H₄₀O₅	444.604		Ability of the four diastereomers at C-23 and -25 of 1,25-(OH)₂D₃ 26,23-lactone and 1,25-(OH)₂D₃ to bind to chick intestinal receptor was compared : Affinity relative to 1,25-(OH)₂D₃ : (23S,25S)-isomer, 8% ; (23R,25R)-isomer, 2% ; (23R,25S)-isomer, 0.2% ; (23S,25R)-isomer, 0.15%. (Ref. 0280) Time-course response of 1,25-(OH)₂D₃ 26,23-lactone four diastereomers in bone calcium mobilization induced in rats and dose-response of 1,25-(OH)₂D₃ 26,23-lactone diastereomers in intestinal calcium transport and bone calcium mobilization. Figure (Ref. 0282)									¹H-NMR (d, CDCl₃, 400MHz) 6.38 (1H, d, J = 11.3 Hz, 6-H), 6.02 (1H, d, J = 11.3 Hz, 7-H), 5.33 (1H, m, 19-H), 5.01 (1H, m, 19-H), 4.77 (1H, m, 23-H), 4.43 (1H, m, 1b-H), 4.24 (1H, m, 3a-H), 1.52 (3H, s, 27-H), 1.03 (3H, d, J = 6.7 Hz, 21-H), 0.51 (3H, s, 18-H) (Ref. 0280)					Synthesis of four diastereomers at C-23 and -25 of the title compound from 1a-hydroxyergosterol. The stereochemistries at C-23 and -25 of the four diastereomers were determined by comparing their NMR spectra and HPLC properties with those of the four diastereomers at C-23 and -25 of 25-hydroxyvitamin D₃ 26,23-lactone. (Ref. 0280)				[0280] / [0282]
135		(23S,25R)-1a,25-dihydroxyvitamin D₃ 26,23-lactone / (23S,25R)-1a,25-dihydroxycholecalciferol 26,23-lactone	(5Z,7E)-(1S,3R,23S,25R)-1,3,25-trihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-lactone	VVD0138	Sachiko Yamada	1a,25R-(OH)₂D₃ 26,23S-lactone	C₂₇H₄₀O₅	444.604		Affinity for the chick intestinal receptor: 1/662 as active as 1,25-(OH)₂D₃. In vitamin D deficient rats fed a low-calcium diet, this compound has a weak potency to increase intestinal calcium transport but it decrreases the serum calcium level: 500 ng dose decreases the serum calcium level by about 20% at 24 h. (Ref. 0242) Ability of the four diastereomers at C-23 and -25 of 1,25-(OH)₂D₃ 26,23-lactone and 1,25-(OH)₂D₃ to bind to chick intestinal receptor was compared: Affinity relative to 1,25-(OH)₂D₃: (23S,25S)-isomer, 7.9% ; (23R,25R)-isomer, 2.3%; (23R,25S)-isomer, 0.22%; (23S,25R)-isomer, 0.17%. (Ref. 0280) Time-course response of 1,25-(OH)₂D₃ 26,23-lactone four diastereomers in bone calcium mobilization induced in rats. Dose-response of 1,25-(OH)₂D₃ 26,23-lactone diastereomers in intestinal calcium transport and bone calcium mobilization. (Ref. 0282)					[a] +21.3 C (c = 0.47 in Et₂O) [Lit. [a]_D +24.66 C (in Et₂O)] (Ref. 0078/0280)		(95% EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0078/0280)	(KBr) 3416, 2940, 1771, 1212, 1054 cm^-¹ (Ref. 0078/0280)	¹H-NMR (d, CDCl₃) 0.55 (3H, s, 18-H), 1.03 (3H, d, J = 5.9 Hz, 21-H), 1.48 (3H, s, 27-H), 4.22 (1H, m, 3-H), 4.44 (2H, m, 1- and 23-H), 5.00 and 5.33 (each 1H, m, 19-H), 6.02 and 6.38 (each 1H, d, J = 11 Hz, 7- and 6-H, respectively) (Ref. 0078/0280) ¹H-NMR (d, CD₃OD) 0.59 (3H, s, 18-H), 1.05 (3H, d, J = 6.4 Hz, 21-H), 1.44 (3H, s, 27-H), 4.14 (1H, m, 3-H), 4.36 (1H, m, 1-H), 4.49 (1H, m, 23-H), 4.91 and 5.29 (each 1H, m, 19-H), 6.09 and 6.33 (each 1H, d, J = 11 Hz, 7- and 6-H, respectively) (Ref. 0078/0280)	m/z 444 (M⁺, 6), 426 (13), 408 (14), 269 (7), 251 (16), 134 (100) (Ref. 0078/0280)			In normal beagle dogs, serum concentrations of 1,25R-(OH)₂D₃ 26,23S-lactone, 1,25-(OH)₂D₃ and 1,24,25-(OH)₃D₃ were 100, 36, and 6 pg/ml serum. (Ref. 0085)	From 1a-hydroxydehydroepiandrosterone: The side chain was introduced via the reaction of C(22)-aldehyde with chiral C(5)-sulfone having the desired stereochemistry at C(25) of the target compound as key step. The lactone structure was constructed stereoselectively by iodolactonization of 22-ene-25-carboxylic acid. Provitamin D with the required side chain was converted to the title compound by photochemical method. (Ref. 0078) Synthesis of four diastereomers at C-23 and -25 of the title compound from 1a-hydroxyergosterol and determination of the stereochemistry of the natural metabolite to be (23S, 25R). The stereochemistries at C-23 and -25 of the four diastereomers were determined by comparing their NMR spectra and HPLC properties with those of the four diastereomers at C-23 and -25 of 25-hydroxyvitamin D₃ 26,23-lactone (Ref. 0280)	The role of kidney in the production of 25-OHD₃ 26,23-lactone and 1,25-(OH)₂D₃ 26,23-lactone was demonstrated. (Ref. 0120)			[0078] / [0085] / [0120] / [0242] / [0280] / [0282]
136		(23R,25S)-1a,25-dihydroxyvitamin D₃ 26,23-lactone / (23R,25S)-1a,25-dihydroxycholecalciferol 26,23-lactone	(5Z,7E)-(1S,3R,23R,25S)-1,3,25-trihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-lactone	VVD0139	Sachiko Yamada	1a,25S-(OH)₂D₃ 26,23R-lactone	C₂₇H₄₀O₅	444.604		Ability of the four diastereomers at C-23 and -25 of 1,25-(OH)₂D₃ 26,23-lactone and 1,25-(OH)₂D₃ to bind to chick intestinal receptor was compared : Affinity relative to 1,25-(OH)₂D₃ : (23S,25S)-isomer, 8% ; (23R,25R)-isomer, 2% ; (23R,25S)-isomer, 0.2% ; (23S,25R)-isomer, 0.15%. (Ref. 0280) Time-course response of 1,25-(OH)₂D₃ 26,23-lactone four diastereomers in bone calcium mobilization induced in rats and dose-response of 1,25-(OH)₂D₃ 26,23-lactone diastereomers in intestinal calcium transport and bone calcium mobilization. Figure (Ref. 0282)									¹H-NMR (d, CDCl₃, 400MHz) 6.37 (1H, d, J = 11.3 Hz, 6-H), 6.02 (1H, d, J = 11.3 Hz, 7-H), 5.34 (1H, m, 19-H), 5.00 (1H, m, 19-H), 4.46 (2H, m, 23- and 1b-H), 4.24 (1H, m, 3a-H), 1.50 (3H, s, 27-H), 1.01 (3H, d, J = 6.4 Hz, 21-H), 0.57 (3H, s, 18-H) (Ref. 0280)					Synthesis of four diastereomers at C-23 and -25 of the title compound from 1a-hydroxyergosterol. The stereochemistries at C-23 and -25 of the four diastereomers were determined by comparing their NMR spectra and HPLC properties with those of the four diastereomers at C-23 and -25 of 25-hydroxyvitamin D₃ 26,23-lactone. (Ref. 0280)				[0280] / [0282]
137		(23S,25S)-1a,25-dihydroxyvitamin D₃ 26,23-lactone / (23S,25S)-1a,25-dihydroxycholecalciferol 26,23-lactone	(5Z,7E)-(1S,3R,23S,25S)-1,3,25-trihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-lactone	VVD0140	Sachiko Yamada	1a,25S-(OH)₂D₃ 26,23S-lactone	C₂₇H₄₀O₅	444.604		Ability of the four diastereomers at C-23 and -25 of 1,25-(OH)₂D₃ 26,23-lactone and 1,25-(OH)₂D₃ to bind to chick intestinal receptor was compared: Affinity relative to 1,25-(OH)₂D₃ : (23S,25S)-isomer, 8% ; (23R,25R)-isomer, 2% ; (23R,25S)-isomer, 0.2% ; (23S,25R)-isomer, 0.15%. (Ref. 0280) Time-course response of 1,25-(OH)₂D₃ 26,23-lactone four diastereomers in bone calcium mobilization induced in rats and dose-response of 1,25-(OH)₂D₃ 26,23-lactone diastereomers in intestinal calcium transport and bone calcium mobilization. Figure (Ref. 0282)									¹H-NMR (d, CDCl₃, 400MHz) 6.38 (1H, d, J = 11.3 Hz, 6-H), 6.01 (1H, d, J = 11.3 Hz, 7-H), 5.33 (1H, m, 19-H), 5.00 (1H, m, 19-H), 4.72 (1H, m, 23-H), 4.33 (1H, m, 1b-H), 4.23 (1H, m, 3a-H), 1.51 (3H, s, 27-H), 1.03 (3H, d, J = 6.4 Hz, 21-H), 0.56 (3H, s, 18-H) (Ref. 0280)					Synthesis of four diastereomers at C-23 and -25 of the title compound from 1a-hydroxyergosterol. The stereochemistries at C-23 and -25 of the four diastereomers were determined by comparing their NMR spectra and HPLC properties with those of the four diastereomers at C-23 and -25 of 25-hydroxyvitamin D₃ 26,23-lactone. (Ref. 0280)				[0280] / [0282]
138		(25R)-26,26,26-trideuterio-1a,25-dihydroxyvitamin D₃ / (25R)-26,26,26-trideuterio-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,25R)-26,26,26-trideuterio-9,10-seco-5,7,10(19)-cholestatriene-1,25-diol	VVD0141	Sachiko Yamada	1a,25R-(OH)₂-[26,26,26-²H]D₃	C₂₇H₄₁D₃O₃	419.613		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for rat intestinal receptor : 83 ; Calf intestinal receptor : 97 ; Intestinal calcium absorption, 136 ; Bone calcium mobilization, 143. (Ref. 0329)														Total convergent synthesis via Wittig-Horner coupling of upper half 8-ketone with A ring phosphine oxide. The upper half was synthesized from CD-ring 23-nitrone via 1,3-dipolar cycloaddition with methyl methacrylate as key step. (Ref. 0329)				[0329]
139		(25S)-26,26,26-trideuterio-1a,25-dihydroxyvitamin D₃ / (25S)-26,26,26-trideuterio-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,25S)-26,26,26-trideuterio-9,10-seco-5,7,10(19)-cholestatriene-1,25-diol	VVD0142	Sachiko Yamada	1a,25S-(OH)₂-[26,26,26-²H]D₃	C₂₇H₄₁D₃O₃	419.613		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for rat intestinal receptor : 148 ; Calf intestinal receptor : 161 ; Intestinal calcium absorption, 92 ; Bone calcium mobilization, 149. (Ref. 0329)														Total convergent synthesis via Wittig-Horner coupling of upper half 8-ketone with A ring phosphine oxide. The upper half was synthesized from CD-ring 23-nitrone via 1,3-dipolar cycloaddition with methyl methacrylate as key step. (Ref. 0329)				[0329]
140		(24R)-24,25-dihydroxy-[6,19,19-²H₃]vitamin D₃ / (24R)-24,25-dihydroxy-[6,19,19-²H₃]cholecalciferol	(5Z,7E)-(3S,24R)-[6,19,19-²H₃]-9,10-seco-5,7,10(19)-cholestatriene-3,24,25-triol	VVD0143	Sachiko Yamada	24R,25-(OH)₂-[6,19,19-²H₃]D₃	C₂₇H₄₁D₃O₃	419.613									(EtOH) lmax (nm) 265 (Ref. 0332)	(KBr) 3450, 2970, 2900, 1640, 1630, 1450, 1380, 1162, 1075, 965 cm^-¹ (Ref. 0332)	¹H-NMR (d, CDCl₃) 0.55 (3H, s, 18-H), 0.94 (3H, d, J = 5.0 Hz, 21-H), 1.17 and 1.22 (each 3H, s, 26- and 27-H), 3.31 (1H, m, 24-H), 3.93 (1H, m, 3-H), 6.02 (1H, s, 7-H) (Ref. 0332)					From 24R,25-dihydroxyvitamin D₃ via proton-deuterium exchange at 6 and 19-positions of its sulfur dioxide adduct under basic conditions. (Ref. 0332)				[0332]
141		(5E)-(24R)-24,25-dihydroxy-[6,19,19-²H₃]vitamin D₃ / (5E)-(24R)-24,25-dihydroxy-[6,19,19-²H₃]cholecalciferol	(5E,7E)-(3S,24R)-[6,19,19-²H₃]-9,10-seco-5,7,10(19)-cholestatriene-3,24,25-triol	VVD0144	Sachiko Yamada	(5E)-24R,25-(OH)₂-[6,19,19-²H₃]D₃	C₂₇H₄₁D₃O₃	419.613									(EtOH) lmax (nm) 273 (Ref. 0332)	(KBr) 3650, 3450, 3020, 2950, 1210, 1060 cm^-¹ (Ref. 0332)	¹H-NMR (d, CDCl₃) 0.57 (3H, s, 18-H), 0.95 (3H, d, J = 5.0 Hz, 21-H), 1.17 and 1.22 (each 3H, s, 26- and 27-H), 3.32 (1H, m, 24-H), 3.84 (1H, m, 3-H), 5.86 (1H, s, 7-H) (Ref. 0332)	m/z 419 (M⁺, 83), 401 (30), 274 (67), 256 (68), 160 (68), 139 (70), 121 (100) (Ref. 0332)				From 24R,25-dihydroxyvitamin D₃ via proton-deuterium exchange at 6 and 19-positions of its sulfur dioxide adduct under basic conditions. (Ref. 0332)				[0332]
142		(20R,24R)-20-fluoro-1a,24-dihydroxy-26,27-cyclovitamin D₃ / (20R,24R)-20-fluoro-1a,24-dihydroxy-26,27-cyclocholecalciferol	(5Z,7E)-(1S,3R,20R,24R)-20-fluoro-26,27-cyclo-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0145	Sachiko Yamada	20R-F-1a,24R-(OH)₂-26,27-cyclo-D₃	C₂₇H₄₁FO₃	432.611										(KBr) 3400, 2900 cm^-¹ (Ref. 0161)	¹H-NMR (d, CDCl₃, 300MHz) 6.02 and 6.39 (1H each, 2 d, J = 11 Hz, 6- and 7-H), 5.00 and 5.34 (1H each, 2 s, 19-H), 4.43 (1H, m, 1-H), 4.22 (1H, m, 3-H), 2.88 (1H, m, 24-H), 1.30 (3H, d, J = 20 Hz, 21-H), 0.90 (1H, m, 25-H), 0.70 (3H, d, J = 3 Hz, 18-H), 0.54 and 0.28 (2H each, 2 m, 26- and 27-H) (Ref. 0161)	m/z 432 (M⁺, 9%),414 (10%), 394 (10%), 376 (7%), 358 (3%), 134 (100%) (Ref. 0161)				Synthesis of the four diastereomers at C(20) and C(24) from protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via fluorination of its silylenol ether and introduction of the side chain fragment by Wittig type reaction as key steps. (Ref. 0161)				[0161]
143		(20S,24R)-20-fluoro-1a,24-dihydroxy-26,27-cyclovitamin D₃ / (20S,24R)-20-fluoro-1a,24-dihydroxy-26,27-cyclocholecalciferol	(5Z,7E)-(1S,3R,20S,24R)-20-fluoro-26,27-cyclo-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0146	Sachiko Yamada	20S-F-1a,24R-(OH)₂-26,27-cyclo-D₃	C₂₇H₄₁FO₃	432.611										(KBr) 3400, 2930 cm^-¹ (Ref. 0161)	¹H-NMR (d, CDCl₃, 300MHz) 6.02 and 6.39 (1H each, 2 d, J = 11 Hz, 6- and 7-H), 5.00 and 5.33 (1H each, 2 s, 19-H), 4.43 (1H, m, 1-H), 4.22 (1H, m, 3-H), 2.85 (1H, m, 24-H), 1.41 (3H, d, J = 21 Hz, 21-H), 0.70 (3H, d, J = 4 Hz, 18-H) (Ref. 0161)	m/z 432 (M⁺, 7%),414 (10%), 394 (8%), 376 (7%), 152 (34%), 134 (100%) (Ref. 0161)				Synthesis of the four diastereomers at C(20) and C(24) from protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via fluorination of its silylenol ether and introduction of the side chain fragment by Wittig type reaction as key steps. (Ref. 0161)				[0161]
144		(20R,24S)-20-fluoro-1a,24-dihydroxy-26,27-cyclovitamin D₃ / (20R,24S)-20-fluoro-1a,24-dihydroxy-26,27-cyclocholecalciferol	(5Z,7E)-(1S,3R,20R,24S)-20-fluoro-26,27-cyclo-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0147	Sachiko Yamada	20R-F-1a,24S-(OH)₂-26,27-cyclo-D₃	C₂₇H₄₁FO₃	432.611										(KBr) 3400, 2900 cm^-¹ (Ref. 0161)	¹H-NMR (d, CDCl₃, 300MHz) 6.02 and 6.39 (1H each, 2 d, J = 11 Hz, 6- and 7-H), 5.01 and 5.34 (1H each, 2 s, 19-H), 4.43 (1H, m, 1-H), 4.22 (1H, m, 3-H), 2.85 (1H, m, 24-H), 1.30 (3H, d, J = 20 Hz, 21-H), 0.90 (1H, m, 25-H), 0.70 (3H, d, J = 3 Hz, 18-H), 0.53 and 0.27 (2H each, 2 m, 26- and 27-H) (Ref. 0161)	m/z 432 (M⁺, 8%),414 (13%), 394 (14%), 376 (8%), 358 (3%), 134 (100%) (Ref. 0161)				Synthesis of the four diastereomers at C(20) and C(24) from protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via fluorination of its silylenol ether and introduction of the side chain fragment by Wittig type reaction as key steps. (Ref. 0161)				[0161]
145		(20S,24S)-20-fluoro-1a,24-dihydroxy-26,27-cyclovitamin D₃ / (20S,24S)-20-fluoro-1a,24-dihydroxy-26,27-cyclocholecalciferol	(5Z,7E)-(1S,3R,20S,24S)-20-fluoro-26,27-cyclo-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0148	Sachiko Yamada	20S-F-1a,24S-(OH)₂-26,27-cyclo-D₃	C₂₇H₄₁FO₃	432.611										(KBr) 3400, 2920 cm^-¹ (Ref. 0161)	¹H-NMR (d, CDCl₃, 300MHz) 6.02 and 6.39 (1H each, 2 d, J = 11 Hz, 6- and 7-H), 5.00 and 5.33 (1H each, 2 s, 19-H), 4.43 (1H, m, 1-H), 4.22 (1H, m, 3-H), 2.85 (1H, m, 24-H), 1.41 (3H, d, J = 21 Hz, 21-H), 0.70 (3H, d, J = 4 Hz, 18-H) (Ref. 0161)	m/z 432 (M⁺, 8%),414 (13%), 394 (12%), 376 (9%), 152 (33%), 134 (100%) (Ref. 0161)				Synthesis of the four diastereomers at C(20) and C(24) from protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via fluorination of its silylenol ether and introduction of the side chain fragment by Wittig type reaction as key steps. (Ref. 0161)				[0161]
146		26,26,26-trifluoro-25-hydroxyvitamin D₃ / 26,26,26-trifluoro-25-hydroxycholecalciferol	(5Z,7E)-(3S)-26,26,26-trifluoro-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0149	Sachiko Yamada	26,26,26-F₃-25-OHD₃	C₂₇H₄₁F₃O₂	454.608									lmax (nm) 265, lmin (nm) 227 (Ref. 0201)			m/z 454 (M⁺), 493, 436, 421, 271, 253, 136, 118 (Ref. 0201)				From 24-phenylsulfonyl-5-cholen-3-ol via reaction with trifluoroacetate as a key step. (Ref. 0201)				[0201]
147		(25R)-26,26,26-trifluoro-1a,25-dihydroxyvitamin D₃ / (25R)-26,26,26-trifluoro-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,25R)-26,26,26-trifluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0150	Sachiko Yamada	26,26,26-F₃-1a,25R-(OH)₂D₃	C₂₇H₄₁F₃O₃	470.608		Potency relative to 1,25-(OH)₂D₃ (defined 1): Differentiation of HL-60 cells: 3; Calcemic activity: 2. (Ref. 0356)																		[0356]
148		(25S)-26,26,26-trifluoro-1a,25-dihydroxyvitamin D₃ / (25S)-26,26,26-trifluoro-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,25S)-26,26,26-trifluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0151	Sachiko Yamada	26,26,26-F₃-1a,25S-(OH)₂D₃	C₂₇H₄₁F₃O₃	470.608		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 197 ; Bone calcium mobilization in rat, 163 ; Competitive binding to rat intestinal vitamin D receptor, 199 ; Differentiation of human leukemia cells (HL-60), 300. (Ref. 0237)																		[0237]
149		4,4-difluorovitamin D₃ / 4,4-difluorocholecalciferol	(5E,7E)-(3S)-4,4-difluoro-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0152	Sachiko Yamada	4,4-F₂-D₃	C₂₇H₄₂F₂O	420.619									(95% EtOH) lmax (nm) (emax) 270 (19400) (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.55 (3H, s, 18-H), 0.86 and 0.87 (each 3H, d, J = 6.6 Hz, 26- and 27-H), 0.92 (3H, d, J = 6.2 Hz, 21-H), 2.19 (1H, m, 1-H), 2.47 (1H, m, 1-H), 3.98 (1H, m, 3-H), 5.00 and 5.23 (each 1H, s, 19-H), 6.09 (1H, d, J = 11.4 Hz, 7-H), 6.94 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -114.0 (dd, J = 234.6 and 11.5 Hz, 4b-F), -108.0 (d, J = 234.6 Hz, 4a-F) (Ref. 0333)	m/z 420 (M⁺, 93), 382 (79), 380 (18), 335 (22), 307 (61), 269 (33), 267 (16), 135 (100) (Ref. 0333)				From 4,7-cholestadien-3-one via electrophilic difluorination at C(4) followed by reduction giving 4,4-difluoroprovitamin D₃ as a key step. (Ref. 0345)				[0333] / [0345]
150		(5Z)-4,4-difluorovitamin D₃ / (5Z)-4,4-difluorocholecalciferol	(5Z,7E)-(3S)-4,4-difluoro-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0153	Sachiko Yamada	(5Z)-4,4-F₂-D₃	C₂₇H₄₂F₂O	420.619									(95% EtOH) lmax (nm) (emax) 277 (23000) (Ref. 0333)		¹H-NMR (d, CD₃OD) 0.60 (3H, s, 18-H), 0.89 (6H, d, J = 6.6 Hz, 26- and 27-H), 0.96 (3H, d, J = 6.1 Hz, 21-H), 2.23 (1H, m, 1-H), 2.52 (1H, m, 1-H), 3.88 (1H, m, 3-H), 4.82 and 5.01 (each 1H, s, 19-H), 6.40 (1H, d, J = 12.0 Hz, 7-H), 6.83 (1H, d, J = 12.0 Hz, 6-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -109.0 (d, J = 248.7 Hz), -101.7 (d, J = 248.7 Hz) (Ref. 0333)					From 4,7-cholestadien-3-one via electrophilic difluorination at C(4) followed by reduction giving 4,4-difluoroprovitamin D₃ as a key step. (Ref. 0345)				[0333] / [0345]
151		1a,25-difluorovitamin D₃ / 1a,25-difluorocholecalciferol	(5Z,7E)-(1S,3R)-1,25-difluoro-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0154	Sachiko Yamada	1a,25-F₂-D₃	C₂₇H₄₂F₂O	420.619		The title compound showed no response in intestinal calcium transport and elevation of serum calcium level in vitamin D deficient rats. Antivitamin D properties of the title compound was tested. At a 1000-fold excess administration, this compound failed to block the expression of vitamin D activity. (Stereochemistry at C-1 is ambiguous) (Ref. 0296)							lmax (nm) 265 (Ref. 0296)		¹H-NMR (d) 0.53 (3H, s, 18-CH₃), 0.93 (3H, d, J = 6.0 Hz, 21-CH₃), 1.34 (6H, d, J = 22.0 Hz, 26- and 27-CH₃), 3.98 (1H, m, 3-H), 5.02 (1H, d m, J = 52.0 Hz, 1-H), 5.12 [1H, m(sharp), 19(Z)-H], 5.41 [1H, m(sharp), 19(E)-H], 6.03 (1H, d, J = 11.0 Hz, 7-H), 6.44 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0296)	m/z 420 (M⁺, 20), 400 (70), 382 (35), 135 (100) (Ref. 0296)				From 1a,25-(OH)₂D₃ 3-acetate, by fluorination with diethylaminosulfurtrifluoride followed by deprotection. (Stereochemistry at C-1 is ambiguous) (Ref. 0296)				[0296]
152		24,24-difluoro-1a-hydroxyvitamin D₃ / 24,24-difluoro-1a-hydroxycholecalciferol	(5Z,7E)-(1S,3R)-24,24-difluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0155	Sachiko Yamada	24,24-F₂-1a-OH-D₃	C₂₇H₄₂F₂O₂	436.618		The analogue showed higher activity than 24,24-difluoro-1a,25-dihydroxyvitamin D₃ in intestinal calcium absorption. (Ref. 0251)					[a]_D +75.6 (c = 0.15 in CHCl₃) (Ref. 0251)		(EtOH) lmax (nm) (e) 264 (18100) (Ref. 0251)	(neat) 3422, 1645, 1456 cm^-¹ (Ref. 0251)	¹H-NMR (d, CDCl₃, 400MHz) 0.55 (3H, s), 0.94 (3H, d, J = 6.4 Hz), 1.00 (6H, d, J = 7.0 Hz), 4.20-4.25 (1H, m), 4.43 (1H, dd, J = 4.6, 7.6 Hz), 5.00 (1H, s), 5.33 (1H, t, J = 1.7 Hz), 6.02 (1H, d, J = 11.5 Hz), 6.38 (1H, d, J = 11.5 Hz) (Ref. 0251)	m/z 436 (M⁺), 418 (M⁺-H₂O), 400 (M⁺-2H₂O), 152, 134 (Ref. 0251)		HPLC : Lichrosorb Si-60, 25 250 mm ; mobile phase, 8 % isoPrOH-CH₂Cl₂ (Ref. 0251)		The PTAD adduct of 1a,3b-bis[(tert-butyldimethylsilyl)oxy]-24-norchol-5,7-dien-23-al was modified to give the analogues with fluorine atoms in the side-chain. The radical deoxygenation of the 25-OH was a key feature in the synthesis. (Ref. 0251)				[0251]
153		4,4-difluoro-1a-hydroxyvitamin D₃ / 4,4-difluoro-1a-hydroxycholecalciferol	(5E,7E)-(1S,3S)-4,4-difluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0156	Sachiko Yamada	4,4-F₂-25-OHD₃	C₂₇H₄₂F₂O₂	436.618									(95% EtOH) lmax (nm) 271 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.55 (3H, s, H-18), 0.86 and 0.87 (each 3H, d, J = 6.6 Hz, H-26 and 27), 0.92 (3H, d, J = 6.2 Hz, H-21), 2.08 (2H, m, H-2), 2.90 (1H, m, H-9), 4.26 (1H, m, H-3), 4.49 (1H, t, J = 5.6 Hz, H-1), 5.18 and 5.50 (each 1H, s, H-19), 6.07 (1H, d, J = 11.4 Hz, H-7), 7.06 (1H, d, J = 11.4 Hz, H-6) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -116.3 (d, J = 237.9 Hz, 4b-F), -107.7 (br d, J = 237.9 Hz, 4a-F) (Ref. 0333)	m/z 436 (M⁺, 54), 418 (6), 398 (9), 380 (6), 351 (25), 323 (58), 305 (12), 285 (6), 259 (11), 135 (100) (Ref. 0333)				From 4,7-cholestadien-3-one via electrophilic difluorination at C(4) followed by reduction giving 4,4-difluoroprovitamin D₃ as a key step. (Ref. 0345)				[0333] / [0345]
154		(5Z)-4,4-difluoro-1a--hydroxyvitamin D₃ / (5Z)-4,4-difluoro-1a--hydroxycholecalciferol	(5Z,7E)-(1S,3S)-4,4-difluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0157	Sachiko Yamada	(5Z)-4,4-F₂-25-OHD₃	C₂₇H₄₂F₂O₂	436.618																From 4,7-cholestadien-3-one via electrophilic difluorination at C(4) followed by reduction giving 4,4-difluoroprovitamin D₃ as a key step. (Ref. 0345)				[0345]
155		23,23-difluoro-25-hydroxyvitamin D₃ / 23,23-difluoro-25-hydroxycholecalciferol	(5Z,7E)-(3S)-23,23-difluoro-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0158	Sachiko Yamada	23,23-F₂-25-OHD₃	C₂₇H₄₂F₂O₂	436.618		The title compound is 5-10 times less active than 25-OHD₃ in stimulating intestinal calcium transport, bone calcium mobilization, increasing serum phosphorus, mineralization of rachitic bone, and binding to the plasma transport protein in rats. (Ref. 0301)							(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0202)		¹H-NMR (d, CDCl₃) 0.58 (3H, s, 18-H₃), 1.07 (3H, d, J = 6.1 Hz, 21-H₃), 1.34 (6H, s, 26- and 27-H₃), 3.95 (1H, m, 3-H), 4.81 (1H, bs, 19-H), 5.04 (1H, bs, 19-H), 6.03 (1H, d, J = 10.7 Hz, 7-H), 6.23 (1H, J = 10.7 Hz, 6-H) (Ref. 0202)	m/z 436 (M⁺), 418, 403 (Ref. 0202)				From 6b-methoxy-3a,5-cyclo-23,24-dinor-5a-cholan-22-ol via methyl 23,23-difluoro-cholan-24-oate. as key intermediate. (Ref. 0202)				[0202] / [0301]
156		24,24-difluoro-25-hydroxyvitamin D₃ / 24,24-difluoro-25-hydroxycholecalciferol	(5Z,7E)-(3S)-24,24-difluoro-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0159	Sachiko Yamada	24,24-F₂-25-OHD₃	C₂₇H₄₂F₂O₂	436.618									(95% EtOH) lmax (nm) (logemax) 265 (4.24) (Ref. 0303)		¹H-NMR (d, CDCl₃) 0.56 (3 H, s), 0.95 (3 H, d, J = 6 Hz), 1.32 (6 H, s), 3.95 (1 H, m, W/2 = 20 Hz), 4.85 (1 H, bs), 5.08 (1 H, bs), 6.16 (2 H, AB type q, J = 11 Hz) (Ref. 0303)	m/z 436 (M⁺), 421, 418, 403, 377, 271, 253, 136, 118 (Ref. 0199)				From lithocholic acid via fluorination of 24-oxo-25-carboxylic acid ester with DAST (diethylaminosulfur trifluoride) as a key step to construct the desired side chain structure. (Ref. 0303)				[0199] / [0303]
157		4,4-difluoro-1a,25-dihydroxyvitamin D₃ / 4,4-difluoro-1a,25-dihydroxycholecalciferol	(5E,7E)-(1S,3S)-4,4-difluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0160	Sachiko Yamada	4,4-F₂-1a,25-(OH)₂D₃	C₂₇H₄₂F₂O₃	452.617									(95% EtOH) lmax (nm) 271 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.55 (3H, s, 18-H), 0.94 (3H, d, J = 6.4 Hz, 21-H), 1.22 (6H, s, 26- and 27-H), 2.09 (2H, m, 2-H), 2.90 (1H, m, 9-H), 4.25 (1H, m, 3-H), 4.49 (1H, t, J = 5.6 Hz, 1-H), 5.18 and 5.50 (each 1H, s, 19-H), 6.07 (1H, d, J = 11.5 Hz, 7-H), 7.06 (1H, d, J = 11.5 Hz, 6-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -116.3 (d, J = 237.0 Hz, 4b-F), -107.6 (br d, J = 237.0 Hz, 4a-F) (Ref. 0333)	m/z 452 (M⁺, 17), 434 (34), 419 (12), 414 (10), 396 (10), 351 (13), 323 (56), 305 (18), 303 (11), 285 (12), 135 (100) (Ref. 0333)				From 25-hydroxy-4,7-cholestadien-3-one via electrophilic difluorination at C(4) followed by reduction giving 4,4-difluoro-25-hydroxyprovitamin D₃ as a key step. (Ref. 0333)				[0333]
158		(5Z)-4,4-difluoro-1a,25-dihydroxyvitamin D₃ / (5Z)-4,4-difluoro-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3S)-4,4-difluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0161	Sachiko Yamada	(5Z)-4,4-F₂-1a,25-(OH)₂D₃	C₂₇H₄₂F₂O₃	452.617																From 25-hydroxy-4,7-cholestadien-3-one via electrophilic difluorination at C(4) followed by reduction giving 4,4-difluoro-25-hydroxyprovitamin D₃ as a key step. (Ref. 0333)				[0333]
159		23,23-difluoro-1a,25-dihydroxyvitamin D₃ / 23,23-difluoro-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-23,23-difluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0162	Sachiko Yamada	23,23-F₂-1a,25-(OH)₂D₃	C₂₇H₄₂F₂O₃	452.617		Affinity for chick intestinal receptor : 1/7 as active as 1,25-(OH)₂D₃ ; Intestinal calcium transport, approximately as potent as 1,25-(OH)₂D₃. (Ref. 0301)										m/z 452 (M⁺), 434, 416, 287, 269, 251, 152, 134 (Ref. 0301)				From 23,23-difluoro-25-hydroxyvitamin D₃ by in vitro incubation with vitamin D-deficient chick kidney homogenates and subsequent purification on three HPLC systems. (Ref. 0301)				[0301]
160		24,24-difluoro-1a,25-dihydroxyvitamin D₃ / 24,24-difluoro-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-24,24-difluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0163	Sachiko Yamada	24,24-F₂-1a,25-(OH)₂D₃	C₂₇H₄₂F₂O₃	452.617		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 235 ; Bone calcium mobilization in rat, 58 ; Competitive binding to rat intestinal vitamin D receptor, 229 ; Differentiation of human leukemia cells (HL-60), 1000. (Ref. 0237) The analogue was about four to five times more active than 1a,25-dihydroxyvitamin D₃ to stimulate the chick intestinal calcium uptake. (Ref. 0253) The analogue, 24,24-F₂-1a,25-(OH)₂D₃ was four to seven times more potent than 1a,25-(OH)₂D₃ in inducing phagocytosis and C3 rosette formation of HL-60 cells. (Ref. 0254) The analogue induced macrophage differentiation of leukemic myeloid colony-forming cells, and the potency of the induction by 1a,25-(OH)₂D₃ and 24,24-F₂-1a,25-(OH)₂D₃ was almost equivalent. (Ref. 0255) The analogue induced a significantly greater hypercalcemia and hyperphophatemia than did 1a,25-(OH)₂D₃. (Ref. 0256)					[a]_D +10.0 (c = 0.25 in EtOH) (Ref. 0258)		lmax (nm) (emax) 265 (18100) (Ref. 0258)	(CHCl₃) 3690 cm^-¹ (Ref. 0258)	¹H-NMR (d, CDCl₃, 400MHz) 0.55 (3H, s), 0.95 (3H, d, J = 6.4 Hz), 1.30-2.14 (3H, m), 1.31 (6H, s), 2.31 (1H, dd, J = 6.4, 13.1 Hz), 2.60 (1H, dd, J = 3.4, 13 Hz), 2.83 (1H, dd, J = 3.5, 12 Hz), 4.23 (1H, tt, J = 3.2, 6.4 Hz), 4.43 (1H, dd, J = 4.3, 7.3 Hz), 5.33 (1H, t, J = 1.5 Hz), 6.02 (1H, d, J = 11.3 Hz), 6.38 (1H, d, J = 11.3 Hz) (Ref. 0258)	m/z 452 (M⁺), 434 (M⁺-H₂O), 416 (M⁺-2H₂O) (Ref. 0258)				The analogue was synthesized from 24,24-difluoro-5b-chorestane-3a,25-diol, which was prepared from lithocholic acid in 20 % overall yield. (Ref. 0252) Synthesis was accomplished from vitamin D₂ via vitamin D₂-SO₂ adducts in 12.5 % overall yield in 11 steps. (Ref. 0257/0258)				[0237] / [0252] / [0253] / [0254] / [0255] / [0256] / [0257] / [0258]
161		(6RS)-6,19-epidioxy-24,24-difluoro-25-hydroxy-6,19-dihydrovitamin D₃ / (6RS)-6,19-epidioxy-24,24-difluoro-25-hydroxy-6,19-dihydrocholecalciferol	(7E)-(3S, 6RS)-6,19-epidioxy-24,24-difluoro-9,10-seco-5(10),7-cholestadiene-3,25-diol	VVD0164	Sachiko Yamada	6,19-epidioxy-24,24-F₂-25-OH-6,19-dihydro-D₃	C₂₇H₄₂F₂O₄	468.617		Binding affinity for the vitamin D receptor in HL-60 cells : 1/1000 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : 1/45 as active as 1,25-(OH)₂D₃. (Ref. 0339)										m/z 468 (M⁺), 450, 330, 312, 299, 285, 258 (Ref. 0339)				As a major product by the reaction of 24,24-difluoro-25-hydroxyvitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0339)				[0339]
162		24,25-didehydrovitamin D₃ / 24,25-didehydrocholecalciferol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19),24-cholestatetraen-3-ol	VVD0165	Sachiko Yamada	24,25-didehydro-D₃ / 24-ene-D₃	C₂₇H₄₂O	382.622
163		(22E)-1a-hydroxy-22,23-didehydrovitamin D₃ / (22E)-1a-hydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3-diol	VVD0166	Sachiko Yamada	(22E)-1a-OH-22,23-didehydro-D₃ / (22E)-1a-OH-22-ene-D₃	C₂₇H₄₂O₂	398.621		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 4.7 10^-⁷ M, 6.0 10^-⁷ M and 4.0 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)														The side chain with 22E-stereochemistry was constructed with high selectivity by coupling of C(22) steroid aldehyde with isopentyl phenyl sulfone followed by reductive desulfonylation as a key step. 1a-Hydroxyl group was introduced by SeO₂ oxidation of 3,5-cyclovitamin D after photochemical conversion to (22E)-22,23-didehydrovitamin D₃. The 5Z isomer was obtained as a minor product in the cycloreversion of the 1a-hydroxylated cyclovitamin D. (Ref. 0244)				[0228] / [0244]
164		(22E)-1b-hydroxy-22,23-didehydrovitamin D₃ / (22E)-1b-hydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1R,3R)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3-diol	VVD0167	Sachiko Yamada	(22E)-1b-OH-22,23-didehydro-D₃ / (22E)-1b-OH-22-ene-D₃	C₂₇H₄₂O₂	398.621																The side chain with 22E-stereochemistry was constructed with high selectivity by coupling of C(22) steroid aldehyde with isopentyl phenyl sulfone followed by reductive desulfonylation as a key step. The 1b-hydroxylated vitamin was obtained as a minor product in the SeO₂ oxidation of 3,5-cyclo derivative of (22E)-22,23-didehydrovitamin D followed by cycloreversion. (Ref. 0244)				[0244]
165		(22Z)-1a-hydroxy-22,23-didehydrovitamin D₃ / (22Z)-1a-hydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22Z)-(1S,3R)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3-diol	VVD0168	Sachiko Yamada	(22Z)-1a-OH-22,23-didehydro-D₃ / (22Z)-1a-OH-22-ene-D₃	C₂₇H₄₂O₂	398.621																The side chain with 22Z-stereochemistry was constructed with high selectivity by coupling of C(22) steroid aldehyde with appropriate Wittig reagent. 1a-Hydroxyl group was introduced by SeO₂ oxidation of 3,5-cyclovitamin D derivative after photochemical conversion to (22Z)-22,23-didehydrovitamin D₃. The 5Z isomer was obtained as a minor product in the cycloreversion of the 1a-hydroxylated cyclovitamin D. (Ref. 0244)				[0244]
166		(22Z)-1b-hydroxy-22,23-didehydrovitamin D₃ / (22Z)-1b-hydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22Z)-(1R,3R)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3-diol	VVD0169	Sachiko Yamada	(22Z)-1b-OH-22,23-didehydro-D₃ / (22Z)-1b-OH-22-ene-D₃	C₂₇H₄₂O₂	398.621																The side chain with 22Z-stereochemistry was constructed with high selectivity by coupling of C(22) steroid aldehyde with appropriate Wittig reagent. The 1b-hydroxylated vitamin was obtained as a minor product in the SeO₂ oxidation of 3,5-cyclo derivative of (22Z)-22,23-didehydrovitamin D followed by cycloreversion. (Ref. 0244)				[0244]
167		(22Z)-1a-hydroxy-22,23-didehydrovitamin D₃ / (22Z)-1a-hydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3-diol	VVD0170	Sachiko Yamada	(22Z)-1a-OH-22,23-didehydro-D₃	C₂₇H₄₂O₂	398.621		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are all > 10^-⁶ M, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)																		[0228]
168		1a-hydroxy-24,25-didehydrovitamin D₃ / 1a-hydroxy-24,25-didehydrocholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19),24-cholestatetraene-1,3-diol	VVD0171	Sachiko Yamada	1a-OH-24,25-didehydro-D₃ / 1a-OH-24-ene-D₃	C₂₇H₄₂O₂	398.621
169		1a,25-dihydroxy-9,11-didehydro-3-deoxyvitamin D₃ / 1a,25-dihydroxy-9,11-didehydro-3-deoxycholecalciferol	(5Z,7E)-(1S)-9,10-seco-5,7,10(19),9(11)-cholestatetraene-1,25-diol	VVD0172	Sachiko Yamada	3-deoxy-1a,25-(OH)₂-9,11-didehydro-D₃	C₂₇H₄₂O₂	398.621																From de-A,B-cholesta-9(11),25-dien-8-one and A-ring synthon (1-ethynyl-3-hydroxy-2-methyl-1-cyclohexene) via 9,10-seco-5(10),6,7,9(11),25- cholestapentaen-1-ol derivative as the key intermediate. (Ref. 0225)				[0225]
170		25-hydroxy-16,17-didehydrovitamin D₃ / 25-hydroxy-16,17-didehydrocholecalciferol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19),16-cholestatetraene-3,25-diol	VVD0173	Sachiko Yamada	25-OH-16,17-didehydro-D₃	C₂₇H₄₂O₂	398.621		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 10 ; Competitive binding to rat intestinal vitamin D receptor, 0.23 ; Differentiation of human leukemia cells (HL-60), 3. (Ref. 0237)																		[0237]
171		23,24-didehydro-25-hydroxyvitamin D₃ / 23,24-didehydro-25-hydroxycholecalciferol	(5Z,7E,23E)-(3S)-9,10-seco-5,7,10(19),23-cholestatetraene-3,25-diol	VVD0174	Sachiko Yamada	25-OH-23-dehydro-D₃	C₂₇H₄₂O₂	398.621												m/z 398 (11, M⁺), 380 (5, M⁺-H₂O), 271 (2, M⁺-side chain), 253 (5, 271-H₂O), 136 [100, (A ring+C₆+C₇)⁺], 118 (74, 136-H₂O); spectrum (Ref. 0100) bis-TMS-derivative : m/z 542 (22, M⁺), 527 (8, M⁺-CH₃), 452 (18, M⁺HOSiMe₃), 437 (8, 452-CH₃), 208 [60, (A ring+C₆+C₇)⁺], 131 (56, C₃H₆OSiMe₃⁺), 118 (100, 208-HOSiMe₃); spectrum (Ref. 0100)			Isolated and identified from blood plasma of chicks given large doses of vitamin D₃. (Ref. 0100)					[0100]
172		calicoferol E	(8S)-3-hydroxy-9,10-seco-1,3,5(10)-cholestatrien-9-one	VVD0175	Sachiko Yamada	calicoferol E	C₂₇H₄₂O₂	398.621							[a]_D +21.6 (c = 0.6 in CHCl₃) (Ref. 0316)				¹H-NMR (d, CDCl₃, 400MHz) 0.87 (6H, d, J = 6.5 Hz, 26-, 27-CH₃), 0.93 (3H, d, J = 6.5 Hz, 21-CH₃), 0.98 (3H, s, 18-CH₃), 2.24 (3H, s, 19-CH₃), 6.57 (1H, dd, J = 8.1, 2.7 Hz, 2-H), 6.67 (1H, d, J = 2.7 Hz, 4-H), 6.98 (1H, d, J = 8.1 Hz, 1-H) (Ref. 0316) ¹³C-NMR (d, CDCl₃, 100MHz) 11.5, 18.4, 18.5, 22.5, 22.8, 23.8, 25.1, 27.6, 28.0, 29.0, 31.0, 35.6, 35.9, 38.3, 38.5, 39.4, 42.8, 50.4, 55.0, 55.2, 112.5, 115.7, 128.0, 131.0, 142.5, 153.7, 213.4 (Ref. 0316)	m/z 398 (M⁺), 277, 268, 264, 249, 223 (Ref. 0316)			Source see (Ref. 0319)	By the coupling of upper-half fragment derived from Grundmann				[0316] / [0319]
173		1-oxoprevitamin D₃ / 1-oxoprecholecalciferol	(6Z)-(3R)-3-hydroxy-9,10-seco-5(10),6,8-cholestatriene-1-one	VVD0176	Sachiko Yamada	1-oxo-pre-D₃	C₂₇H₄₂O₂	398.621									(EtOH) lmax (nm) (emax) 288 (7100), 237 (6800) (Ref. 0176)		¹H-NMR (d, CDCl₃, 270MHz) 0.72 (3H, s, 13-Me), 1.80 (3H, s, 10-Me), 4.16 (1H, m, 3-H), 5.47 (1H, narrow m, 9-H), 6.14 and 6.03 (2H, AB q, J = 11.9 Hz, 6- and 7-H) (Ref. 0176)	m/z 398 (M⁺, 60%), 380 (100%), 365 (10%) (Ref. 0176)				From 1a-hydroxyvitamin D₃ by selective (MnO₂) oxidation of the allylic 1-hydroxyl group. (Ref. 0176)				[0176]
174		1a-hydroxy-22-oxovitamin D₃ / 1a-hydroxy-22-oxocholecalciferol	(5Z,7E)-(1S,3R)-1,3-dihydroxy-9,10-seco-5,7,10(19)-cholestatrien-22-one	VVD0177	Sachiko Yamada	1a-OH-22-oxo-D₃	C₂₇H₄₂O₃	414.621
175		24,25-epoxy-1a-hydroxyvitamin D₃ / 24,25-epoxy-1a-hydroxycholecalciferol	(5Z,7E)-(1S,3R)-24,25-epoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0178	Sachiko Yamada	24,25-epoxy-1a-OHD₃	C₂₇H₄₂O₃	414.621		Biological activity (% of 1,25-(OH)₂D₃ effect): Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 6, 40 and 18, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : 1, 11, 2 and 2, respectively. Affinity for pig intestinal receptor and human vitamin D binding protein: 16 and 27, respectively. (Ref. 0240)														By epoxidation of the corresponding olefinic precursor which was constructed from Inhoffen-Lythgoe diol. (Ref. 0240)				[0240]
176		25,26-epoxy-1a-hydroxyvitamin D₃ / 25,26-epoxy-1a-hydroxycholecalciferol	(5Z,7E)-(1S,3R)-25,26-epoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0179	Sachiko Yamada	25,26-epoxy-1a-OHD₃	C₂₇H₄₂O₃	414.621		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 37, 18 and 22, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : 14, 25, 9 and 17, respectively. Affinity for pig intestinal receptor and human vitamin D binding protein : 27 and 76, respectively. (Ref. 0240)														By epoxidation of the corresponding olefinic precursor which was constructed from Inhoffen-Lythgoe diol. (Ref. 0240)				[0240]
177		24,25-epoxy-1a-hydroxy-23,23-dimethyl-26,27-dinorvitamin D₃ / 24,25-epoxy-1a-hydroxy-23,23-dimethyl-26,27-dinorcholecalciferol	(5Z,7E)-(1S,3R)-24,25-epoxy-23,23-dimethyl-26,27-dinor-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0180	Sachiko Yamada	24,25-epoxy-23,23-dimethyl-1a-OH-26,27-dinor-D₃	C₂₇H₄₂O₃	414.621		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 0, 5 and 0, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : all < 0.1. Affinity for pig intestinal receptor and human vitamin D binding protein : 1 and 0, respectively. (Ref. 0240)														By epoxidation of the corresponding olefinic precursor which was constructed from Inhoffen-Lythgoe diol. (Ref. 0240)				[0240]
178		25-hydroxy-23-oxovitamin D₃ / 25-hydroxy-23-oxocholecalciferol	(5Z,7E)-(3S)-3,25-dihydroxy-9,10-seco-5,7,10(19)-cholestatrien-23-one	VVD0181	Sachiko Yamada	25-OH-23-oxo-D₃	C₂₇H₄₂O₃	414.621		Affinity for bovine thymus receptor (% of 1,25-(OH)₂D₃ effect), 2.5 ; Affinity for rat plasma vitamin D binding protein : % of 25-OHD₃ effect, 272, % of 1,25-(OH)₂D₃ effect, 13600. (Ref. 0099>							lmax (nm) 264, lmin (nm) 228 (Ref. 0099)			m/z 414, 356, 323, 136, 118, 58 (Ref. 0099)					Produced as a minor metabolite from 23S,25-(OH)₂D₃ and a major metabolite from 23R,25-(OH)₂D₃ when incubated with chick kidney. (Ref. 0099)			[0099]
179		25-hydroxy-24-oxovitamin D₃ / 25-hydroxy-24-oxocholecalciferol	(5Z,7E)-(3S)-3,25-dihydroxy-9,10-seco-5,7,10(19)-cholestatrien-24-one	VVD0182	Sachiko Yamada	25-OH-24-oxo-D₃	C₂₇H₄₂O₃	414.621		Influences of vitamin D₃ metabolites on medullary bone formation; Table (Ref. 0097)								(KBr) spectrum (Ref. 0097)	¹H-NMR (d, CDCl₃) spectrum (Ref. 0097)	m/z 414 (M⁺), 271, 253, 136, 118, 59; spectrum (Ref. 0096)			Isolation and identification from Chicken kidney homogenates incubated with 25-OHD₃. (Ref. 0096) Isolation and identification from Rat kidneys perfused with pharmacological concentration of 25-OHD₃. (Ref. 0098) Isolated and identified from blood plasma of chicks given large doses of vitamin D₃. (Ref. 0100)	Five step synthesis from 22-phenylsulfonyl-23,24-dinor-5,7-choladien-3b-ol tetrahydropyranyl ether and 1,2-epoxy-3-hydroxy-3-methyl butane. (Ref. 0097)	In vitro, 25-hydroxy-24-oxovitamin D₃ is hydroxylated at C(23) to give 23S,25-dihydroxy-24-oxovitamin D₃ (Ref. 0102) and then cleaved at 23,24-bond to afford 23-hydroxy-24,25,26,27-tetranorvitamin D₃. (Ref. 0105)			[0096] / [0097] / [0098] / [0100] / [0102] / [0105]
180		25-hydroxy-1-oxo-3-epiprevitamin D₃ / 25-hydroxy-1-oxo-3-epiprecholecalciferol	(6Z)-(3S)-3,25-dihydroxy-9,10-seco-5(10),6,8-cholestatrien-1-one	VVD0183	Sachiko Yamada	25-OH-1-oxo-3-epipre-D₃	C₂₇H₄₂O₃	414.621									(95% EtOH) lmax (nm) (emax) 242 (10000), 298 (11200) (Ref. 0182)		¹H-NMR (d, CDCl₃, 300MHz) 0.71 (3H, 18C-CH₃), 0.96 (3H, d, J = 6.6 Hz, 21C-CH₃), 1.21 (6H, s, 26, 27C-2CH₃), 1.78 (3H, s, 19C-CH₃), 2.4-2.6 (1H, m), 2.70-2.85 (1H, m), 4.16 (1H, m, 3-H), 5.47 (1H, m, 9-H), 6.05 and 6.11 (2H, AB pattern, J = 11.7 Hz, 6-, 7-H) (Ref. 0182)	(CI, NH₃) m/z 415 (M⁺H, 15), 414 (M⁺, 7), 396 (M⁺-H₂O, 86), 379 (M⁺H-2H₂O, base), 363 (4), 338 (2), 323 (3), 295 (2), 267 (10), 253 (4), 239 (3), 213 (6), 199 (4), 171 (9), 157 (6), 135 (3), 121 (4), 107 (3), 95 (6), 81 (4), 69 (2) (Ref. 0182)				From 1b,25-dihydroxy-3-epivitamin D₃ by Des-Martin oxidation. (Ref. 0182)				[0182]
181			(6E)-(8S)-8,25-dihydroxy-9,10-seco-4,6,10(19)-cholestatrien-3-one	VVD0184	Sachiko Yamada	8a,25-(OH)₂-3-oxo-4,6,10(19)-triene-D₃	C₂₇H₄₂O₃	414.621									(95 % EtOH) lmax (nm) 295, (log e 4.2) (Ref. 0136)	(KBr) 3210-3600, 2950, 1660, 1565, 1380 cm^-¹ (Ref. 0136)	¹H-NMR (d, CDCl₃) spectrum (Ref. 0136)	m/z 414 (M⁺), 396, 381, 378, 368, 363, 325, 267, 135, 122; spectrum(Ref. 0136)			Isolation and identification in various phagocytic cells [alveolar macrophages, murine myeloid leukemia cells (M1), human promyelocytic leukemia cells (HL-60); human monoblast-like lymphoma cells (U 937) ] (Ref. 0136/0137) and in rat liver microsomes incubated with 25-OHD₃.. (Ref. 0138)	Synthesis from 25-OHD₃ via regio- and stereoselective 7,8-epoxidation as the key step and the determination of the C(18) stereochemistry of the natural metabolite to be S. (Ref. 0136)				[0136] / [0137] / [0138]
182		(23S)-1a,23-dihydroxy-25,26-didehydrovitamin D₃ / (23S)-1a,23-dihydroxy-25,26-didehydrocholecalciferol	(5Z,7E)-(1S,3R,23S)-9,10-seco-5,7,10(19),25-cholestatetraene-1,3,23-triol	VVD0185	Sachiko Yamada	1a,23S-(OH)₂-25,26-dehydro-D₃	C₂₇H₄₂O₃	414.621		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Competitive binding to rat intestinal vitamin D receptor, 0.048. (Ref. 0237)																		[0237]
183		(22E)-(24R)-1a,24-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(24R)-1a,24-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,24R)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24-triol	VVD0186	Sachiko Yamada	(22E)-1a,24R-(OH)₂-22,23-didehydro-D₃	C₂₇H₄₂O₃	414.621		Affinity for chick the intestinal receptor : 1/10 as active as 1,25-(OH)₂D₃. Activities in increasing intestinal calcium transport, serum calcium and inorganic phosphorus concentration and bone ash were determined in compared with 1,25-(OH)₂D₃ and its 24S-epimer. This compound is less potent than either its 24S-epimer or 1,25-(OH)₂D₃ in these activities. (Ref. 0241)							(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0241)		¹H-NMR (d, CDCl₃, 400.5MHz) 0.57 (3H, s, 18-H₃), 0.87 (3H, d, J = 6.7 Hz, 26-H₃), 0.92 (3H, d, J = 6.7 Hz, 27-H₃), 1.04 (3H, d, J = 6.6 Hz, 21-H₃), 2.32 (1H, dd, J = 13.7 and 6.6 Hz), 2.60 (1H, dd, J = 13.4 and 3.4 Hz), 2.83 (1H, dd, J = 12.6 and 4.0 Hz), 4.23 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.00 (1H, br s, W₁_/₂ = 4.3 Hz, 19-H), 5.33 (1H, br s, W₁_/₂ = 4.3 Hz, 19-H), 5.39 (1H, dd, J = 15.2 and 7.1 Hz, 22-H), 5.51 (1H, dd, J = 15.2 and 8.3 Hz, 23-H), 6.01 (1H, d, J = 11.4 Hz, 7-H), 6.38 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0241)	m/z 414 (M⁺), 396, 378, 363, 360, 345, 335, 317, 287, 269, 251, 249, 152, 135, 134, 109 (Ref. 0241)				Synthesis was started with dinorcholenic acid acetate and achieved via Barton				[0241]
184		(22E)-(24S)-1a,24-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(24S)-1a,24-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,24S)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24-triol	VVD0187	Sachiko Yamada	(22E)-1a,24S-(OH)₂-22,23-didehydro-D₃	C₂₇H₄₂O₃	414.621		Affinity for chick the intestinal receptor : nearly as active as 1,25-(OH)₂D₃. Activities in increasing intestinal calcium transport, serum calcium and inorganic phosphorus concentration and bone ash were determined in compared with 1,25-(OH)₂D₃ and its 24R-epimer. This compound is less potent than 1,25-(OH)₂D₃ in these activities but it more potent than its 24R-epimer. (Ref. 0241)							(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0241)		¹H-NMR (d, CDCl₃, 400.5MHz) 0.57 (3H, s, 18-H₃), 0.87 (3H, d, J = 6.7 Hz, 26-H₃), 0.92 (3H, d, J = 6.7 Hz, 27-H₃), 1.05 (3H, d, J = 6.6 Hz, 21-H₃), 2.32 (1H, dd, J = 13.7 and 6.6 Hz), 2.60 (1H, dd, J = 13.4 and 3.4 Hz), 2.83 (1H, dd, J = 12.6 and 4.0 Hz), 4.23 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.00 (1H, br s, W₁_/₂ = 4.3 Hz, 19-H), 5.33 (1H, br s, W₁_/₂ = 4.3 Hz, 19-H), 5.37 (1H, dd, J = 15.4 and 7.5 Hz, 22-H), 5.46 (1H, dd, J = 15.4 and 8.3 Hz, 23-H), 6.01 (1H, d, J = 11.4 Hz, 7-H), 6.38 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0241)	m/z 414 (M⁺), 396, 378, 363, 360, 345, 335, 317, 287, 269, 251, 249, 152, 135, 134, 109 (Ref. 0241)				Synthesis was started with dinorcholenic acid acetate and achieved via Barton				[0241]
185		1a,25-dihydroxy-9,11-didehydrovitamin D₃ / 1a,25-dihydroxy-9,11-didehydrocholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,9(11),10(19)-cholestatetraene-1,3,25-triol	VVD0188	Sachiko Yamada	1a,25-(OH)₂-9,11-didehydro-D₃	C₂₇H₄₂O₃	414.621																From de-A,B-cholesta-9(11),25-dien-8-one and A-ring synthon (1-ethynyl-3S,5R-dihydroxy-2-methyl-1-cyclohexene derivative), which was obtained in 6 steps from Carvone, via 9,10-seco-5(10),6,7,9(11),25-cholestapentaene-1,3-diol derivative as the key intermediate. (Ref. 0225)				[0225]
186		1a,25-dihydroxy-16,17-didehydrovitamin D₃ / 1a,25-dihydroxy-16,17-didehydrocholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19),16-cholestatetraene-1,3,25-triol	VVD0189	Sachiko Yamada	1a,25-(OH)₂-16,17-didehydro-D₃	C₂₇H₄₂O₃	414.621		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 10 ; Competitive binding to rat intestinal vitamin D receptor, 240 ; Differentiation of human leukemia cells (HL-60), 500. (Ref. 0237)																		[0237]
187		1a,25-dihydroxy-22,23-didehydrovitamin D₃ / 1a,25-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0190	Sachiko Yamada	(22E)-1a,25-(OH)₂-22,23-didehydro-D₃	C₂₇H₄₂O₃	414.621		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 10 ; Intestinal calcium absorption in rat, 92 ; Bone calcium mobilization in rat, 133 ; Competitive binding to rat intestinal vitamin D receptor, 122 ; Differentiation of human leukemia cells (HL-60), 125. (Ref. 0237)					[a] +57.2 (c = 0.14 in EtOH) (Ref. 0159)		(MeOH) lmax (nm) (emax) 266 (17300) lmin (nm) 228 (Ref. 0159)		¹H-NMR (d, CDCl₃, 400MHz) 0.57 (3H, s, 18-CH₃), 1.05 (3H, d, J = 6.6 Hz, 21-CH₃), 1.20 (6H, s, 26- and 27-CH₃), 4.23 (1H, m, 3-H), 4.45 (1H, m, 1-H), 5.02 [1H, m (sharp), 19Z-H], 5.35 [1H, m (sharp), 19E-H], 5.42 (2H, m, 22- and 23-H), 6.04 (1H, d, J = 11.3 Hz, 7-H), 6.39 (1H, d, J = 11.3 Hz, 6-H) (Ref. 0159)	m/z 415 (6.8%) (M⁺+1), 397 (100%) (M⁺+1-H₂O), 379 (38%) (M⁺+1-2 H₂O), 287 (6.4%) (M⁺-side chain), 269 (7.2%), 251 (2.0%), 152 (2.4%), 134 (2.0%) (Ref. 0159)								[0159] / [0237]
188		(23E)-1a,25-dihydroxy-23,24-didehydrovitamin D₃ / (23E)-1a,25-dihydroxy-23,24-didehydrocholecalciferol	(5Z,7E,23E)-(1S,3R)-9,10-seco-5,7,10(19),23-cholestatetraene-1,3,25-triol	VVD0191	Sachiko Yamada	(23E)-1a,25-(OH)₂-23,24-didehydro-D₃	C₂₇H₄₂O₃	414.621
189		1a,25-dihydroxy-6,7-didehydroprevitamin D₃ / 1a,25-dihydroxy-6,7-didehydroprecholecalciferol	(1S,3R)-9,10-seco-5(10),8-cholestadien-6-yne-1,3,25-triol	VVD0192	Sachiko Yamada	1a,25-(OH)₂-6,7-dehydro-pre-D₃	C₂₇H₄₂O₃	414.621
190		1b,25-dihydroxy-6,7-didehydro-3-epiprevitamin D₃ / 1b,25-dihydroxy-6,7-didehydro-3-epiprecholecalciferol	(1R,3S)-9,10-seco-5(10),8-cholestadien-6-yne-1,3,25-triol	VVD0193	Sachiko Yamada	1b,25-(OH)₂-6,7-didehydro-3-epipre-D₃	C₂₇H₄₂O₃	414.621
191		(17S,20S)-1a,25-dihydroxy-17,20-methano-21-norvitamin D₃ / (17S,20S)-1a,25-dihydroxy-17,20-methano-21-norcholecalciferol	(5Z,7E)-(1S,3R,17S,20S)-17,20-methano-21-nor-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0194	Sachiko Yamada	17S,20S-methano-1a,25-(OH)₂-21-nor-D₃	C₂₇H₄₂O₃	414.621																From 4-hydroxyhydrindanone via introduction of the side chain and A-ring fragment. Stereoselective introduction of 17,20-methano-bridge was achieved by the reaction of 17E(20)-ene CD-fragment with dichlorocarbene followed by reduction with sodium in ethanol. (Ref. 0315)				[0315]
192		(17S,20R)-1a,25-dihydroxy-17,20-methano-21-norvitamin D₃ / (17S,20R)-1a,25-dihydroxy-17,20-methano-21-norcholecalciferol	(5Z,7E)-(1S,3R,17S,20R)-17,20-methano-21-nor-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0195	Sachiko Yamada	17S,20R-methano-1a,25-(OH)₂-21-nor-D₃	C₂₇H₄₂O₃	414.621																From 4-hydroxyhydrindanone via introduction of the side chain and A-ring fragment. Stereoselective introduction of 17,20-methano-bridge was achieved by the reaction of 17Z(20)-ene CD-fragment with dichlorocarbene followed by reduction with sodium in ethanol. (Ref. 0315)				[0315]
193		(22E)-(24R)-24,25-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(24R)-24,25-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(3S,24R)-9,10-seco-5,7,10(19),22-cholestatetraene-3,24,25-triol	VVD0196	Sachiko Yamada	(22E)-24,25-(OH)₂22,23-didehydro-D₃	C₂₇H₄₂O₃	414.621									(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0193)		¹H-NMR (d, CDCl₃) 0.56 (3H, s, 13-Me), 1.05 (3H, d, J = 6 Hz, 20-Me), 1.16 and 1.20 (each 3H, s, 25-Me), 3.83 (1H, d, J = 7 Hz, 24-H), 3.96 (1H, m, 3a-H), 4.83 and 5.06 (each 1H, br s, 19-H₂), 5.42 (1H, dd, J = 15.7 Hz, 23-H), 5.60 (1H, dd, J = 15.8 Hz, 22-H), 6.05 and 6.25 (each 1H, d, J = 11 Hz, 6- and 7-H) (Ref. 0193)	m/z 414.3132 (Ref. 0193)								[0193]
194		(22E)-(24S)-24,25-dihydroxy-22,23-didehydrovitamin D₃ / (22E)-(24S)-24,25-dihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(3S,24S)-9,10-seco-5,7,10(19),22-cholestatetraene-3,24,25-triol	VVD0197	Sachiko Yamada	(22E)-24S,25-(OH)₂-22,23-didehydro-D₃	C₂₇H₄₂O₃	414.621									(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0193)		¹H-NMR (d, CDCl₃) 0.56 (3H, s, 13-Me), 1.04 (3H, d, J = 6 Hz, 20-Me), 1.16 and 1.20 (each 3H, s, 25-Me), 3.86 (1H, d, J = 7 Hz, 24-H), 3.96 (1H, m, 3a-H), 4.84 and 5.07 (each 1H, br s, 19-H₂), 5.44 (1H, dd, J = 15.7 Hz, 23-H), 5.64 (1H, dd, J = 15.8 Hz, 22-H), 6.04 and 6.26 (each 1H, d, J = 11 Hz, 6- and 7-H) (Ref. 0193)	m/z 414.3125 (Ref. 0193)								[0193]
195		calicoferol B	(8S,16S)-3,16-dihydroxy-9,10-seco-1,3,5(10)-cholestatrien-9-one	VVD0198	Sachiko Yamada	calicoferol B	C₂₇H₄₂O₃	414.621		Toxic against brine shrimp larvae. (Ref. 0317)													Isolated from a gorgonian of the genus Calicogorgia. (Ref. 0318)					[0317] / [0318]
196		(24R,25R)-25,26-epoxy-1a,24-dihydroxyvitamin D₃ / (24R,25R)-25,26-epoxy-1a,24-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,24R,25R)-25,26-epoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0199	Sachiko Yamada	25R,26-epoxy-1a,24R-(OH)₂D₃	C₂₇H₄₂O₄	430.620		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 20 and 73, respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 12, 160 and 45, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : 1, 3, 1 and < 1, respectively. (Ref. 0240)														By Sharpless kinetic epoxidation of the corresponding olefinic precursor. (Ref. 0243)				[0240] / [0243]
197		(24R,25S)-25,26-epoxy-1a,24-dihydroxyvitamin D₃ / (24R,25S)-25,26-epoxy-1a,24-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,24R,25S)-25,26-epoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0200	Sachiko Yamada	25S,26-epoxy-1a,24R-(OH)₂D₃	C₂₇H₄₂O₄	430.620		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 9 and 30, respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 33, 4 and 34, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : 1, 2, 4 and 1, respectively. (Ref. 0240)														By Sharpless kinetic epoxidation of the corresponding olefinic precursor. (Ref. 0243)				[0240] / [0243]
198		(24S,25R)-25,26-epoxy-1a,24-dihydroxyvitamin D₃ / (24S,25R)-25,26-epoxy-1a,24-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,24S,25R)-25,26-epoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0201	Sachiko Yamada	25R,26-epoxy-1a,24S-(OH)₂D₃	C₂₇H₄₂O₄	430.620		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 10 and 7, respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 44, 7 and 20, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : 3, 2, 1 and 2, respectively. (Ref. 0240)														By Sharpless kinetic epoxidation of the corresponding olefinic precursor. (Ref. 0243)				[0240] / [0243]
199		(24S,25S)-25,26-epoxy-1a,24-dihydroxyvitamin D₃ / (24S,25S)-25,26-epoxy-1a,24-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,24S,25S)-25,26-epoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0202	Sachiko Yamada	25S,26-epoxy-1a,24S-(OH)₂D₃	C₂₇H₄₂O₄	430.620		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 5 and 3, respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60), osteosarcoma (MG-63) and breast carcinoma (MCF-7) cells : 7, 15 and 20, respectively. Elevation of serum calcium, serum osteocalcin, bone calcium and duodenal calbindin in rachitic chicks : 2, < 1, < 1 and < 1, respectively. (Ref. 0240)														By Sharpless kinetic epoxidation of the corresponding olefinic precursor. (Ref. 0243)				[0240] / [0243]
200		1a,25-dihydroxy-18-oxovitamin D₃ / 1a,25-dihydroxy-18-oxocholecalciferol	(5Z,7E)-(1S,3R)-1,3,25-trihydroxy-9,10-seco-5,7,10(19)-cholestatrien-18-al	VVD0203	Sachiko Yamada	1a,25-(OH)₂-18-oxo-D₃	C₂₇H₄₂O₄	430.620
201		1a,25-dihydroxy-24-oxovitamin D₃ / 1a,25-dihydroxy-24-oxocholecalciferol	(5Z,7E)-(1S,3R)-1,3,25-trihydroxy-9,10-seco-5,7,10(19)-cholestatrien-24-one	VVD0204	Sachiko Yamada	1a,25-(OH)₂-24-oxo-D₃	C₂₇H₄₂O₄	430.620		Competition of 1,25-(OH)₂D₃ and its derivatives for the 3.7 S cytosolic receptors present in intestine and thymus; Table (Ref. 0068)							lmax (nm) 265, lmin (nm) 228 (Ref. 0067)		¹H-NMR (d, CDCl₃, 200MHz) 6.39 (d, J = 11.2Hz, 6-H), 6.03 (d, J = 11.2 Hz, 7-H), 5.34 (broad s, 19Z-H), 5.01 (broad s, 19E-H), 4.44 (m, 1b-H), 4.24 (m, 3a-H), 1.40 (s, 26C, 27C-CH₃), 0.94 (d, J = 5.86 Hz, 21C-CH₃), 0.56 (s, 18C-CH₃); spectrum (Ref. 0067)	m/z 430 (5, M⁺), 412 (38, M⁺-H₂O), 394 (59, M⁺-2H₂O), 376 (10, M⁺-3H₂O), 269 (16, M⁺-side chain), 251 (42, 269-H₂O), 152 [24, (A ring+C₆+C₇)⁺], 134 (59, 152-H₂O); spectrum (Ref. 0067) m/z 430 (M⁺), 412, 394, 287, 269, 251, 152, 134; spectrum (Ref. 0102)			Isolation and identification from homogenates of either chick small intestine mucoca or rat kidney incubated with either 1,25-(OH)₂D₃ or 1,24,25-(OH)₃D₃. (Ref. 0067)		1,25-(OH)₂-24-oxo-D₃ is metabolized to 1-OH-tetranor-D₃ 23-carboxylic acid (calcitroic acid) (Ref. 0070/0073) via 1,23S,25-(OH)₃-24-oxo-D₃ (Ref. 0067) and 1,23-(OH)₂-tetranor-D₃ (Ref. 0069) .			[0067] / [0068] / [0069] / [0070] / [0073] / [0102]
202		(23S)-23,25-dihydroxy-24-oxovitamin D₃ / (23S)-23,25-dihydroxy-24-oxocholecalciferol	(5Z,7E)-(3S,23S)-3,23,25-trihydroxy-9,10-seco-5,7,10(19)-cholestatrien-24-one	VVD0205	Sachiko Yamada	23S,25-(OH)₂-24-oxo-D₃	C₂₇H₄₂O₄	430.620									lmax (nm) 265, lmin (nm) 228 (Ref. 0103)	(CHCl₃) 3500, 2930, 2860, 1708 cm^-¹ (Ref. 0103)	¹H-NMR (d, CDCl₃, 100MHz) 0.57 (3H, s, 18-H), 1.09(3H, d, J = 6 Hz, 21-H), 1.42 and 1.44 (each 3H, s, 26- and 27-H), 3.96 (1H, m, 3-H), 4.66 (1H, m, 23-H), 4.84 (1H, bs, 19E-H), 5.07 (1H, bs, 19Z-H), 6.04 (1H, d, J = 11.5 Hz, 7-H), 6.24 (1H, d, J = 11.5 Hz, 6-H) (Ref. 0103)	m/z 430 (M⁺), 412, 372, 342, 271, 253, 136, 118; spectrum(Ref. 0102)			Isolation and identification from chicken kidney homogenate incubated with 25-OH-24-oxo D₃. (Ref. 0102) Isolation and identification from rat kidneys perfused with pharmacological concentration of 25-OHD₃. (Ref. 0098)	Stereoselective synthesis of (23S)-23,25-dihydroxy-24-oxovitamin D₃ from 3b-hydroxy-5,7-cholestadien-24-one, and determination of the configulation at C(23) of the natural metabolite. (Ref. 0103)	In vitro, 23S,25-dihydroxy-24-oxovitamin D₃ is cleaved at 23,24-bond to afford 23-hydroxy-24,25,26,27-tetranorvitamin D₃. (Ref. 0105) In vivo, 23S,25-(OH)2-24-oxo-D₃ is conjugated at 23-hydroxyl group as b-glucuronide to be excreted to bile. (Ref. 0106)			[0098] / [0102] / [0103] / [0105] / [0106]
203		(23S,25R)-25-hydroxyvitamin D₃ 26,23-lactol / (23S,25R)-25-hydroxycholecalciferol 26,23-lactol	(5Z,7E)-(3S,23S,25R)-3,25-dihydroxy-9,10-seco-5,7,10(19)-cholestatrieno-26,23-lactol	VVD0206	Sachiko Yamada	25R-OHD₃ 26,23S-lactol	C₂₇H₄₂O₄	430.620									lmax (nm) 265, lmin (nm) 228 (Ref. 0124)			m/z 430 (M⁺), 412 (M⁺-H₂O), 342, 309 (342-H₂O-CH₃), 136, 118; spectrum (Ref. 0124)			Produced by incubating vitamin D supplemented Chick Kidney homogenate with 23S,25R,26-(OH)₃D₃. (Ref. 0124)	From 25R-OHD₃ 26,23S-lactone (Ref. 0113) by reduction with diisobutyl alminium hydride. (Ref. 0125)				[0113] / [0124] / [0125]
204		(22E)-(24R)-1a,24,25-trihydroxy-22,23-didehydrovitamin D₃ / (22E)-(24R)-1a,24,25-trihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,24R)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24,25-tetrol	VVD0207	Sachiko Yamada	(22E)-1a,24R,25-(OH)₃-22,23-didehydro-D₃	C₂₇H₄₂O₄	430.620		Increase of Intestinal Calcium Transport and Serum Calcium Concentration in Response to Either (22E,24R)-1,24-(OH)₂-D²²-D₃, (22E,24S)-1,24-(OH)₂-D²²-D₃ or 1,25-(OH)₂D₃. :Table (Ref. 0194) Increase of Serum Inorganic Phosphorus Concentration and Bone Ash in Response to Either (22E,24R)-1,24-(OH)₂-D²²-D₃, (22E,24S)-1,24-(OH)₂-D²²-D₃ or 1,25-(OH)₂D₃. : Table (Ref. 0194)							(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0194)		¹H-NMR (d, CDCl₃, 400.5MHz) 0.57 (3H, s, 18-H₃), 0.87 (3H, d, J = 6.7 Hz, 26-H₃), 0.92 (3H, d, J = 6.7 Hz, 27-H₃), 1.05 (3H, d, J = 6.6 Hz, 21-H₃), 2.32 (1H, dd, J = 13.7 and 6.6 Hz), 2.60 (1H, dd, J = 13.4 and 3.4 Hz), 2.83 (1H, dd, J = 12.6 and 4.0 Hz), 4.23 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.00 (1H, br s, W₁_/₂ = 4.3 Hz, 19-H), 5.33 (1H, br s, W₁_/₂ = 4.3 Hz, 19-H), 5.37 (1H, dd, J = 15.4 and 7.5 Hz, 22-H), 5.46 (1H, dd, J = 15.4 and 8.3 Hz, 23-H), 6.01 (1H, d, J = 11.4 Hz, 7-H), 6.38 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0194)	m/z 414 (M⁺), 396, 378, 363, 360, 345, 335, 317, 287, 269, 251, 249, 152, 135, 134, 109 (Ref. 0194)								[0194]
205		(22E)-(24S)-1a,24,25-trihydroxy-22,23-didehydrovitamin D₃ / (22E)-(24S)-1a,24,25-trihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,24S)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,24,25-tetrol	VVD0208	Sachiko Yamada	(22E)-1a,24S,25-(OH)₃-22,23-didehydro-D₃	C₂₇H₄₂O₄	430.620		Increase of Intestinal Calcium Transport and Serum Calcium Concentration in Response to Either (22E,24R)-1,24-(OH)₂-D²²-D₃, (22E,24S)-1,24-(OH)₂-D²²-D₃ or 1,25-(OH)₂D₃. : Table(Ref. 0194) Increase of Serum Inorganic Phosphorus Concentration and Bone Ash in Response to Either (22E,24R)-1,24-(OH)₂-D²²-D₃, (22E,24S)-1,24-(OH)₂-D²²-D₃ or 1,25-(OH)₂D₃. : Table (Ref. 0194)							(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0194)		¹H-NMR (d, CDCl₃, 400.5MHz) 0.57 (3H, s, 18-H₃), 0.87 (3H, d, J = 6.7 Hz, 26-H₃), 0.92 (3H, d, J = 6.7 Hz, 27-H₃), 1.04 (3H, d, J = 6.6 Hz, 21-H₃), 2.32 (1H, dd, J = 13.7 and 6.6 Hz), 2.60 (1H, dd, J = 13.4 and 3.4 Hz), 2.83 (1H, dd, J = 12.6 and 4.0 Hz), 4.23 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.00 (1H, br s, W₁_/₂ = 4.3 Hz, 19-H), 5.33 (1H, br s, W₁_/₂ = 4.3 Hz, 19-H), 5.39 (1H, dd, J = 15.2 and 7.1 Hz, 22-H), 5.51 (1H, dd, J = 15.2 and 8.3 Hz, 23-H), 6.01 (1H, d, J = 11.4 Hz, 7-H), 6.38 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0194)	m/z 414 (M⁺), 396, 378, 363, 360, 345, 335, 317, 287, 269, 251, 249, 152, 135, 134, 109 (Ref. 0194)								[0194]
206		(22E)-(25R)-1a,25,26-trihydroxy-22,23-didehydrovitamin D₃ / (22E)-(25R)-1a,25,26-trihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,25R)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25,26-tetrol	VVD0209	Sachiko Yamada	(22E)-1a,25R,26-(OH)₃-22,23-didehydro-D₃	C₂₇H₄₂O₄	430.620
207		(22E)-(25S)-1a,25,26-trihydroxy-22,23-didehydrovitamin D₃ / (22E)-(25S)-1a,25,26-trihydroxy-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,25S)-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25,26-tetrol	VVD0210	Sachiko Yamada	(22E)-1a,25S,26-(OH)₃-22,23-didehydro-D₃	C₂₇H₄₂O₄	430.620		Biological activity (% of 1,25-(OH)₂D₃ effect) : Vitamin D receptor binding (chick intestine), 5.5% ; Inhibition of cell (HL-60) proliferation, 50% ; Induction cell (HL-60) differentiation, 100% ; ⁴⁵Ca retention in kidney in rats, <10%. (Ref. 0297)														By convergent method in which CD ring synthon and A-ring precursor were combined by Wittig-Horner reaction. The desired side chain structure was constructed stereoselectively by 1,3-dipolar cycloaddition of C-23 nitrone with methyl methacrylate as key step. (Ref. 0297)				[0297]
208		(23S,25R)-1a,25-dihydroxyvitamin D₃ 26,23-lactol / (23S,25R)-1a,25-dihydroxycholecalciferol 26,23-lactol	(5Z,7E)-(1S,3R,23S,25R)-1,3,25-trihydroxy-9,10-seco- 5,7,10,(19)-cholestatrieno-26,23-lactol	VVD0211	Sachiko Yamada	1a,25R-(OH)₂D₃ 26,23S-lactol	C₂₇H₄₂O₅	446.619		Affinity for the chick intestinal receptor : 1/59 as active as 1,25-(OH)₂D₃. (Ref. 0242)																		[0242]
209		(23R)-1a,23,25-trihydroxy-24-oxovitamin D₃ / (23R)-1a,23,25-trihydroxy-24-oxocholecalciferol	(5Z,7E)-(1S,3R,23R)-1,3,23,25-tetrahydroxy-9-10-seco-5,7,10(19)-cholestatrien-24-one	VVD0212	Sachiko Yamada	1a,23R,25-(OH)₃-24-oxo-D₃	C₂₇H₄₂O₅	446.619		The title compound suppressed PTH secretion significantly (p < 0.01) at 10^-¹² M and is equipotent with 1,25-(OH)₂D₃, though the affinity of the former for the receptor in paratyroid cells was 10 times less effective than that of the latter. (Ref. 0271)								Mixture (9:1) of 23R and 23S epimers : (neat) 3391.4, 2925.3, 1711.7, 1375.1, 1043.7 cm^-¹ (Ref. 0271)	¹³C-NMR (d, CDCl₃, 100MHz) major isomer, 217.03, 147.64, 142.87, 133.02, 124.93, 117.19, 111.80, 77.20, 71.01, 70.84, 66.86, 56.90, 56.39, 46.11, 45.27, 42.87, 40.97, 40.50, 33.12, 29.04, 27.77, 27.72, 27.64, 23.53, 22.27, 18.14, 12.08 (Ref. 0271)					Two C(23) epimers of the title compound were synthesized by palladium catalyzed coupling of the appropriate CD ring fragment with A ring enyne as key step. The A-ring precursor was prepared from quinic acid. The configuration at C(23) of natural metabolite produced in neonatal human keratinocytes was determined to be S by direct comparison with the synthetic two epimers on HPLC. (Ref. 0271)				[0271]
210		(23S)-1a,23,25-trihydroxy-24-oxovitamin D₃ / (23S)-1a,23,25-trihydroxy-24-oxocholecalciferol	(5Z,7E)-(1S,3R,23S)-1,3,23,25-tetrahydroxy-9-10-seco-5,7,10(19)-cholestatrien-24-one	VVD0213	Sachiko Yamada	1a,23S,25-(OH)₃-24-oxo-D₃	C₂₇H₄₂O₅	446.619		The title compound suppressed PTH secretion significantly (p < 0.01) at 10^-¹² M and is equipotent with 1,25-(OH)₂D₃, though the affinity of the former for the receptor in paratyroid cells was 10 times less effective than that of the latter. (Ref. 0271)							lmax (nm) 265, lmin (nm) 228 (Ref. 0067)	Mixture (9:1) of 23R and 23S epimers : (neat) 3391.4, 2925.3, 1711.7, 1375.1, 1043.7 cm ^-¹ (Ref. 0271)	¹H-NMR (d, CDCl₃, 200MHz) 6.39 (d, J = 11.2 Hz, 6-H), 6.02 (d, J = 11.2 Hz, 7-H), 5.34 (broad s, 19Z-H), 5.01 (broad s, 19E-H), 4.44 (m, 1b-H), 4.23 (m, 3a-H), 1.10 (d, J = 6.3 Hz, 21C-CH₃), 0.57 (s, 18C-CH₃); spectrum (Ref. 0067) ¹³C-NMR (d, CDCl₃, 100MHz) major isomer, 217.03, 147.64, 142.87, 133.02, 124.93, 117.19, 111.80, 77.20, 71.01, 70.84, 66.86, 56.90, 56.39, 46.11, 45.27, 42.87, 40.97, 40.50, 33.12, 29.04, 27.77, 27.72, 27.64, 23.53, 22.27, 18.14, 12.08 (Ref. 0271)	m/z 446 (8, M⁺), 428 (2.7, M⁺-H₂O), 410 (10, M⁺-2H₂O), 388 (6, M⁺-C₃H₆O), 370 (17, 388-H₂O), 352 (10, 388-2H₂O), 287 (2, M⁺-side chain), 269 (10, 287-H₂O), 251 (10, 287-2H₂O), 152 [28, (A ring+C₆+C₇)⁺], 134 (100, 152-H₂O); spectrum(Ref. 0067)			Isolation and identification from homogenates of either chick small intestine mucoca or rat kidney incubated with either 1,25-(OH)₂D₃ or 1,24,25-(OH)₃D₃. (Ref. 0067)	Two C(23) epimers of the title compound were synthesized by palladium catalyzed coupling of the appropriate CD ring fragment with A ring enyne as key step. The A-ring precursor was prepared from quinic acid. The configuration at C(23) of natural metabolite produced in neonatal human keratinocytes was determined to be S by direct comparison with the synthetic two epimers on HPLC. (Ref. 0271)	1,23S,25-(OH)₃ -24-oxo-D₃ is metabolized to 1-OH-tetranor-D₃ 23-carboxylic acid (calcitroic acid) (Ref. 0070/0073) via 1,23-(OH)₂-tetranor-D₃. (Ref. 0069)			[0067] / [0069] / [0070] / [0073] / [0271]
211		2a-chloro-1b,25-dihydroxyvitamin D₃ / 2a-chloro-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1S,2S,3R)-2-chloro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0214	Sachiko Yamada	2a-chloro-1b,25-(OH)₂D₃	C₂₇H₄₃ClO₃	451.081		Affinity for rat intestinal VDR, 10 % of the activity of 25-OHD₃ ; gene transcription (VDRE-CAT assay), nearly 10,000 times weaker than 1,25-(OH)₂D₃. (Ref. 0325)	CH₃OH :173-179 C (Ref. 0325)						(CH₃OH) lmax (nm) (emax) 264 (15300) (Ref. 0325)		¹H-NMR (d, CDCl₃, 400MHz) 0.50 (3H, s, 18-H), 0.91 (3H, d, J = 6.3 Hz, 21-H), 1.19 (6H, s, 26- and 27-H), 2.25 (1H, m, 4b-H), 2.54 (1H, t, J = 9.7 Hz, 4a-H), 2.71 (1H, m, 9b-H), 3.81-3.83 (2H, m, 2b-H and 3a-H), 4.12 (1H, m, 1a-H), 5.11 and 5.56 (2H, 2t, J = 2 Hz, 19-H), 5.94 and 6.38 (2H, 2d, J = 11.3 Hz, 7- and 6-H) (Ref. 0325)					From 1b,2b-epoxy-25-hydroxy-7-dehydrocholesterol via the reaction with hydrogen chloride followed by photochemical transformation. (Ref. 0325)				[0325]
212		6-fluorovitamin D₃ / 6-fluorocholecalciferol	(5E,7E)-(3S)-6-fluoro-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0215	Sachiko Yamada	6-F-D₃	C₂₇H₄₃FO	402.628		Ability to compete with tritiated 1,25-(OH)₂-D₃ for binding to the chick intestinal receptor (RCI) : 0.26% of 1,25-(OH)₂D₃ effect. The title compound showed no biological action on either intestinal calcium absorption (ICA) or bone calcium mobilization at doses up to 130 nmol but it significantly inhibited vitamin D-mediated ICA. (Ref. 0294)							(Hexane) lmax (nm) (emax) 268 (10300) (Ref. 0295)		¹H-NMR (d, CDCl₃) 6.00 (1H, br d, J = 6.0 Hz), 5.10 (1H, s), 4.93 (1H, s), 4.02 (1H, m), 0.95 (3H, d, J = 6.4 Hz), 0.87 (6H, d, J = 6.4 Hz), 0.66 (3H, s) (Ref. 0295)	m/z (relative intensity) 402 (parent, 50), 369 (67), 315 (26), 314 (100), 299 (21), 281 (23), 271 (25), 299 (33), 163 (30), 161 (32), 147 (23), 145 (30), 133 (30), 109 (29), 107 (32), 105 (30), 95 (40), 81 (41) (Ref. 0295)				From 6-fluorocholesteryl acetate via conventional photochemical conversion of the corresponding 7-dehydro derivative. (Ref. 0295)				[0294] / [0295]
213		(10Z)-19-fluorovitamin D₃ / (10Z)-19-fluorocholecalciferol	(5Z,7E,10Z)-(3S)-19-fluoro-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0216	Sachiko Yamada	(10Z)-19-F-D₃	C₂₇H₄₃FO	402.628									(95% EtOH) lmax (nm) 263 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.55 (3H, s, 18-H), 0.86 and 0.87 (each 3H, d, J = 6.6 Hz, 26- and 27-H), 0.92 (3H, d, J = 6.2 Hz, 21-H), 2.60 (1H, dd, J = 13.2 and 3.5 Hz, 4-H), 2.81 (1H, m, 9-H), 3.95 (1H, tt, J = 7.3 and 3.6 Hz, 3-H), 5.63 (1H, d, J = 11.3 and 5.3 Hz, 7-H), 6.37 (1H, d, J = 11.3 Hz, 6-H), 6.47 (1H, d, J = 85.5 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -127.5 (d, J = 85.5 Hz) (Ref. 0333)					From vitamin D₃ via elimination of the exocyclic methylene and introduction of a fluoromethylene group as key steps. (Ref. 0333)				[0333]
214		(10E)-19-fluorovitamin D₃ / (10E)-19-fluorocholecalciferol	(5Z,7E,10E)-(3S)-19-fluoro-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0217	Sachiko Yamada	(10E)-19-F-D₃	C₂₇H₄₃FO	402.628									(EtOH) lmax (nm) (emax) 260 (20900) (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.53 (3H, s, 18-H), 0.86 and 0.87 (each 3H, d, J = 6.6 Hz, 26- and 27-H), 0.92 (3H, d, J = 6.4 Hz, 21-H), 2.56 (2H, m), 2.78 (1H, m), 3.93 (1H, m, 3-H), 5.93 and 6.28 (each 1H, d, J = 11.1 Hz, 6, 7-H), 6.51 (1H, d, J = 87.4 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -132.5 (d, J = 87.4 Hz, 19-F) (Ref. 0333)	m/z 402 (M⁺, 36), 384 (21), 382 (8), 364 (16), 317 (5), 289 (13), 271 (19), 269 (6), 259 (11), 154 (45), 136 (70), 135 (100) (Ref. 0333)				From vitamin D₃ by regioselective electrophilic 19-fluorination of its sulfur dioxide adduct as a key step. (Ref. 0346)				[0333] / [0346]
215		(5E,10Z)-19-fluorovitamin D₃ / (5E,10Z)-19-fluorocholecalciferol	(5E,7E,10Z)-(3S)-19-fluoro-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0218	Sachiko Yamada	(5E,10Z)-19-F-D₃	C₂₇H₄₃FO	402.628									(EtOH) lmax (nm) 270 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-H), 0.867 and 0.871 (each 3H, d, J = 6.6 Hz, 26- and 27-H), 0.92 (3H, d, J = 6.4 Hz, 21-H), 2.83 (2H, m), 3.86 (1H, m, 3-H), 5.93 and 6.63 (each 1H, d, J = 11.5 Hz, 6, 7-H), 6.51 (1H, d, J = 86.6 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -134.8 (d, J = 86.6 Hz, 19-F) (Ref. 0333)	m/z 402 (M⁺, 100), 384 (7), 382 (4), 364 (4), 317 (20), 289 (42), 271 (18), 269 (7), 259 (47), 194 (12), 176 (16), 154 (20), 136 (39), 135 (67) (Ref. 0333)				From vitamin D₃ by regioselective electrophilic 19-fluorination of its sulfur dioxide adduct as a key step. (Ref. 0346)				[0333] / [0346]
216		(5E,10E)-19-fluorovitamin D₃ / (5E,10E)-19-fluorocholecalciferol	(5E,7E,10E)-(3S)-19-fluoro-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0219	Sachiko Yamada	(5E,10E)-19-F-D₃	C₂₇H₄₃FO	402.628									(EtOH) lmax (nm) 209, 269 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.55 (3H, s, 18-H), 0.868 and 0.873 (each 3H, d, J = 6.6 Hz, 26- and 27-H), 0.92 (3H, d, J = 6.7 Hz, 21-H), 2.67 (1H, m), 2.82 (2H, m), 3.88 (1H, m, 3-H), 5.83 and 6.35 (each 1H, d, J = 11.5 Hz, 6, 7-H), 6.69 (1H, d, J = 86.7 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -135.4 (d, J = 86.7 Hz, 19-F) (Ref. 0333)	m/z 402 (M⁺, 84), 384 (7), 382 (3), 364 (4), 317 (11), 289 (25), 271 (13), 269 (7), 259 (21), 194 (6), 176 (13), 154 (50), 136 (89), 135 (100) (Ref. 0333)				From vitamin D₃ by regioselective electrophilic 19-fluorination of its sulfur dioxide adduct as a key step. (Ref. 0346)				[0333] / [0346]
217		22-fluorovitamin D₃ / 22-fluorocholecalciferol	(5Z,7E)-(3S)-22-fluoro-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0220	Sachiko Yamada	22-F-D₃	C₂₇H₄₃FO	402.628		Serosal/Mucosal Ratio after Administration of Sterols or Vehicle. Mean SEM (n=Number of Animals). : (Ref. 0162) Serum Calcium (mg/dL) after Administration of Sterols or Vehicle. Mean SEM (n=Number). (Ref. 0162) Serosal/Mucosal Ratio and Serum Calcium Response Following Administration of Vitamin D₃ or 22-Fluorovitamin D₃. Mean SEM (n=Number). (Ref. 0162) Calcium Binding Protein Induction by 22-Fluorovitamin D₃ in Duodenal Organ Culture. (Ref. 0162)							(EtOH) lmax (nm) 264, lmin (nm) 227 (Ref. 0162)		¹H-NMR (d, CDCl₃) 3.82 (1H, m, 3a-H), 4.44 (1H, dm, J = 48.2 Hz, 22-H), 4.82 (1H, d, J = 2.24 Hz, 19-H), 5.05 (1H, d, J = 2.24 Hz, 19-H), 6.01 and 6.25 (2H, ABq, J = 11.22 Hz, 6- and 7-H) (Ref. 0162)	m/z 402 (M⁺, 80.51), 384 (M⁺-H₂O, 8.05), 382 (M⁺-HF, 8.88), 369 (25.11), 136 (25.51), 118 (53.82) (Ref. 0162)								[0162]
218		(5Z,10Z)-19-fluoro-1a-hydroxyvitamin-D₃ / (5Z,10Z)-19-fluoro-1a-hydroxycholecalciferol	(5Z,7E,10Z)-(1S,3R)-19-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0221	Sachiko Yamada	(5Z,10Z)-19-F-1a-OHD₃	C₂₇H₄₃FO₂	418.628									(EtOH) lmax (nm) 262 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.53 (3H, s, 18-H), 0.863 and 0.867 (each 3H, d, J = 6.6 Hz, 26- and 27-H), 0.91 (3H, d, J = 6.3 Hz, 21-H), 2.19 (1H, m), 2.32 (1H, m), 2.68 (1H, m), 2.80 (1H, m, 9-H), 4.16 (1H, m, 3-H), 5.09 (1H, br s, 1-H), 5.90 (1H, d, J = 11.1 Hz, 7-H), 6.46 (1H, d, J = 11.1 Hz, 6-H), 6.50 (1H, d, J = 86.0 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -129.8 (d, J = 86.0 Hz) (Ref. 0333)	m/z 418 (M⁺, 6), 400 (5), 398 (5), 380 (10), 362 (52), 347 (8), 305 (5), 287 (5), 285 (5), 267 (8), 249 (34), 195 (35), 135 (100) (Ref. 0333)								[0333]
219		(5Z,10E)-19-fluoro-1a-hydroxyvitamin-D₃ / (5Z,10E)-19-fluoro-1a-hydroxycholecalciferol	(5Z,7E,10E)-(1S,3R)-19-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0222	Sachiko Yamada	(5Z,10E)-19-F-1a-OHD₃	C₂₇H₄₃FO₂	418.628									(EtOH) lmax (nm) 264 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.54 (3H, s, 18-H), 0.86 and 0.87 (each 3H, d, J = 6.6 Hz, 26- and 27-H), 0.92 (3H, d, J = 6.3 Hz, 21-H), 2.14 (1H, m), 2.28 (1H, dd, J = 13.0, 8.6 Hz, 4-H), 2.66 (1H, dd, J = 13.0, 3.9 Hz, 4-H), 2.82 (1H, m, 9-H), 4.20 (1H, m, 3-H), 4.44 (1H, dd, J = 9.2, 4.7 Hz, 1-H), 5.62 (1H, dd, J = 11.3, 5.4 Hz, 7-H), 6.52 (1H, d, J = 11.3 Hz, 6-H), 6.70 (1H, d, J = 84.0 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -127.8 (broard s) (Ref. 0333)	m/z 418 (M⁺, 55), 400 (7), 398 (12), 380 (22), 362 (100), 347 (21), 305 (16), 287 (9), 285 (10), 267 (16), 249 (68), 195 (52), 135 (43) (Ref. 0333)								[0333]
220		(5E,10Z)-19-fluoro-1a-hydroxyvitamin-D₃ / (5E,10Z)-19-fluoro-1a-hydroxycholecalciferol	(5E,7E,10Z)-(1S,3R)-19-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0223	Sachiko Yamada	(5E,10Z)-19-F-1a-OHD₃	C₂₇H₄₃FO₂	418.628									(EtOH) lmax (nm) 269 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.55 (3H, s, 18-H), 0.868 and 0.872 (each 3H, d, J = 6.5 Hz, 26- and 27-H), 0.93 (3H, d, J = 6.2 Hz, 21-H), 2.31 (1H, m), 2.81 (1H, m, 9-H), 3.15 (1H, m, 4-H), 4.15 (1H, m, 3-H), 5.05 (1H, d, J = 3.2 Hz, 1-H), 5.87 (1H, d, J = 11.4 Hz, 7-H), 6.38 (1H, d, J = 11.4 Hz, 6-H), 6.69 (1H, d, J = 85.6 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl3) -133.2 (d, J = 85.6 Hz) (Ref. 0333)	m/z 418 (M⁺, 12), 398 (26), 380 (31), 362 (51), 347 (13), 305 (7), 287 (7), 285 (15), 267 (26), 249 (44), 195 (41), 135 (100) (Ref. 0333)								[0333]
221		(5E,10E)-19-fluoro-1a-hydroxyvitamin-D₃ / (5E,10E)-19-fluoro-1a-hydroxycholecalciferol	(5E,7E,10E)-(1S,3R)-19-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0224	Sachiko Yamada	(5E,10E)-19-F-1a-OHD₃	C₂₇H₄₃FO₂	418.628									(EtOH) lmax (nm) 272 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.57 (3H, s, 18-H), 0.87 and 0.88 (each 3H, d, J = 6.6 Hz, 26- and 27-H), 0.93 (3H, d, J = 6.3 Hz, 21-H), 2.19 (1H, m), 2.32 (1H, m), 2.68 (1H, m), 2.80 (1H, m, 9-H), 3.07 (1H, dd, 4-H), 4.19 (1H, m, 3-H), 4.34 (1H, br s, 1-H), 5.97 (1H, d, J = 11.6 Hz, 7-H), 6.68 (1H, d, J = 11.6 Hz, 6-H), 6.74 (1H, d, J = 83.4 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -132.8 (d, J = 83.4 Hz) (Ref. 0333)	m/z 418 (M⁺, 100), 398 (61), 380 (23), 362 (54), 347 (14), 305 (30), 287 (19), 285 (36), 267 (30), 249 (53), 195 (40), 135 (88) (Ref. 0333)								[0333]
222		25-fluoro-1a-hydroxyvitamin D₃ / 25-fluoro-1a-hydroxycholecalciferol	(5Z,7E)-(1S,3R)-25-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0225	Sachiko Yamada	1a-OH-25-F-D₃	C₂₇H₄₃FO₂	418.628		Binding affinity for chick intestinal cytosol protein : 25-F-1-OHD₃ is 315 times less efective than 1,25-(OH)₂D₃ in competitive protein-binding assay. Intestinal calcium transport and bone mineral mobilization : 25-F-1-OHD₃ is about 50 times less active than 1,25-(OH)₂D₃. Antirachitic potency : 25-F-1-OHD₃ is 40 times less potent than 1,25-(OH)₂D₃. (Ref. 0229)										m/z 418 (M⁺), 380, 152, 134 (Ref. 0229)								[0229]
223		(24R)-25-fluoro-24-hydroxyvitamin D₃ / (24R)-25-fluoro-24-hydroxycholecalciferol	(5Z,7E)-(3S,24R)-25-fluoro-9,10-seco-5,7,10(19)-cholestatriene-3,24-diol	VVD0226	Sachiko Yamada	24R-OH-25-F-D₃	C₂₇H₄₃FO₂	418.628
224		1a-fluoro-25-hydrovitamin D₃ / 1a-fluoro-25-hydrocholecalciferol	(5Z,7E)-(1S,3R)-3-fluoro-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0227	Sachiko Yamada	1a-F-25-OHD₃	C₂₇H₄₃FO₂	418.628		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100. (Ref. 0237)																		[0237]
225		24-fluoro-25-hydroxyvitamin D₃ / 24-fluoro-25-hydroxycholecalciferol	(5Z,7E)-(3S)-24-fluoro-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0228	Sachiko Yamada	24-F-25-OHD₃	C₂₇H₄₃FO₂	418.628									(EtOH) lmax (nm) 263, lmin (nm) 228 (Ref. 0199)			m/z 418 (M⁺), 403, 400, 385, 359, 271, 253, 136, 118 (Ref. 0199)								[0199]
226		(24R)-25-fluoro-1a,24-dihydroxyvitamin D₃ / (24R)-25-fluoro-1a,24-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,24R)-25-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0229	Sachiko Yamada	25-F-1a,24R-(OH)₂-D₃	C₂₇H₄₃FO₃	434.627		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Competitive binding to rat intestinal vitamin D receptor, 0.165. (Ref. 0237)														(Ref. 0367)				[0237] / [0367]
227		(10Z)-19-fluoro-1a,25-dihydroxyvitamin D₃ / (10Z)-19-fluoro-1a,25-dihydroxycholecalciferol	(5Z,7E,10Z)-(1S,3R)-19-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0230	Sachiko Yamada	(10Z)-19-F-1a,25-(OH)₂D₃	C₂₇H₄₃FO₃	434.627									(95% EtOH) lmax (nm) 261 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.53 (3H, s, 18-H), 0.93 (3H, d, J = 6.4 Hz, 21-H), 1.21 (6H, s, 26- and 27-H), 2.18 (1H, t, J = 11.6 Hz, 4-H), 2.31 (1H, m, 2-H), 2.67 (1H, dm, J = 11.6 Hz, 4-H), 2.80 (1H, m, 9-H), 4.17 (1H, tt, J = 10.9 and 4.4 Hz, 3-H), 5.08 (1H, t, J = 3.1 Hz, 1-H), 5.90 (1H, d, J = 11.1 Hz, 7-H), 6.46 (1H, d, J = 11.1 Hz, 6-H), 6.50 (1H, d, J = 86.1 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -129.6 (d, J = 86.1 Hz) (Ref. 0333) ¹³C-NMR (d, CDCl₃) 12.3, 19.0, 21.0, 22.5, 23.6, 27.9, 29.4, 29.6, 29.9, 36.3, 36.6, 40.7, 42.0, 44.6, 46.2, 46.3, 56.5, 56.7, 63.1 (d, J = 6.2 Hz), 66.5, 71.4, 116.6, 121.4 (d, J = 4.1 Hz), 126.1, 126.7 (d, J = 6.1 Hz), 144.5, 146.5 (d, J = 267.9 Hz) (Ref. 0333)	m/z 434 (M⁺, 13), 416 (17), 398 (13), 396 (18), 378 (25), 360 (52), 305 (8), 287 (16), 285 (11), 269 (9), 267 (13), 249 (32), 135 (100) (Ref. 0333)				From (1) vitamin D₂, via side chain cleavage, side chain introduction, 1a-hydroxylation, and 19-fluorination of 6,19-sulfur-dioxide adduct of the resulting 1a,25-dihydroxyvitamin D₃ derivative as key steps or (2) from (5E)-1a,25-dihydroxyvitamin D₃ via elimination of the exocyclic methylene and introduction of a fluoromethylene group as key steps. (Ref. 0345)				[0333] / [0345]
228		(10E)-19-fluoro-1a,25-dihydroxyvitamin D₃ / (10E)-19-fluoro-1a,25-dihydroxycholecalciferol	(5Z,7E,10E)-(1S,3R)-19-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0231	Sachiko Yamada	(10E)-19-F-1a,25-(OH)₂D₃	C₂₇H₄₃FO₃	434.627									(95% EtOH) lmax (nm) 264 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.54 (3H, s, 18-H), 0.93 (3H, d, J = 6.4 Hz, 21-H), 1.21 (6H, s, 26- and 27-H), 2.13 (1H, m, 2-H), 2.27 (1H, dd, J = 13.0 and 8.5 Hz, 4-H), 2.66 (1H, dd, J = 13.0 and 3.8 Hz, 4-H), 2.82 (1H, m, 9-H), 4.20 (1H, tt, J = 8.5 and 3.8 Hz, 3-H), 4.43 (1H, dd, J = 5.5 and 3.8 Hz, 1-H), 5.63 (1H, d, J = 11.3 and 5.4 Hz, 7-H), 6.51 (1H, d, J = 11.3 Hz, 6-H), 6.70 (1H, d, J = 83.8 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -128.0 (br. signal) (Ref. 0333) ¹³C-NMR (d, CDCl₃) 12.2, 19.0, 21.0, 22.4, 23.8, 27.6, 29.36, 29.39, 29.5, 36.3, 36.6, 40.7, 43.2, 44.6, 45.1, 46.1, 56.5, 56.8, 66.8, 67.7 (d, J = 9.5 Hz), 71.4, 117.9 (d, J = 3.0 Hz), 122.0 (d, J = 4.8 Hz), 124.9, 126.7, 143.4 (d, J = 265.2 Hz), 144.4 (Ref. 0333)	m/z 434 (M⁺, 28), 416 (31), 398 (13), 396 (11), 378 (20), 360 (100), 305 (16), 287 (14), 285 (10), 269 (14), 267 (15), 249 (69), 135 (42) (Ref. 0333)				From (5E)-1a,25-dihydroxyvitamin D₃ via elimination of the exocyclic methylene and introduction of a fluoromethylene group as key steps. (Ref. 0345)				[0333] / [0345]
229		(5E,10Z)-19-fluoro-1a,25-dihydroxyvitamin D₃ / (5E,10Z)-19-fluoro-1a,25-dihydroxycholecalciferol	(5E,7E,10Z)-(1S,3R)-19-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0232	Sachiko Yamada	(5E,10Z)-19-F-1a,25-(OH)₂D₃	C₂₇H₄₃FO₃	434.627									(95% EtOH) lmax (nm) 269 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-H), 0.95 (3H, d, J = 6.4 Hz, 21-H), 1.22 (6H, s, 26- and 27-H), 2.31 (1H, m), 2.81 (1H, m, 9-H), 3.15 (1H, dm, J = 13.2 Hz, 4-H), 4.16 (1H, tt, J = 11.0 and 4.3 Hz, 3-H), 5.05 (1H, br s, 1-H), 5.87 (1H, d, J = 11.5 Hz, 7-H), 6.38 (1H, d, J = 11.5 Hz, 6-H), 6.69 (1H, d, J = 86.5 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -133.2 (d, J = 86.5 Hz) (Ref. 0333) ¹³C-NMR (d, CD₂Cl₂-CD₃OD = 2 : 1) 12.3, 19.1, 21.5, 22.8, 24.1, 28.2, 29.0, 29.1, 29.6, 36.8, 37.1, 37.9, 41.1, 42.0, 44.8, 46.5, 57.1, 57.3, 62.5 (d, J = 5.9 Hz), 65.4, 71.3, 116.3, 122.8, 127.6 (d, J = 6.2 Hz), 128.4 (d, J = 6.2 Hz), 144.1 (d, J = 266.1 Hz), 145.6 (Ref. 0333)	m/z 434 (M⁺, 25), 416 (18), 398 (10), 396 (19), 378 (15), 360 (61), 305 (13), 287 (18), 285 (21), 269 (15), 267 (21), 249 (53), 135 (100) (Ref. 0333)				From (1) vitamin D₂, via side chain cleavage, side chain introduction, 1a-hydroxylation, and 19-fluorination of 6,19-sulfur-dioxide adduct of the resulting 1a,25-dihydroxyvitamin D₃ derivative as key steps or (2) from (5E)-1a,25-dihydroxyvitamin D₃ via elimination of the exocyclic methylene and introduction of a fluoromethylene group as key steps. (Ref. 0345)				[0333] / [0345]
230		(5E,10E)-19-fluoro-1a,25-dihydroxyvitamin D₃ / (5E,10E)-19-fluoro-1a,25-dihydroxycholecalciferol	(5E,7E,10E)-(1S,3R)-19-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0233	Sachiko Yamada	(5E,10E)-19-F-1a,25-(OH)₂D₃	C₂₇H₄₃FO₃	434.627									(95% EtOH) lmax (nm) 269 (Ref. 0333)		¹H-NMR (d, CDCl₃) 0.58 (3H, s, 18-H), 0.95 (3H, d, J = 6.4 Hz, 21-H), 1.22 (6H, s, 26- and 27-H), 2.25 (1H, m), 2.68 (1H, m), 2.81 (1H, m, 9-H), 3.07 (1H, dd, J = 13.7 and 3.7 Hz, 4-H), 4.19 (1H, tt, J = 10.0 and 4.4 Hz, 3-H), 4.34 (1H, t, J = 3.6 Hz, 1-H), 5.97 (1H, d, J = 11.5 Hz, 7-H), 6.68 (1H, d, J = 11.5 Hz, 6-H), 6.75 (1H, d, J = 83.4 Hz, 19-H) (Ref. 0333) ¹⁹F-NMR (d, CDCl₃) -132.6 (d, J = 83.4 Hz) (Ref. 0333) ¹³C-NMR (d, CD₂Cl₂-CD₃OD = 2 : 1) 12.3, 19.1, 21.5, 22.9, 24.2, 28.2, 29.0, 29.1, 29.6, 36.8, 37.1, 37.2, 41.2, 42.5, 44.9, 46.5, 57.2, 57.3, 65.6, 67.7 (d, J = 9.0 Hz), 71.3, 116.5, 125.7 (d, J = 6.1 Hz), 127.7 (d, J = 5.7 Hz), 145.6, 145.8 (d, J = 264.4 Hz) (Ref. 0333)	m/z 434 (M⁺, 59), 416 (35), 398 (19), 396 (33), 378 (21), 360 (52), 305 (31), 287 (32), 285 (31), 269 (30), 267 (36), 249 (66), 135 (100) (Ref. 0333)				From (5E)-1a,25-dihydroxyvitamin D₃ via elimination of the exocyclic methylene and introduction of a fluoromethylene group as key steps. (Ref. 0345)				[0333] / [0345]
231		24R-fluoro-1a,25-dihydroxyvitamin D₃ / 24R-fluoro-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,24R)-24-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0234	Sachiko Yamada	24R-F-1a,25-(OH)₂D₃	C₂₇H₄₃FO₃	434.627		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 65 ; Bone calcium mobilization in rat, 40 ; Competitive binding to rat intestinal vitamin D receptor, 115 ; Differentiation of human leukemia cells (HL-60), 30. (Ref. 0237)					[a] +67.9 (c = 0.52 in MeOH) (Ref. 0191)		(EtOH) lmax (nm) (emax) 213 (12500), 265 (16385) (Ref. 0191)	(CHCl₃) 3420 (OH), 1635 (C=C) cm^-¹ (Ref. 0191)	¹H-NMR (d, CDCl₃, 200MHz) 0.56 (3H, s, CH₃), 0.95 (3H, d, J = 7 Hz, CHCH₃), 1.22 and 1.24 (6H, 2 s, CMe₂), 2.33 (1H, m), 2.64 (1H, m), 2.84 (1H, m), 4.21 (1H, d m, J = 48 Hz, CHF), 4.26 (1H, br s, CHO), 4.46 (1H, br s, CHO), 5.01 (1H, s, vinyl CH), 5.33 (1H, s, vinyl CH), 6.03 (1H, d, J = 12 Hz, vinyl CH), 6.39 (1H, d, J = 12 Hz, vinyl CH) (Ref. 0191)	m/z 434 (M⁺, 13), 416 (11), 398 (3), 375 (2), 287 (7), 152 (36), 134 (100) (Ref. 0191)								[0191] / [0237]
232		1a,25-dihydroxy-24-oxo-23-azavitamin D₂ / 1a,25-dihydroxy-24-oxo-23-azaergocalciferol	(5Z,7E)-(1S,3R,24R)-23-aza-22-oxo-9,10-seco-5,7,10(19)-ergostatriene-1,3,25-triol	VVD0235	Sachiko Yamada		C₂₇H₄₃NO₄	445.635		The analogue showed almost no affinity to the chick cytosol vitamin D receptor. (Ref. 0259)					[a]_D +1.5 (c = 0.0023 in EtOH) (Ref. 0259)		(EtOH) lmax (nm) (emax) 265 (18300) (Ref. 0259)	(CHCl₃) 3441, 1651 cm^-¹ (Ref. 0259)	¹H-NMR (d, CDCl₃, 400MHz) 0.56 (3H, s), 1.14 (3H, d, J = 7.0 Hz), 1.20 (3H, s), 1.21 (3H, d, J = 6.3 Hz), 1.23 (3H, s), 3.89 (1H, dq, J = 8.2, 6.3 Hz), 4.23 (1H, m), 4.43 (1H, m), 4.99 (1H, s), 5.32 (1H, t, J = 1.8 Hz), 6.02 (1H, d, J = 11.3 Hz), 6.38 (1H, d, J = 11.5 Hz) (Ref. 0259)	m/z 445 (M⁺), 427 (M⁺-H₂O), 409 (M⁺-2H₂O) (Ref. 0259)		HPLC : Lichrosorb Si-60, 10 250 mm ; mobile phase, isoPrOH-CH₂Cl₂ (13 : 87). Zorbax-SIL,4.6 250 mm 2 ; mobile phase, hexane-CH₂Cl₂-MeOH-isoPrOH (60 : 30 : 5 : 5). (Ref. 0259)		Condensation of the steroidal 20-carboxylic acid with the requisite side-chain amine, followed by the usual ring opening reactions, gave the amide analogue. (Ref. 0259)				[0259]
233		1a-hydroxy-3-deoxyvitamin D₃ / 1a-hydroxy-3-deoxycholecalciferol	(5Z,7E)-(1S)-9,10-seco-5,7,10(19)-cholestatrien-1-ol	VVD0236	Sachiko Yamada	3-deoxy-1a-OHD₃	C₂₇H₄₄O	384.638		Intestinal Calcium Transport and Bone Calcium Mobilization Activity of Analog 4* (3-deoxy-1a-hydroxyvitamin D₃) and 3* (1a-OH-D₃). (Ref. 0179)							lmax (nm) 264.5, lmin (nm) 229 (Ref. 0179)			m/z 384 (M⁺), 366, 271, 253, 136 (Ref. 0179)				From 1a,2a-epoxy-6-ethylenedioxycholestan-3-one: treatment with hydrazine hydrate, catalytic reduction, introduction of 5,7-diene function by conventional method and photochemical followed by thermal isomerization. (Ref. 0179) From 1a-acetoxycholesterol tosylate: reduction of the tosylate function, introduction of 5,7-diene function and photochemical followed by thermal isomerization. (Ref. 0179)				[0179]
234		vitamin D₃ / cholecalciferol / calciol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0237	Sachiko Yamada	D₃	C₂₇H₄₄O	384.638		Activities of vitamin D₃ in intestinal calcium transport and bone calcium mobilization were compared with those of 25-OHD₃: Tables (Ref. 0014)	84-85 C (Ref. 0001)				[a] +51.9 (c = 1.6 in CHCl₃) (Ref. 0001)		(95% EtOH or Hexane) lmax (nm) (e) 264.5 (18200) (Ref. 0001)		¹H-NMR (d, CDCl₃, 300MHz) 0.54 (3 H, s, 18-CH₃), 0.87 (6 H, d, J = 6.5 Hz, 26-, 27-CH₃), 0.92 (3 H, d, J = 6 Hz, 21-CH₃), 2.17 (1 H, ddd, 4.5, 8.6 and 13.9 Hz, 1a-H), 2.28 (1 H, dd, J = 7.5 and 13.2 Hz, 4b-H), 2.39 (1 H, ddd, J = 5.0, 7.7 and 13.9 Hz, 1b-H), 2.56 (1 H, dd, J = 3.6 and 13.2 Hz, 4a-H), 2.82 (1 H, d, J = 12 Hz, 9b-H), 3.94 (1 H, dddd, J = 3.6, 3.8, 7.5 and 7.6 Hz, 3a-H), 4.82 (1 H, d, J = 2.5 Hz, 19-H), 5.05 (1 H, dt, J = 2.5 and 1.2 Hz, 19-H), 6.03 (1 H, d, J = 11.2 Hz, 7-H), 6.25 (1 H, d, J = 11.2 Hz, 6-H) (Ref. 0002) ¹H-NMR (d, CDCl₃, 300MHz) spectrum (Ref. 0004) ¹³C-NMR (d, CDCl₃, 22.6MHz) 32.1 (1), 35.3 (2), 69.2 (3), 46.0 (4), 135.3 (5), 122.5 (6) 117.8 (7), 142.2 (8), 29.1 (9),* 145.3 (10), 22.4 (11), 40.6 (12), 46.0 (13), 56.5 (14),** 23.7 (15), 27.8 (16),* 56.7 (17),** 11.9 (18), 112.5 (19), 36.2 (20), 18.9 (21), 36.2 (22), 24.0 (23), 39.6 (24), 28.1 (25),* 22.7 (26), 22.9 (27); * and **, the assignments may be interchanged. (Ref. 0003)	m/z 384 (M⁺), 351, 325, 271, 253, 158, 136, 118; spectrum (Ref. 0015)			Upon sunlight irradiation, 7-dehydrocholesterol (provitamin D₃) on the skin isomerizes to previtamin D₃ which in turn isomerizes to vitamin D₃ at skin temperature. (Ref. 0005/0006)	Synthesis from cholesterol acetate via photochemical isomerization of the corresponding 5,7-diene (provitamin D₃) followed by thermal isomerization. (Ref. 0007) By convergent method from des-AB-cholestan-8-one and A-ring precursor using Wittig-Horner coupling. (Ref. 0286)	Vitamin D₃ is hydroxylated by vitamin D 25-hydroxylase (CYP27) in the liver (Ref. 0016/0017) to yield 25-OHD₃ and then by 1a-hydroxylase (CYP24B1) (Ref. 0030/0031) in the kidney to afford 1,25-(OH)₂D₃ (Ref. 0026/0027) , the biologically active form of vitamin D₃.			[0001] / [0002] / [0003] / [0004] / [0005] / [0006] / [0007] / [0014] / [0015] / [0016] / [0017] / [0026] / [0027] / [0030] / [0031] / [0286]
235		3-epivitamin D₃ / 3-epicholecalciferol	(5Z,7E)-(3R)-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0238	Sachiko Yamada	3-epi-D₃	C₂₇H₄₄O	384.638			p-nitrobenzoate : 117-118 C (Ref. 0165)				[a]_D -0.5 (c = 0.9 in C₆H₆) (Ref. 0165)		lmax (nm) (emax) 264 (18000) (Ref. 0165)		¹H-NMR (d, CDCl₃) 6.2 (1H, J = 11.2 Hz, 6-H), 6.0 (1H, J = 11.2 Hz, 7-H), 5.0 (1H, 19Z-H), 4.8 (1H, 19E-H), 3.9 (1H, J = 4.1 Hz, 3-H), 0.5 (3H, 18-H) (Ref. 0165) ¹³C-NMR (d, CDCl₃, 20MHz) 32.40 (1), 35.60 (2), 69.70 (3), 46.25 (4), 145.05 (5), 122.25 (6), 117.65 (7), 142.15 (8), 29.10 (9), 135.40 (10), 22.35 (11), 40.65 (12), 45.95 (13), 56.45 (14), 23.70 (15), 27.65 (16), 56.80 (17), 12.00 (18), 112.50 (19) (Ref. 0165)					From vitamin D₃ by inverting the configuration at C(3). (Ref. 0165)				[0165]
236		(5E)-vitamin D₃ / (5E)-cholecalciferol / (5E)-calciol	(5E,7E)-(3S)-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0239	Sachiko Yamada	(5E)-D₃	C₂₇H₄₄O	384.638											¹H-NMR (d, CDCl₃, 300MHz) 6.52 (1H, d, J = 11.2 Hz, 6-H), 5.84 (1H, d, J = 11.2 Hz, 7-H), 4.95 (1H, br, 19Z-H), 4.65 (1H, br, 19E-H), 3.86 (1H, dddd, J = 8.5, 8.5, 4.1 and 4.1 Hz, 3a-H), 2.84 (1H, br d, J = 13.8 Hz, 4a-H), 2.84 (1H, d, J = 12.0 Hz, 9b-H), 2.44 (1H, ddd, J = 14.0, 5.0 and 5.0 Hz, 1b-H), 2.21 (1H, dd, J = 13.8 and 8.5 Hz, 4b-H), 2.17 (1H, br d, J = 14.0 Hz, 1a-H), 1.94 (1H, 2a-H), 1.58 (1H, 2b-H), 0.92 (3H, d, J = 6.2 Hz, 21-CH₃), 0.87 (6H, d, J = 6.7 Hz, 26-, 27-CH₃), 0.57 (3H, s, 18-CH₃) (Ref. 0164) ¹³C-NMR (d, CDCl₃, 20MHz) 31.20 (1), 34.80 (2), 69.00 (3), 37.25 (4), 149.25 (5), 121.05 (6), 116.0 (7), 145.55 (8), 29.15 (9), 134.95 (10), 22.40 (11), 40.70 (12), 46.00 (13), 56.70 (14), 23.65 (15), 27.70 (16), 56.85 (17), 12.20 (18), 108.15 (19) (Ref. 0165)					From vitamin D₃ via its SO₂ adduct: Treatment of D₃ with liquid SO₂ at its refluxing temperature gives D₃-SO₂ adduct in quantitative yeild which upon heating in refluxing EtOH in the presence of weak base (such as NaHCO₃) gives exclusively 5E-D₃. (Ref. 0267/0265)				[0164] / [0165] / [0265] / [0267]
237		(5E)-3-epivitamin D₃ / (5E)-3-epicholecalciferol	(5E,7E)-(3R)-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0240	Sachiko Yamada	(5E)-3-epi-D₃	C₂₇H₄₄O	384.638			p-nitrobenzoate : 104-105 C (Ref. 0165)				[a]_D -30.0 (c = 0.85 in C₆H₆) (Ref. 0165)		lmax (nm) (emax) 272 (22000) (Ref. 0165)		¹H-NMR (d, CDCl₃) 6.5 (1H, J = 11.1 Hz, 6-H), 5.8 (1H, J = 11.1 Hz, 7-H), 4.9 (1H, 19Z-H), 4.6 (1H, 19E-H), 3.8 (1H, J = 4.2 Hz, 3-H), 0.5 (3H, 18-H) (Ref. 0165) ¹³C-NMR (d, CDCl₃, 20MHz) 31.15 (1), 34.75 (2), 68.95 (3), 37.10 (4), 149.20 (5), 121.05 (6), 115.9 (7), 144.65 (8), 29.10 (9), 134.80 (10), 22.35 (11), 40.60 (12), 46.00 (13), 56.60 (14), 23.65 (15), 27.70 (16), 56.75 (17), 12.15 (18), 108.2 (19) (Ref. 0165)					From (5E)-vitamin D₃ by inverting the configuration at C(3). (Ref. 0165)				[0165]
238		previtamin D₃ / precholecalciferol / (6Z)-tacalciol	(6Z)-(3S)-9,10-seco-5(10),6,8-cholestatrien-3-ol	VVD0241	Sachiko Yamada	pre-D₃	C₂₇H₄₄O	384.638			3:5-Dinitrobenzoate : 104.5-105 C (Ref. 0008)				[a] +54 (in CHCl₃) (Ref. 0008)		lmax (nm) (emax) 260 (9250) (Ref. 0008)											[0008]
239		tachysterol₃	(6E)-(3S)-9,10-seco-5(10),6,8-cholestatrien-3-ol	VVD0242	Sachiko Yamada	tachysterol₃	C₂₇H₄₄O	384.638
240		isotachysterol₃	(6E)-(3S)-9,10-seco-5(10),6,8(14)-cholestatrien-3-ol	VVD0243	Sachiko Yamada	isotachysterol₃	C₂₇H₄₄O	384.638									(EtOH) lmax (nm) 288, 277, 301 (Ref. 0011)		Dinitrobenzoate : ¹H=NMR (d, CDCl₃, 100MHz) 5.37 (1H, m), 6.54 (1H, d, J = 16 Hz), 6.30 (1H, d, J = 16 Hz), 0.91 (3H, s), 1.90 (3H, s), 0.92 (3H, d, J = 6 Hz), 0.89 (6H, d, J = 6 Hz) (Ref. 0011)	m/z 384 (M⁺) (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzen/acetone] 0.71 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 1.47/1.62/2.36/2.60 (Ref. 0011)		Obtained as a minor product by overirradiation of 7-dehydrocholesterol in ethanol or methanol. (Ref. 0011) Better method of producing this compound is to treat vitamin D₃ with Lewis acids as described in vitamin D₂ series. (Ref. 0268)				[0011] / [0268]
241		(5E)-isovitamin D₃ / (5E)-isocholecalciferol	(5E,7E)-(3S)-9,10-seco-1(10),5,7-cholestatrien-3-ol	VVD0244	Sachiko Yamada	(5E)-iso-D₃	C₂₇H₄₄O	384.638									(EtOH) lmax (nm) 287, 276, 298 (Ref. 0011)		Dinitrobenzoate : ¹H-NMR (d, CDCl₃, 100MHz) 5.42 (1H, m), 6.54 (1H, d, J = 12 Hz), 5.91 (1H, d, J = 12 Hz), 0.52 (3H, s), 1.96 (3H, s), 0.93 (3H, d, J = 6 Hz), 0.87 (6H, d, J = 6 Hz) (Ref. 0011)	m/z 384 (M⁺) (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzen/acetone] 0.85 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 1.39/1.59/2.27 (Ref. 0011)		Obtained as a minor product by overirradiation of 7-dehydrocholesterol in ethanol or methanol. (Ref. 0011) Better method of producing this compound is to treat vitamin D₃ with Lewis acids as described in vitamin D₂ series. (Ref. 0268)				[0011] / [0268]
242		provitamin D₃ /procholecalciferol / 7-dehydrocholesterol	(3S)-5,7-cholestadien-3-ol	VVD0245	Sachiko Yamada	pro-D₃	C₂₇H₄₄O	384.638			126 C (Ref. 0187) 141.5 C (Alcohol) (Ref. 0188)				[a] -50.45 to -49.69 (in CHCl₃) (Ref. 0188)		lmax (nm) (e) 262.5 5 (7400), 271.0 5 (10400), 281.5 5 (10750), 293.0 5 (6150) (Ref. 0187)		¹³C-NMR (d, CDCl₃, 22.6MHz) 38.5 (1), 32.0 (2), 70.5 (3), 40.8 (4), 141.3 (5), 119.8 (6), 116.5 (7), 140.0 (8), 46.5 (9), 37.2 (10), 21.2 (11), 39.2 (12), 43.1 (13), 54.6 (14), 23.1 (15), 28.1 (16), 56.2 (17), 11.9 (18), 16.4 (19), 36.3 (20), 18.9 (21), 36.3 (22), 24.0 (23), 39.6 (24), 28.1 (25), 22.6 (26), 22.8 (27) (Ref. 0003)				Isolation and identification from pig skin. (Ref. 0190)					[0003] / [0187] / [0188] / [0190]
243		pyrovitamin D₃ / pyrocholecalciferol	(3S)-10a-cholesta-5,7-dien-3-ol	VVD0246	Sachiko Yamada	pyro-D₃	C₂₇H₄₄O	384.638									lmax (nm) 274, 285, 296 (Ref. 0009)		¹H-NMR (d, CCl₄, 100MHz) 0.84 (s, 18-H₃), 1.07 (s, 19-H₃), 3.95 (narrow m, 3a-H), 5.36 (q, J = 6 Hz, 6-, 7-H₂) (Ref. 0009)					From vitamin D₃ by heating (110-170 C) in various organic solvent. (Ref. 0009)				[0009]
244		isopyrovitamin D₃ / isopyrocholecalciferol	(3S)-9b-cholesta-5,7-dien-3-ol	VVD0247	Sachiko Yamada	isopyro-D₃	C₂₇H₄₄O	384.638									lmax (nm) 274, 284, 295 (Ref. 0009)		¹H-NMR (d, CCl₄, 100MHz) 0.85 (s, 18-H₃), 1.24 (s, 19-H₃), 3.40 (broad m, 3a-H), 5.42 (q, J = 6 Hz, 6-, 7-H₂) (Ref. 0009)					From vitamin D₃ by heating (110-170 C) in various organic solvent. (Ref. 0009)				[0009]
245		toxisterol₃ A1	(3S,4S,8S)-4,8-cyclo-9,10-seco-5(10),6-cholestadien-3-ol	VVD0248	Sachiko Yamada	toxisterol₃ A1	C₂₇H₄₄O	384.638			94.5-96.5 C (Ref. 0011/0012)				[a] -100 (in CHCl₃) (Ref. 0011/0012)		(EtOH) lmax (nm) (emax) 251 (15000) (Ref. 0011/0012)	(KBr) 3340, 3060, 2950, 2870, 1470, 1380, 1120, 1040, 1020, 990, 930, 860, 760, 500 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.85 (1 H, dt, J = 3.5, 11 Hz), 6.27 (2 H, s), 0.89 (3 H, s), 1.67 (3 H, d, J = 2 Hz), 0.90 (3 H, d, J = 5 Hz), 0.86 (6 H, d, J = 6 Hz) (Ref. 0011) ¹³C-NMR (d, CDCl₃, 100MHz) 35.2 t (1), 33.8 t (2), 69.8 d (3), 54.0 d (4), 122.6 s (5), 129.2 d (6), 140.6 d (7), 54.0 s (8), 31.4 t (9), 135.7 s (10), 20.1 t (11), 40.0 t (12), 43.9 s (13), 55.7 d (14), 22.3 t (15), 27.2 t (16), 57.0 d (17), 140.0 q (18), 18.4 q (19), 35.4 d (20), 18.4 q (21), 35.9 t (22), 23.7 t (23), 39.5 t (24), 27.9 d (25), 22.5 q (26), 22.8 q (27) (Ref. 0011/0012)	m/z 384 (M⁺) (Ref. 0011)		RF(TLC) (benzene) 0.57 (Ref. 0011) Rrel(GC) (retention time relative to cholestane) 1.41 (Ref. 0011)		Obtained as one of overirradiation products of 7-dehydrocholesterol. (Ref. 0011)				[0011] / [0012]
246		toxisterol₃ A2	(3S,4S,8S)-4,8,-cyclo-9,10-seco-5(10),6-cholestadien-3-ol	VVD0249	Sachiko Yamada	toxisterol₃ A2	C₂₇H₄₄O	384.638							[a] +39 (in CHCl₃) (Ref. 0011)		(EtOH) lmax (nm) (emax) 251 (15000) (Ref. 0011)	(Neat) 3390, 3060, 2960, 2940, 2870, 1460, 1370, 1120, 1030, 1015, 990, 775, 755, 675 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.81(1H, dt, J = 3.5, 11 Hz), 6.33 (1H, d, J = 6 Hz), 6.06 (1H, d, J = 6 Hz), 0.90 (3H, s), 1.65 (3H, d, J = 2 Hz), 0.94 (3H, d, J = 6 Hz), 0.87 (6H, d, J = 6 Hz) (Ref. 0011) ¹³C-NMR (d, CDCl₃, 100MHz) 31.4 t (1), 34.0 t (2), 69.8 d (3), 59.7 d (4), 120.5 s (5), 128.6 d (6), 140.8 d (7), 53.2 s (8), 35.7 t (9), 138.1 s (10), 19.6 t (11), 40.2 t (12), 45.0 s (13), 48.0 d (14), 24.2 t (15), 29.8 t (16), 54.3 d (17), 18.2 q (18), 25.5 q (19), 36.2 d (20), 19.4 q (21), 36.8 t (22), 23.8 t (23), 39.5 t (24), 28.0 d (25), 22.5 q (26), 22.8 q (27) (Ref. 0011)	m/z 384 (M⁺), 253 (base) (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzene] 0.31 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100mesh), retention time relative to cholestane] 0.98 (Ref. 0011)		Obtained as one of overirradiation products of 7-dehydrocholesterol. (Ref. 0011)				[0011]
247		toxisterol₃ A3	(3S,4R,8R)-4,8-cyclo-9,10-seco-5(10),6-cholestadien-3-ol	VVD0250	Sachiko Yamada	toxisterol₃ A3	C₂₇H₄₄O	384.638							[a] +128 (in CHCl₃) (Ref. 0011)		(Diethyl ether) lmax (nm) (emax) 251 (15000) (Ref. 0011)	(Neat) 3430, 3050, 3020, 2930, 2860, 1470, 1380, 1370, 1175, 1090, 1070, 1015, 990, 870, 810, 770 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 4.61 (1H, m), 6.14 (1H, d, J = 5.5 Hz), 5.35 (1H, d, J = 5.5 Hz), 0.75 (3H, s), 1.76 (3H, d, J = 1.5 Hz), 0.93 (3H, d, J = 6 Hz), 0.88 (6H, d, J = 6 Hz) (Ref. 0011)	m/z 384 (M⁺) (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzene] 0.31 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 1.31 (Ref. 0011)		Obtained as one of overirradiation products of 7-dehydrocholesterol. (Ref. 0011)				[0011]
248		toxisterol₃ C1	(5R,6R,9S,10R)-9(105),10(96)abeo-7-cholesten-3b-ol	VVD0251	Sachiko Yamada	toxisterol₃ C1	C₂₇H₄₄O	384.638			112 C (Ref. 0011/0012)				[a] +141 (in CHCl₃) (Ref. 0011/0012)		(EtOH) lmax (nm) (emax) 227 (6600) (Ref. 0011/0012)	(KBr) 3380, 3060, 2960, 2940, 2880, 1660, 1470, 1380, 1080, 1045, 1030, 1015, 840 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.56 (1H, m), 5.02 (1H, d, J = 1.8 Hz), 0.57 (3H, s), 0.81 (3H, s), 0.90 (3H, d, J = 6 Hz), 0.86 (6H, d, J = 6 Hz) (Ref. 0011/0012) ¹³C-NMR (d, CDCl₃, 100MHz) 39.7 t (1), 32.8 t (2), 67.9 d (3), 31.5 t (4), 34.0 s (5), 31.1d (6), 117.7 d (7), 148.1 s (8), 50.2 d (9), 24.5 s (10), 22.3 t (11), 40.5 t (12), 45.4 s (13), 51.6 d (14), 25.5 t (15), 28.6 t (16), 55.6 d (17), 12.2 q (18), 15.2 q (19), 36.3d(20), 18.9 q (21), 36.3 t (22), 23.9 t (23), 39.5 t (24), 28.0 d (25), 22.6 q (26), 22.8 q (27) (Ref. 0011)	m/z 384 (M⁺), 351 (base) (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzene/acetate] 0.63 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 1.40 (Ref. 0011)		A major overirradiation products of 7-dehydrocholesterol. (Ref. 0011)				[0011] / [0012]
249		toxisterol₃ C2	(5S,6S,9S,10S)-9(105),10(96)abeo-7-cholesten-3b-ol	VVD0252	Sachiko Yamada	toxisterol₃ C2	C₂₇H₄₄O	384.638			102-103 C (Ref. 0011)				[a] -69 (in CHCl₃) (Ref. 0011)		(EtOH) lmax (nm) (emax) 229 (5400) (Ref. 0011)	(KBr) 3360, 3040, 2940, 2860, 1650, 1480, 1390, 1070, 1050, 1020, 825 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.59 (1H, m), 5.15 (1H, d, J = 2 Hz), 0.73 (3H, s), 0.92 (3H, s), 0.90 (3H, d, J = 6 Hz), 0.86 (6H, d, J = 6 Hz) (Ref. 0011) ¹³C-NMR (d, CDCl₃, 100MHz) 38.4 t (1), 33.6 t (2), 68.9 d (3), 31.7 t (4), 37.7 s (5), 30.1 d (6), 119.7 d (7), 148.6 s (8), 46.4 d (9), 28.3 s (10), 19.3 t (11), 40.8 t (12), 42.6 s (13), 48.0 d (14), 24.0 t (15), 29.1 t (16), 57.2 d (17), 15.5 q (18), 18.4 q (19), 36.0 d (20), 18.9 q (21), 36.0 t (22), 24.0 t (23), 39.5 t (24), 28.0 d (25), 22.5 q (26), 22.8 q (27) (Ref. 0011)	m/z 384 (M⁺), 351 (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzen/acetone] 0.60 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 0.95/1.52/1.60 (Ref. 0011)		Obtained as one of overirradiation products of 7-dehydrocholesterol. (Ref. 0011)				[0011]
250		toxisterol₃ D1	(5Z)-(3S)-9,10-seco-5,8,10(19)-cholestatrien-3-ol	VVD0253	Sachiko Yamada	toxisterol₃ D1	C₂₇H₄₄O	384.638			Dinitrobenzoate : 108.5-109.5 C (Ref. 0011/0012)				Dinitrobenzoate : [a] +37 (in CHCl₃) (Ref. 0011/0012)		(EtOH) lmax (nm) (emax) 217 (shoulder) (7200) (Ref. 0011/0012)	(Neat) 3340, 3075, 2950, 2930, 2860, 1640, 1460, 1370, 1050, 900 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.92 (1H, m), 5.34 (1H, t, J = 7 Hz), 2.79 (1H, d, J = 7 Hz), 0.67 (3H, s), 4.73 (3H, d, J = 2 Hz), 4.93 (3H, d, J = 2 Hz), 0.93 (3H, d, J = 7 Hz), 0.86 (6H, d, J = 6 Hz) (Ref. 0011/0012)	m/z 384 (M⁺) (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzen/acetone] 0.71 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 1.69/2.58 (Ref. 0011)		Obtained as one of overirradiation products of 7-dehydrocholesterol. (Ref. 0011)				[0011] / [0012]
251		toxisterol₃ E1	(3S,6R,9R)-9(106)abeo-5(10),7-cholestadien-3-ol	VVD0254	Sachiko Yamada	toxisterol₃ E1	C₂₇H₄₄O	384.638							[a] +155 (in CHCl₃) (Ref. 0011)		lmax (nm) (emax) (diethyl ether) no absorption maximum at l > 210 (Ref. 0011)	(KBr) 3420, 2960, 2930, 2870, 1660, 1480, 1390, 1380, 1100, 1040, 810 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.90 (1H, m), 3.76 (1H, m), 5.57 (1H, s), 0.63 (3H, s), 1.58 (3H, s), 0.94 (3H, d, J = 6 Hz), 0.88 (6H, d, J = 6 Hz) (Ref. 0011)	Dinitrobenzoate : m/z 578 (M⁺), 366 (base) (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzene		Obtained as one of overirradiation products of 7-dehydrocholesterol in ether. (Ref. 0011)				[0011]
252			(3S,6S)-9,10-seco-5(10),6,7-cholestatrien-3-ol	VVD0255	Sachiko Yamada		C₂₇H₄₄O	384.638									lmax (nm) 230 (Ref. 0013)	1950, 1625 cm ^-¹ (Ref. 0013)	¹H-NMR (d, CDCl₃, 100MHz) 0.73 (3H, s) 3.90 (1H, m), 6.18 (1H, t, J = 4 Hz) (Ref. 0013)					One of minor irradiation (>250 nm) products of vitamin D₃ in ethanol. (Ref. 0013)				[0013]
253			(3S,6R)-9,10-seco-5(10),6,7-cholestatrien-3-ol	VVD0256	Sachiko Yamada		C₂₇H₄₄O	384.638									lmax (nm) 230 (Ref. 0013)	1950, 1625 cm ^-¹ (Ref. 0013)	¹H-NMR (d, CDCl₃, 100MHz) 0.65 (3H, s), 0.87 (6H, d, J = 7 Hz), 0.91 (3H, d, J = 7 Hz), 1.74 (3H, s), 3.90 (1H, m), 6.14 (1H, t, J = 4 Hz) (Ref. 0013)					One of minor irradiation (>250 nm) products of vitamin D₃ in ethanol. (Ref. 0013)				[0013]
254			(7E)-(3S,6S)-6,19-cyclo-9,10-seco-5(10),7-cholestadien-3-ol	VVD0257	Sachiko Yamada		C₂₇H₄₄O	384.638									No absorption maxima at l > 200 nm (Ref. 0013)		3,5-Dinitrobenzoate of one of C(6) epimers : ¹H-NMR (d, CDCl₃, 100MHz) 0.54 (3H, s), 0.86 (6H, d, J = 7 Hz), 0.93 (3H, d, J = 7 Hz), 3.71 (1H, m), 4.91 (1H, d, J = 9 Hz), 5.30 (1H, m) (Ref. 0013)					One of minor irradiation (>250 nm) products of vitamin D₃ in ethanol. (Ref. 0013)				[0013]
255		1a-hydroxyvitamin D₃ / 1a-hydroxycholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0258	Sachiko Yamada	1a-OHD₃	C₂₇H₄₄O₂	400.637		Intestinal calcium transport and bone mineral mobilization response to 1a-OH-D₃ and 25-OH-D₃ in anephric rats. : Table(Ref. 0168) Intestinal calcium transport and bone calcium mobilization response of rats to 1a-OH-D₃. Results are means of six rats ; S.E., standard error. : Table (Ref. 0172) HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 9.3 10^-⁷ M, 1.0 10^-⁶ M and 1.0 10^-⁶ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228) Treatment of psoriasis : A case of psoriasis with senile osteoporosis is reported in which skin lesions were cured two and half months after the start of administration of 0.75 mg/day of 1a-OHD₃. (Ref. 0248)	134-136 C (Ref. 0167)				[a] +28.0 (c = 0.6 in Et₂O) (Ref. 0167)		(Et₂O) lmax (nm) (emax) 264-265 (18000) (Ref. 0167)	(CHCl₃) 895m, 912m, 952m, 1040s, 1645m, 3450m, 3600s cm^-¹ (Ref. 0167)	¹H-NMR (d, CDCl₃) 3.58 (1H, d, J = 12 Hz, 6- or 7-H), 3.99 (1H, d, J = 12 Hz, 6- or 7-H), 4.66 (1H, m, 19-H), 4.99 (1H, m, 19-H), 5.45-6.05 (2H, m, >CH-O), 9.12 (9H, d, J = 6 Hz, MeCH<), 9.45 (3H, s, 18-H) (Ref. 0167)	m/z 382 (5.2%), 364 (16.2%), 149 (26.0%), 134 (6.1%), 128 (30.4%), 121 (67.5%), 119 (32.0%), 95 (49.4%), 83 (50.5%), 81 (59%), 71 (58.5%), 69 (76.3%), 57 (100%) (Ref. 0167)				From cholesterol. (Ref. 0035) From 1,4,6-cholestatrien-3-one via its regio- and stereoselective epoxidation followed by deconjugative reduction to yield 1a-hydroxycholesterol as the key step. (Ref. 0166) Total synthesis from 9a-chloro-des-AB-cholestan-8-one and optically active A-ring synthon having C(6)-C(7) linker part as ethyl group. (Ref. 0167) From 1,4-cholestadien-3-one via steps of deconjugation followed by reduction, hydroboration, bromination, dehydrobromination, and photochemical and thermal isomerizations. (Ref. 0168) Synthesis of 1a-hydroxyprovitamin D₃ from 1,4,6-cholestatrien-3-one via steps of deconjugation followed by reduction, protection of 5,7-diene, epoxidation, and reduction. (Ref. 0169/0170) From vitamin D₃ via SeO₂ oxidation of 3,5-cyclo-vitamin D derivative. (Ref. 0171)				[0035] / [0166] / [0167] / [0168] / [0169] / [0170] / [0171] / [0172] / [0228] / [0248]
256		1a-hydroxy-3-epivitamin D₃ / 1a-hydroxy-3-epicholecalciferol	(5Z,7E)-(1S,3S)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0259	Sachiko Yamada	1a-OH-3-epi-D₃	C₂₇H₄₄O₂	400.637		Relative Efficacy of 1,3-diol Stereoisomers in Competing with 1,25-(OH)₂-[26 ,27-³H]D₃ for Binding to The Receptor Protein. (Ref. 0175)							lmax (nm) 263 (Ref. 0175)		¹H-NMR (d, CDCl ₃) 0.54 (3H, s, 18-H₃), 4.05 (1H, m, 3-H), 4.30 (1H, m, 1-H), 5.00 [1H, m, 19(Z)-H], 5.30 [1H, m, 19(E)-H], 6.02 (1H, d, J = 11.4 Hz, 7-H), 6.44 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0175)	m/z 400 (M⁺, 20), 382 (35), 364 (15), 152 (100), 134 (90) (Ref. 0175)				From 3-epivitamin D₃ : SeO₂ oxidation of its 3,5-cyclovitamin D derivative gave 1-oxo-derivative as a minor product which by LiAlH₄ gave 1a-hydroxylated cyclovitamin D as the major product. 1a-Hydroxy-3-epivitamin D₃ was obtained from this compound by cycloreversion followed by hydrolysis. (Ref. 0175) From 1a-hydroxycholesterol via the steps of the inversion of the configuration at C(3) by Mitsunobu method, bromination, dehydrobromination and photochemical followed by thermal isomerization. (Ref. 0177)				[0175] / [0177]
257		(5E)-1a-hydroxyvitamin D₃ / (5E)-1a-hydroxycholecalciferol	(5E,7E)-(1S,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0260	Sachiko Yamada	(5E)-1a-OHD₃	C₂₇H₄₄O₂	400.637		Relative Efficacy of 1,3-diol Stereoisomers in Competing with 1,25-(OH)₂-[26 ,27-³H]D₃ for Binding to The Receptor Protein. Table (Ref. 0175)							lmax (nm) 273 (Ref. 0175)		¹H-NMR (d, CDCl₃) 0.57 (3H, s, 18-H₃), 4.24 (1H, m, 3-H), 4.50 (1H, m, 1-H), 4.97 [1H, m, 19(Z)-H], 5.12 [1H, m, 19(E)-H], 5.89 (1H, d, J = 11.6 Hz, 7-H), 6.58 (1H, d, J = 11.6 Hz, 6-H) (Ref. 0175)	m/z 400 (M⁺, 15), 382 (5), 364 (1), 152 (40), 134 (100) (Ref. 0175)				From vitamin D₃ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative as the key step. Cycloreversion followed by hydrolysis of 1a-hydroxylated cyclovitamin D gave (5Z)- and (5E)-1ahydroxyvitamin D₃ in about 2 : 1 ratio. (Ref. 0175)				[0175]
258		(5E)-1a-hydroxy-3-epivitamin D₃ / (5E)-1a-hydroxy-3-epicholecalciferol	(5E,7E)-(1S,3S)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0261	Sachiko Yamada	(5E)-1a-OH-3-epi-D₃	C₂₇H₄₄O₂	400.637		Relative Efficacy of 1,3-diol Stereoisomers in Competing with 1,25-(OH)₂-[26 ,27-³H]D₃ for Binding to The Receptor Protein. Table (Ref. 0175)							lmax (nm) 271 (Ref. 0175)		¹H-NMR (d, CDCl₃) 0.57 (3H, s, 18-H₃), 4.13 (1H, m, 3-H), 4.38 (1H, m, 1-H), 4.96 [1H, m, 19(Z)-H], 5.12 [1H, m, 19(E)-H], 5.90 (1H, d, J = 11.4 Hz, 7-H), 6.64 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0175)	m/z 400 (M⁺, 20), 382 (5), 364 (1), 152 (100), 134 (70) (Ref. 0175)				From 3-epivitamin D₃ : SeO₂ oxidation of its 3,5-cyclovitamin D derivative gave 1-oxo-derivative as a minor product which by LiAlH₄ gave 1a-hydroxylated cyclovitamin D as the major product. Cycloreversion followed by hydrolysis gave (5Z)- and (5E)-isomers of 1a-hydroxy-3-epivitamin D₃ in about 2 : 1 ratio. (Ref. 0175)				[0175]
259		1b-hydroxyvitamin D₃ / 1b-hydroxycholecalciferol	(5Z,7E)-(1R,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0262	Sachiko Yamada	1b-OHD₃	C₂₇H₄₄O₂	400.637		Binding affinity for intestinal vitamin D receptor was 1/1.65 10⁵ relative to 1,25-(OH)₂D₃. (Ref. 0176)							(EtOH) lmax (nm) (emax) 263 (17000) (Ref. 0176)		¹H-NMR (d, CDCl₃, 270MHz) 0.55 (3H, s, 13-Me), 0.87 (6H, d, 25-Me₂), 4.11 (1H, narrow m, 3-H), 4.37 (1H, narrow m, 1-H), 5.01 [1H, d, J = 1.9 Hz, 19(Z)-H], 5.29 (1H, d, J = 1.9 Hz, 19(E)-H], 6.46 and 6.06 (2H, AB q, J = 11.7 Hz, 6- and 7-H) (Ref. 0176)	m/z 400 (M⁺, 18%), 382 (35%), 264 (25%), 152 (100%), 134 (90%) (Ref. 0176)				From 1a-hydroxyvitamin D₃ : Selective oxidation of the 1-hydroxyl group yielded 1-oxoprevitamin D₃ which by LiAlH₄ reduction gave 1b-hydroxyvitamin D₃ and its 1a-isomer in 4 : 1 ratio. (Ref. 0176/0178)				[0176] / [0178]
260		1b-hydroxy-3-epivitamin D₃ / 1b-hydroxy-3-epicholecalciferol	(5Z,7E)-(1R,3S)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0263	Sachiko Yamada	1b-OH-3-epi-D₃	C₂₇H₄₄O₂	400.637		Relative Efficacy of 1,3-diol Stereoisomers in Competing with 1,25-(OH)₂-[26 ,27-³H]D₃ for Binding to The Receptor Protein. : Table (Ref. 0175)							lmax (nm) 264 (Ref. 0175)		¹H-NMR (d, CDCl₃) 0.55 (3H, m, 18-H₃), 4.21 (1H, m, 3-H), 4.44 (1H, m, 1-H), 5.01 [1H, m, 19(Z)-H], 5.32 [1H, m, 19(E)-H], 6.00 (1H, d, J = 11.4 Hz, 7-H), 6.39 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0175)	m/z 400 (M⁺, 25), 382 (20), 364 (10), 152 (55), 134 (100) (Ref. 0175)				From 3-epivitamin D₃ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative as the key step. (Ref. 0175)				[0175]
261		(5E)-1b-hydroxyvitamin D₃ / (5E)-1b-hydroxycholecalciferol	(5E,7E)-(1R,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0264	Sachiko Yamada	(5E)-1b-OHD₃	C₂₇H₄₄O₂	400.637		Relative Efficacy of 1,3-diol Stereoisomers in Competing with 1,25-(OH)₂-[26 ,27-³H]D₃ for Binding to The Receptor Protein. : Table (Ref. 0175)							lmax (nm) 271 (Ref. 0175)		¹H-NMR (d, CDCl₃) 0.57 (3H, s, 18-H₃), 4.11 (1H, m, 3-H), 4.38 (1H, m, 1-H), 4.96 [1H, m, 19(Z)-H], 5.12 [1H, m, 19(E)-H], 5.90 (1H, d, J = 11.4 Hz, 7-H), 6.64 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0175)	m/z 400 (M⁺, 15), 382 (5), 364 (2), 152 (100), 134 (80) (Ref. 0175)				From 3-epivitamin D₃ : SeO₂ oxidation of its 3,5-cyclovitamin D derivative gave 1-oxo-derivative as a minor product which by LiAlH₄ gave 1b-hydroxylated cyclovitamin D as the major product. Cycloreversion followed by hydrolysis gave (5Z)- and (5E)-isomers of 1b-hydroxy-3-epivitamin D₃ in about 2 : 1 ratio. (Ref. 0175)				[0175]
262		(5E)-1b-hydroxy-3-epivitamin D₃ / (5E)-1b-hydroxy-3-epicholecalciferol	(5E,7E)-(1R,3S)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0265	Sachiko Yamada	(5E)-1b-OH-3-epi-D₃	C₂₇H₄₄O₂	400.637		Relative Efficacy of 1,3-diol Stereoisomers in Competing with 1,25-(OH)₂-[26 ,27-³H]D₃ for Binding to The Receptor Protein.(Ref. 0175)							lmax (nm) 273 (Ref. 0175)		¹H-NMR (d, CDCl₃) 0.57 (3H, m, 18-H₃), 4.25 (1H, m, 3-H), 4.50 (1H, m, 1-H), 4.97 [1H, m, 19(Z)-H], 5.12 [1H, m, 19(E)-H], 5.88 (1H, d, J = 11.4 Hz, 7-H), 6.58 (1H, d, J = 11.4 Hz, 6-H) (Ref. 0175)	m/z 400 (M⁺, 10), 382 (6), 364 (1), 152 (35), 134 (100) (Ref. 0175)				From 3-epivitamin D₃ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative as the key step. (Ref. 0175)				[0175]
263		2a-hydroxyvitamin D₃ / 2a-hydroxycholecalciferol	(5Z,7E)-(2R,3R)-9,10-seco-5,7,10(19)-cholestatriene-2,3-diol	VVD0266	Sachiko Yamada	2a-OHD₃	C₂₇H₄₄O₂	400.637
264		2b-hydroxyvitamin D₃ / 2b-hydroxycholecalciferol	(5Z,7E)-(2S,3R)-9,10-seco-5,7,10(19)-cholestatriene-2,3-diol	VVD0267	Sachiko Yamada	2b-OHD₃	C₂₇H₄₄O₂	400.637
265		1a,25-dihydroxy-3-deoxyvitamin D₃ / 1a,25-dihydroxy-3-deoxycholecalciferol	(5Z,7E)-(1S)-9,10-seco-5,7,10(19)-cholestatriene-1,25-diol	VVD0268	Sachiko Yamada		C₂₇H₄₄O₂	400.637		Affinity for chick intestinal receptor : 1/8 as effective as 1,25-(OH)₂D₃. (Ref. 0310)														From 1a,25-dihydroxycholesterol via reductive deoxygenation of 3-tosyloxy group followed by conventional photochemical transformation. (Ref. 0310)				[0310]
266		astrogorgiadiol B	(8S,9R)-9,10-seco-1,3,5(10)-cholestatriene-3,9-diol	VVD0269	Sachiko Yamada	astrogorgiadiol B	C₂₇H₄₄O₂	400.637		Inhibit cell division in fertilized starfish eggs. (Ref. 0317)					[a]_D -4.6 (c = 0.2 in CHCl₃) (Ref. 0316)				¹H-NMR (d, CDCl₃, 400MHz) 0.69 (3H, s, 18-CH₃), 0.86 (3H, d, J = 6.6 Hz, 26- or 27-CH₃), 0.87 (3H, d, J = 6.6 Hz, 26- or 27-CH₃), 0.92 (3H, d, J = 6.5 Hz, 21-CH₃), 2.22 (3H, s, 19-CH₃), 2.42 (1H, ddd, J = 13.5, 10.7, 3.4 Hz, 6-H), 2.69 (1H, ddd, J = 13.5, 11.1, 3.4 Hz, 6'-H), 4.05 (1H, bs, 9-H), 6.57 (1H, dd, J = 8.1, 2.7 Hz, 2-H), 6.65 (1H, d, J = 2.7 Hz, 4-H), 6.97 (1H, d, J = 8.1 Hz, 1-H) (Ref. 0316) ¹³C-NMR (d, CDCl₃, 100MHz) 11.5, 18.4, 18.5, 22.5, 22.8, 23.8, 25.1, 27.6, 28.0, 29.0, 31.0, 35.6, 35.9, 38.3, 38.5, 39.4, 42.8, 50.4, 55.0, 55.2, 112.5, 115.7, 128.0, 131.0, 142.5, 153.7, 213.4 (Ref. 0316)	m/z 400 (M⁺), 382, 367 (Ref. 0316)			Isolated from a gorgonian of the genus Astrogorgia. (Ref. 0319)	By the coupling of upper-half fragment derived from Grundmann's ketone with lower-half fragment of benzyl iodide derivative. (Ref. 0316)				[0316] / [0317] / [0319]
267		(22S)-22-hydroxyvitamin D₃ / (22S)-22-hydroxycholecalciferol	(5Z,7E)-(3S,22S)-9,10-seco-5,7,10(19)-cholestatriene-3,22-diol	VVD0270	Sachiko Yamada	22S-OHD₃	C₂₇H₄₄O₂	400.637		Displayed no vitamin D agonist activity in the intestine or in bone in vivo and did not block the activity of D₃ or 25-OHD₃. Affinity for chick intestinal receptor : B-50 (molar concentration sufficient to displace 50% of specifically bound radiolabeled 1,25-(OH)₂D₃ from the chick intestinal receptor), > 1.19 10^-⁴ M (B-50 value for 1,25-(OH)₂D₃ and 25-OHD₃, 2.11 10^-¹⁰ M and 1.4 10^-⁷ M, respectively). (Ref. 0311)							(EtOH) lmax (nm) 265, lmin (nm) 227 (Ref. 0311)		¹H-NMR (d, CDCl₃) 3.67 (1H, m, 22-H), 4.04 (1H, m, 3a-H), 4.82 (1H, d, J = 2.24 Hz, 19-H), 5.06 (1H, d, J = 2.24 Hz, 19-H), 6.03 and 6.28 (each 1H, d, J = 11.2 Hz, 6- and 7-H) (Ref. 0311)	m/z 400 (M⁺, 43.44), 382 (M⁺-H₂O, 12.56), 367 (M⁺-H₂O-CH₃, 42.64), 349 (M⁺-2H₂O-CH₃, 11.43), 271 (M⁺-side chain, 11.77), 254 (M⁺-side chain-H₂O, 22.41), 136 (ring A plus C-6 and C-7, 98.56), 118 (136-H₂O, 88.76) (Ref. 0311)				From 23,24-dinor-5-cholenoic acid via the Grignard reaction of the corresponding C-22 aldehyde with side chain fragment as key step. (Ref. 0311)				[0311]
268		(24R)-24-hydroxyvitamin D₃ / (24R)-24-hydroxycholecalciferol	(5Z,7E)-(3S,24R)-9,10-seco-5,7,10(19)-cholestatriene-3,24-diol	VVD0271	Sachiko Yamada	24R-OHD₃	C₂₇H₄₄O₂	400.637												m/z 400 (M⁺), 271, 253, 136, 118; spectrum(Ref. 0133) Bis (trimethylsilyl) ether : m/z 544 (M⁺), 544, 501, 454, 208, 145, 118; spectrum(Ref. 0133)			Isolation and identification: From the blood plasma of chickens given large doses of vitamin D₃. (Ref. 0133)	Synthesis of epimeric mixture at C(24) of 24,25-(OH)₂D₃ from 3b-acetoxy-27-nor-5-cholesten-25-one. (Ref. 0133)				[0133]
269		(24S)-24-hydroxyvitamin D₃ / (24S)-24-hydroxycholecalciferol	(5Z,7E)-(3S,24S)-9,10-seco-5,7,10(19)-cholestatriene-3,24-diol	VVD0272	Sachiko Yamada	24S-OHD₃	C₂₇H₄₄O₂	400.637
270		25-hydroxyvitamin D₃ / 25-hydroxycholecalciferol / calcidiol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0273	Sachiko Yamada	25-OHD₃	C₂₇H₄₄O₂	400.637		Activities of vitamin D₃ in intestinal calcium transport and bone calcium mobilization were compared with those of 25-OHD₃: Tables (Ref. 0014) Antirachitic Activity (IU/mg)(the standard line test assay for vitamin D activity as described in The United States Pharmacopoeia): 25-OHD₃ 56 6 ; vitamin D₃, 40 4. (Ref. 0019) HL-60 human promyelocytes differentiation: ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 8.4 10^-⁷ M, 8.0 10^-⁷ M and 8.0 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)	96-106 C (Ref. 0262) 95-100 C (Ref. 0298)				[a] +88.1 (c = 0.5 in EtOH) (Ref. 0262)		(EtOH) lmax (nm) (e) 265 (18000) (Ref. 0014) lmax (nm) (e) 265 (17700) (Ref. 0298)	(KBr) 3500, 3360, 3080, 3030, 1650, 1635, 1050, 900, 880, 860, 765 cm^-¹ (Ref. 0298)	¹H-NMR (d, CDCl₃, 100MHz) 0.54 (3H, s), 0.90 (3H, d, J = 8 Hz), 1.22 (6H, s), 4.80 and 5.00 (each 1H, s), 5.97 and 6.25 (each 1H, d, J = 12 Hz) (Ref. 0014) ¹H-NMR (d) 0.54 (3H, s, 18-CH₃), 0.93 (3H, d, J = 5 cps, 21-CH₃), 1.21 (6H, s, 26- and 27-CH₃), 3.90 (1H, bm, 3-CH), 4.81 and 5.04 (2H, 2d, =CH₂), 6.02 (1H, d, J = 12 cps, 7-CH), 6.21 (1H, d, J = 12 cps, 6-CH) (Ref. 0298)	m/z 400, 367, 341, 271, 253, 158, 136, 118; spectrum(Ref. 0014/0015)	X-ray crystal structure (Ref. 0274)	HPLC: (Ref. 0023)	Isolation and identification: from plasma of pigs (Ref. 0015/0021) ; from human plasma. (Ref. 0019) Concentration in human plasma : 10-40 ng/ml (Ref. 0020)	Synthesis from 25-hydroxycholesterol acetate and 3b-acetoxy-27-nor-cholest-5-en-25-one by standard photochemical method via 5,7-cholestadiene-3b,25-diol. (Ref. 0014) 8b,25-Dihydroxy-3,5-cyclovitamin D derivative was synthesized in a convergent method from 25-hydroxylated Grundman's ketone and A-ring precursor and the title compound was prepared from the 3,5-cyclovitamin D by cycloreversion followed by photochemical isomerization. (Ref. 0262)	Biosynthesis: Hydroxylation of D₃ by vitamin D 25-hydroxylase (CYP27) in the liver. (Ref. 0016/0017) Further metabolism : 1a-Hydroxylation in the kidney to give 1a,25-(OH)₂D₃ under vitamin D deficient conditions. (Ref. 0017/0018/0022) 24-Hydroxylation to give 24R,25-(OH)₂D₃ in tissues possessing vitamin D receptor under vitamin D supplemented conditions. (Ref. 0017/0018) 26-Hydroxylation to give 25,26-(OH)₂D₃. (Ref. 0126)			[0014] / [0015] / [0016] / [0017] / [0018] / [0019] / [0020] / [0021] / [0022] / [0023] / [0126] / [0228] / [0262] / [0274] / [0298]
271		25-hydroxy-14-epivitamin D₃ / 25-hydroxy-14-epicholecalciferol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0274	Sachiko Yamada	14-epi-25-OHD₃	C₂₇H₄₄O₂	400.637		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for chick intestinal receptor, 0.08% ; Affinity for human vitamin D binding protein, 3450% ; Intestinal calcium absorption in vitamin D-deficient chicks, < 0.1% ; Bone calcium mobilization in vitamin D-deficient chicks, < 1%. (Ref. 0314)							(95% EtOH) lmax (nm) (e) 264 (18100), lmin (nm) (emin) 230 (11000) (Ref. 0314)		¹H-NMR (d, CDCl₃, 300MHz) 0.88 (3H, d, J = 6.4 Hz, 21C-CH₃), 0.92 (3H, s, 18C-CH₃), 1.2 - 2.6 (remaining ring and side chain hydrogens, series of m), 1.22 (6H, s, 26, 27C-CH₃), 3.91 (1H, m, 3H), 4.84 (1H, narrow m, 19H), 5.08 (1H, narrow m, 19H), 6.17 (2H, s, 6, 7H-AB pattern) (Ref. 0314)	m/z 400 (13, M⁺), 382 (17, M⁺-18), 367 (41), 349 (11), 323 (3), 309 (4), 293 (3), 271 (22), 253 (21), 227 (7), 199 (13), 176 (24), 158 (59), 136 (95, A-ring fragment due to C₇,₈ cleavage), 118 (base, 152-H₂O), 95 (22), 81 (24), 69 (21), 59 (11) (Ref. 0314)				By Wittig-Horner coupling of des-AB 14-epivitamin D 8-ketone with A-ring phosphine oxide. The desired 14-epi-CD ketone was obtained from vitamin D3 by ozonolysis followed by oxidation at C-25 and epimerization at C-14. (Ref. 0314)				[0314]
272		(6R)-6,19-epidioxy-6,19-dihydrovitamin D₃ / (6R)-6,19-epidioxy-6,19-dihydrocholecalciferol	(7E)-(3S,6R)-6,19-epidioxy-9,10-seco-5(10),7-cholestadien-3-ol	VVD0275	Sachiko Yamada		C₂₇H₄₄O₃	416.636		Activities in stimulating intestinal calcium transport and in increasing serum calcium and inorganic phosphorus were evaluated compared with vitamin D₃. : Insert Table 1 (Ref. 0336)									¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-H), 4.07 (1H, m, 3-H), 4.88 (d, J = 10 Hz, 6-H), 5.17 (d, J = 10 Hz, 7-H), 4.36 (br s, 19-H) (Ref. 0335) ¹³C-NMR (d, CDCl₃) 125.7 (s, C-5), 125.7 (s, C-10), 115.6 (d, C-7), 148.1 (s, C-8), 65.9 (d, C-3), 76.9 (d, C-6), 72.2 (t, C-19) (Ref. 0335)	m/z 416 (M⁺), 398, 285 (Ref. 0335)	CD : 207 nm (e -23.3) (in Hexane) (Ref. 0335)			As a major product by the reaction of vitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0335)				[0335] / [0336]
273		(6S)-6,19-epidioxy-6,19-dihydrovitamin D₃ / (6S)-6,19-epidioxy-6,19-dihydrocholecalciferol	(7E)-(3S,6S)-6,19-epidioxy-9,10-seco-5(10),7-cholestadien-3-ol	VVD0276	Sachiko Yamada		C₂₇H₄₄O₃	416.636		Activities in stimulating intestinal calcium transport and in increasing serum calcium and inorganic phosphorus were evaluated compared with vitamin D₃. : Insert Table 1 (Ref. 0336)									¹H-NMR (d, CDCl₃) 4.76 (d, J = 9 Hz, 6-H), 5.23 (d, J = 9 Hz, 7-H), 4.17 and 4.60 (each d, J = 16 Hz, 19-H) (Ref. 0335) ¹³C-NMR (d, CDCl₃) 126.8 (s, C-5), 125.7 (s, C-10), 114.5 (d, C-7), 149.2 (s, C-8), 67.2 (d, C-3), 76.8 (d, C-6), 72.0 (t, C-19) (Ref. 0335)	m/z 416 (M⁺), 398, 285 (Ref. 0335)	CD : 215 nm (e +6.5) (in Hexane) (Ref. 0335)			As a major product by the reaction of vitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0335)				[0335] / [0336]
274		(6R)-vitamin D₃ 6,19-sulfur dioxide adduct / (6R)-cholecalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6R)-6,19-epithio-9,10-seco-5(10),7-cholestadien-3-ol S,S-dioxide	VVD0277	Sachiko Yamada	6R-D₃ 6,19-sulfur dioxide adduct	C₂₇H₄₄O₃S	448.702										(CHCl₃) 1310, 1148 cm^-¹ (Ref. 0331)	¹H-NMR (d, CDCl₃) 0.55 (s, 18-H), 3.30 (br s, 19-H), 4.52 (d, J = 9.0 Hz, 6-H), 4.78 (d, J = 9.0 Hz, 7-H) (Ref. 0331) ¹³C-NMR (d, CDCl₃) 65.90 (d, C-3), 130.63 (s, C-5), 67.29 (d, C-6), 109.84 (d, C-7), 150.84 (s, C-8), 126.62 (s, C-10), 58.00 (t, C-19) (Ref. 0331)	m/z 384 (M⁺-SO₂) (Ref. 0331)				From vitamin D₃ by treatment with liquid sulfur dioxide. (Ref. 0331)				[0331]
275		(6S)-vitamin D₃ 6,19-sulfur dioxide adduct / (6S)-cholecalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6S)-6,19-epithio-9,10-seco-5(10),7-cholestadien-3-ol S,S-dioxide	VVD0278	Sachiko Yamada	6S-D₃ 6,19-sulfur dioxide adduct	C₂₇H₄₄O₃S	448.702										(CHCl₃) 1308, 1150 cm^-¹ (Ref. 0331)	¹H-NMR (d, CDCl₃) 0.70 (s, 18-H), 3.28 (br s, 19-H), 4.49 (d, J = 9.0 Hz, 6-H), 4.78 (d, J = 9.0 Hz, 7-H) (Ref. 0331) ¹³C-NMR (d, CDCl₃) 65.42 (d, C-3), 130.14 (s, C-5), 66.97 (d, C-6), 109.50 (d, C-7), 150.38 (s, C-8), 126.82 (s, C-10), 58.13 (t, C-19) (Ref. 0331)	m/z 384 (M⁺-SO₂) (Ref. 0331)				From vitamin D₃ by treatment with liquid sulfur dioxide. (Ref. 0331)				[0331]
276			(7E)-(3S,6R)-6-hydroperoxy-9,10-seco-4,7,10(19)-cholestatrien-3-ol	VVD0279	Sachiko Yamada		C₂₇H₄₄O₃	416.636										(CHCl₃) 3350, 2950 cm^-¹ (Ref. 0335)	¹H-NMR (d, CDCl₃) 0.52 (s, 18-H), 4.96 (br s, 19-H), 5.13 (br s, 19-H), 5.00 and 5.54 (each d, J = 9 Hz, 6- and 7-H), 6.02 (m, 4-H) (Ref. 0335)	m/z 416.400 (M⁺), 398.382 (Ref. 0335)				As a minor product by the reaction of vitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0335)				[0335]
277			(7E)-(3S,6S)-6-hydroperoxy-9,10-seco-4,7,10(19)-cholestatrien-3-ol	VVD0280	Sachiko Yamada		C₂₇H₄₄O₃	416.636									(95% EtOH ) lmax (nm) 232.5 (Ref. 0335)	(CHCl₃) 3350, 2950 cm^-¹ (Ref. 0335)	¹H-NMR (d, CDCl₃) 0.60 (s, 18-H), 4.96 (br s, 19-H), 5.12 (br s, 19-H), 5.00 and 5.53 (each d, J = 9 Hz, 6- and 7-H), 6.04 (m, 4-H) (Ref. 0335)	m/z 416.400 (M⁺), 398.382 (Ref. 0335)				As a minor product by the reaction of vitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0335)				[0335]
278		1a,18-dihydroxyvitamin D₃ / 1a,18-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,18-triol	VVD0281	Sachiko Yamada	1a,18-(OH)₂D₃	C₂₇H₄₄O₃	416.636
279		22-ethyl-1a,22-dihydroxy-25,26,27-trinorvitamin D₃ / 22-ethyl-1a,22-dihydroxy-25,26,27-trinorcholecalciferol	(5Z,7E)-(1S,3R)-22-ethyl-9,10-seco-5,7,10(19)-cholatriene-1,3,22-triol	VVD0282	Sachiko Yamada	1a,22-(OH)₂-26,27-dimethyl-23,24-dinor-D₃	C₂₇H₄₄O₃	416.636		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are all > 10^-⁶ M, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)																		[0228]
280		(24R)-1a,24-dihydroxyvitamin D₃ / (24R)-1a,24-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,24R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0283	Sachiko Yamada	1a,24R-(OH)₂D₃	C₂₇H₄₄O₃	416.636		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 8.0 10^-⁹ M, 7.0 10^-⁹ M and 1.2 10^-⁸ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228) Affinity for the chick intestinal receptor : nearly as active as 1,25-(OH)₂D₃. (Ref. 0241)	Mixture of 24R and 24S epimers : 84-85 C (Ref. 0075)						Mixture of 24R and 24S epimers : lmax (nm) (emax) 266 (17000) (Ref. 0075)		Mixture of 24R and 24S epimers : ¹H-NMR (d, (CD₃)₂CO) 0.57 (3H, s, 13-Me), 0.87 (6H, d, J = 7 Hz, 25-Me2), 0.96 (3H, d, J = 5 Hz, 20-Me), 3.19 (1H, m, 24-H), 4.15 (1H, m, 1b-H), 4.36 (1H, m, 3a-H), 4.85 and 5.30 (each 1H, br s, 19-H), 6.05 and 6.26 (each 1H, d, J_A_B = 11 Hz, 6- and 7-H) (Ref. 0075)	Mixture of 24R and 24S epimers : m/z 416 (M⁺), 398 (M⁺-H₂O), 380 (M⁺-2H₂O), 269, 251, 134, 105 (Ref. 0075)				A mixture of epimers at C(24) was synthesized from 24-oxocholesterol via steps of Barton's 1a-hydroxylation, introduction of 5,7-diene structure, and photochemical followed by thermal isomerization. (Ref. 0075)				[0075] / [0228] / [0241]
281		(24S)-1a,24-dihydroxyvitamin D₃ / (24S)-1a,24-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,24S)-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0284	Sachiko Yamada	1a,24S-(OH)₂D₃	C₂₇H₄₄O₃	416.636		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 3.0 10^-⁸ M, 2.7 10^-⁸ M and 1.7 10^-⁸ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228) Affinity for the chick intestinal receptor : 1/10 as active as 1,25-(OH)₂D₃. (Ref. 0241)	Mixture of 24R and 24S epimers : 84-85 C (Ref. 0075)						Mixture of 24R and 24S epimers : lmax (nm) (emax) 266 (17000) (Ref. 0075)		Mixture of 24R and 24S epimers : ¹H-NMR (d, (CD₃)₂CO) 0.57 (3H, s, 13-Me), 0.87 (6H, d, J = 7 Hz, 25-Me2), 0.96 (3H, d, J = 5 Hz, 20-Me), 3.19 (1H, m, 24-H), 4.15 (1H, m, 1b-H), 4.36 (1H, m, 3a-H), 4.85 and 5.30 (each 1H, br s, 19-H), 6.05 and 6.26 (each 1H, d, J_A_B = 11 Hz, 6- and 7-H) (Ref. 0075)	Mixture of 24R and 24S epimers : m/z 416 (M⁺), 398 (M⁺-H₂O), 380 (M⁺-2H₂O), 269, 251, 134, 105 (Ref. 0075)				A mixture of epimers at C(24) was synthesized from 24-oxocholesterol via steps of Barton's 1a-hydroxylation, introduction of 5,7-diene structure, and photochemical followed by thermal isomerization. (Ref. 0075)				[0075] / [0228] / [0241]
282		1a,25-dihydroxyvitamin D₃ / 1a,25-dihydroxycholecalciferol / calcitriol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0285	Sachiko Yamada	1a,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636		Mechanism of action of 1,25-(OH)₂D₃: (Ref. 0027/0028) Clinical use: (Ref. 0058/0059) Cell differentiation: Table (Ref. 0060) Relative effects of 1a,25-(OH)₂D₃ and its A-ring diastereomers on components of the vitamin D endocrine system:Table (Ref. 0183) Dissociation constant (Kd) for vitamin D receptor (VDR): 8.2 10 ^-¹¹ (Ref. 0235); Kd, Mammalian VDR: 10^-¹¹ - 10^-¹⁰M : (Ref. 0184)<	106-112 C (Ref. 0024)				[a]_D +29 (in Et₂O) (Ref. 0024)		(Et₂O) lmax (nm) (e) 264 (18000), lmin (nm) (e) 228.5 (10100) (Ref. 0024)		¹H-NMR (d, CDCl₃, 500MHz) 0.54 (3H, s, 18-CH₃), 0.94 (3H, d, J = 6.2 Hz, 21-CH₃), 1.20 (6H, s, 26-, 27-CH₃), 2.32 (1H, dd, J = 13.6 and 6.7 Hz, 4b-H), 2.59 (1H, dd, J = 13.5 and 3.4 Hz, 4a-H), 2.83 (1H, dd, J = 11.8 and 3.7 Hz, 9b-H), 4.23 (1H, tt, J = 6.5 and 3.5 Hz, 3a-H), 4.43 (1H, dd, J = 7.5 and 4.0 Hz, 1b-H), 5.00 (1H, br s, 19-H), 5.33 (1H, br t, J = 1.4 Hz, 19-H), 6.02 (1H, d, J = 11.3 Hz, 7-H), 6.38 (1H, d, J = 11.3 Hz, 6-H) (Ref. 0025) ¹³C-NMR (d, CD₃OD-CFCl₃, 67.5MHz) spectrum (Ref. 0025)	m/z 416 (M⁺), 287, 269, 251, 152, 134 (Ref. 0026)	X-ray crystal structure: (Ref. 0186)		Isolation and identification: from chicken intestine (Ref. 0026/0027); from chick kidney homogenates incubated with 25-OHD₃. (Ref. 0028); from plants such as Solanum malacoxylon. (Ref. 0063) Concentration in human plasma: 20-65 pg/ml (Ref. 0029)	From 25-hydroxycholesterol: Dehydration, epoxidation, and reductive deconjugation of the resulting 1,2-epoxy-4,6-dien-3-one gave the key intermediate, 1a,25-dihydroxycholesterol, which was converted to 1a,25-(OH)₂D₃ by standard procedures of dehydration to the provitamin D, uv irradiation, and thermal isomerization. (Ref. 0024) From 6-methoxy-3,5-cyclo-24-homocholanic acid via 1a,3b,25-triacetoxy cholestan-6-one as a key intermediate. (Ref. 0035) From 25-OHD₃ via 3,5-cyclovitamin D derivative by SeO₂ oxidation as a key step. (Ref. 0062) Total chiral synthesis from d-carvone as an A-ring precursor and tetrahydroindan-5-one derivative as a CD-ring precursor. (Ref. 0357)	Biosynthesis: Hydroxylation of 25-OHD₃ by 1a-hydroxylase, a cytochrome P450 (CYP24B1) (Ref. 0030/0031) located in the kidney (Ref. 0017/0018/0022) . Further metabolism (catabolism), 24-Hydroxylation pathway: 24-Hydroxylation by vitamin D-24-hydroxylase (CTP24) (Ref. 0031/0033) to give 1,24R,25-(OH)₃D₃ (Ref. 0065/0034/0066) which is further oxidized by the same enzyme to 1-OH-tetranor-D₃ 23-carboxylic acid (calcitroic acid) (Ref. 0070/0073) via 1,25-(OH)₂-24-oxo-D₃ (Ref. 0068/0067) , 1,23,25-(OH)₃D₃-24-oxo-D₃ (Ref. 0067) and 1,23-(OH)₂-tetranor-D₃ (Ref. 0069) . 23-Hydroxylation pathway: 1,25-(OH)₂D₃ is also metabolized to 1,25R-(OH)₂D₃ 26,23S-lactone (Ref. 0077) via 1,23S,25-(OH)₃D₃ (Ref. 0076) , 1,23,25,26-(OH)₄D₃ (Ref. 0084) , and 1,25R-(OH)₂D₃ 26,23S-lactol (Ref. 0084). 26-Hydroxylation pathway: Kidney homogenates from vitamin D-supplemented chicks convert 1,25-(OH)₂D₃ to 1,25.26-(OH)₃D₃. (Ref. 0087)	Vitamin D receptor (VDR), Avian receptor: (Ref. 0037/0038/0039) ; Human receptor: (Ref. 0040) ; Rat receptor: (Ref. 0041/0042); Mouse receptor : (Ref. 0043) . VDR knock out mice: (Ref. 0057) . Dissociation constant (Kd, Mammalian) : 10^-¹¹ - 10^-¹⁰M: (Ref. 0184) Relationship between vitamin D receptor alleles and born density: (Ref. 0185) Vitamin D responsive elements (VDRE) sequences 1) Calcium binding protein (CaBP) 9K : GGGTGT CGG AAGCCC (Ref. 0044) 2) Rat osteocalcin : GGGTGA ATG AGGACA (Ref. 0045) 3) Human osteocalcin : GGGTGA ACG GGGGCA (Ref. 0046/0047) 4) Mouse osteopontin : GGTTCA CGA GGTTCA (Ref. 0048) 5) Rat 24-hydroxylase,distal : GGTTCA GCG GGTGCG (Ref. 0049) 6) Human 24-hydroxylase,distal : AGTTCA CCG GGTGTG (Ref. 0050) 7) Rat 24-hydroxylase,proximal : GAGTCA GCG AGGTGA GTG AGGGCG (Ref. 0051) 8) Human 24-hydroxylase,proximal : GAGTCA GCG AGGTGA GCG AGGGCG (Ref. 0050) 9) Human PTH : GGTTCA AAG CAGACA (Ref. 0052) 10) Mouse calbindin D28K : AGGTGA TGA AAGTCA (Ref. 0053) 11) Chicken carbonic anhydrase-II : GGGGGA AAA AGTCCA (Ref. 0054) 12) Human calbindin D9K : TGCCCTTCCTTATGGGGTTCA (Ref. 0055) 13) Mouse calbindin D28K : CTGGGGGATGTGAGGAGAAATGAGTCTGAGC (Ref. 0056)		[0017] / [0018] / [0022] / [0024] / [0025] / [0026] / [0027] / [0028] / [0029] / [0030] / [0031] / [0033] / [0034] / [0035] / [0037] / [0038] / [0039] / [0040] / [0041] / [0042] / [0043] / [0044] / [0045] / [0046] / [0047] / [0048] / [0049] / [0050] / [0051] / [0052] / [0053] / [0054] / [0055] / [0056] / [0057] / [0058] / [0059] / [0060] / [0062] / [0063] / [0065] / [0066] / [0067] / [0068] / [0069] / [0070] / [0073] / [0076] / [0077] / [0084] / [0087] / [0183] / [0184] / [0185] / [0186] / [0235] / [0357]
283		1a,25-dihydroxy-3-epivitamin D₃ / 1a,25-dihydroxy-3-epicholecalciferol	(5Z,7E)-(1S,3S)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0286	Sachiko Yamada	3-epi-1a,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636		Affinity to chick intestinal vitamin D receptor : 1/4 as active as 1,25-(OH)₂D₃. (Ref. 0182) Relative effect of 1a,25-(OH)₂D₃ and its A-ring diastereomers upon components of the vitamin D endocrine system.: Table (Ref. 0183)							(95% EtOH) lmax (nm) (emax) 264 (16900) (Ref. 0182)		¹H-NMR (d, CDCl₃, 300MHz) 0.54 (3H, s, 18C-CH₃), 0.93 (3H, d, J = 6.2 Hz, 21C-CH₃), 1.21 (6H, s, 26, 27C-2CH₃), 2.43 (1H, dd, J = 13.5, 5.5 Hz, 4b-H), 2.56 (1H, dd, J = 13.5, 2.9, 4a-H), 2.83 (1H, dd, J = 11.8, 3.0 Hz, 9b-H), 4.0-4.1 (1H, m, 3-H), 4.25-4.35 (1H, m, 1-H), 5.0 (1H, narrow m, 19-H), 5.29 (1H, narrow m, 19-H), 6.02 and 6.43 (2H, AB pattern, J = 11.3 Hz, 6-,7-H) (Ref. 0182) ¹³C-NMR (d, CDCl₃, 75.5MHz) 12.0, 18.8, 20.8, 22.2, 23.5, 27.7, 29.1, 29.2, 29.4, 36.1, 36.4, 40.5, 40.7, 44.4, 45.5, 45.9, 56.3, 56.5, 68.2, 71.1, 73.2, 112.9, 117.0, 125.6, 131.6, 143.2, 147.2 (Ref. 0182)	m/z 416 (M⁺, 19), 398 (M⁺-H₂O, 28), 380 (M⁺-2H₂O, 10), 330 (3), 285 (12), 251 (7), 227 (6), 152 (base, A-ring portion due to C₇,₈-cleavage), 134 (152-H₂O, 73), 107 (26), 95 (26), 81 (27), 55 (30) (Ref. 0182)				From 1b,25-dihydroxy-3-epivitamin D₃ by following transformations : oxidation with Des-Martin reagent, reduction (NaBH₄), and thermal isomerization. (Ref. 0182)				[0182] / [0183]
284		1a,25-dihydroxy-14-epivitamin D₃ / 1a,25-dihydroxy-14-epicholecalciferol	(5Z,7E)-(1S,3R,14R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0287	Sachiko Yamada	14-epi-1a,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for chick intestinal receptor, 15% ; Affinity for human vitamin D binding protein, 12% ; Intestinal calcium absorption in vitamin D-deficient chicks, 3.9% ; Bone calcium mobilization in vitamin D-deficient chicks. (Ref. 0314)							(95% EtOH) lmax (nm) (emax) 266 (17700), lmin (nm) (emin) 230 (10400) (Ref. 0314)		¹H-NMR (d, CDCl₃, 300MHz) 0.87 (3H, d, J = 6.4 Hz, 21C-CH₃), 0.90 (3H, s, 18C-CH₃), 1.22 (6H, s, 26,27C-CH₃), 1.0-2.3 (remaining ring and side chain hydrogens, series of m), 2.31 (1H, dd, J = 13.2 and 7.2 Hz), 2.46 (1H, br d, J = 14.3 Hz), 2.60 (1H, dd, J = 13.3 and 3.5 Hz), 4.23 (1H, m, 3-H), 4.44 (1H, t, J = 5.4 Hz, 1-H), 5.00 (1H, br s, 19-H), 5.34 (1H, br s, 19-H), 6.14 and 6.33 (2H, d, J = 11.2 Hz, 6-, 7-H-AB pattern) (Ref. 0314)	m/z 416 (11, M⁺), 398 (31, M⁺-H₂O), 380 (36, M⁺-2H₂O), 365 (9), 347 (5), 329 (3), 310 (2), 285 (11), 269 (9), 251 (16), 227 (8), 197 (14), 174 (17), 152 (34, A-ring fragment due to C₇,₈-cleavage), 134 (base, 152-H₂O), 109 (19), 95 (24), 81 (22), 69 (25), 59 (15) (Ref. 0314)				By Wittig-Horner coupling of des-AB 14-epivitamin D 8-ketone with A-ring phosphine oxide. The desired 14-epi-CD ketone was obtained from vitamin D₃ by ozonolysis followed by oxidation at C-25 and epimerization at C-14. (Ref. 0314)				[0314]
285		1a,25-dihydroxy-14-epiprevitamin D₃ / 1a,25-dihydroxy-14-epiprecholecalciferol	(6Z)-(1S,3R,14R)-9,10-seco-5(10),6,8-cholestatriene-1,3,25-triol	VVD0288	Sachiko Yamada	14-epipre-1a,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636
286		1a,25-dihydroxy-20-epivitamin D₃ / 1a,25-dihydroxy-20-epicholecalciferol	(5Z,7E)-(1S,3R,20S)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0289	Sachiko Yamada	1a,25-(OH)₂-20-epi-D₃	C₂₇H₄₄O₃	416.636		Biological activity (% of 1,25-(OH)₂D₃ effect) Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 5000 (IC50 : the title compound, 2.8 10^-¹⁰ M ; 1,25-(OH)₂D₃, 1.4 10^-⁸ M) ; Induction of U 937 cell differentiation : 2666 ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 120 ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 230. Inhibitory effects on murine thymocyte activation : 730800 (IC50 : the title compound, 2.6 10^-¹⁴ M ; 1,25-(OH)₂D₃, 1.9 10^-¹⁰ M). (Ref. 0278)															In vitro metabolism in human HPK1A-ras. cells was studied. 20-Epi-1,25-(OH)₂D₃ was found to be metabolized 36 times slowly than the natural hormone, 1,25-(OH)₂D₃ forming several metabolites which were analogous to metabolites of 1,25-(OH)₂D₃ formed in the side chain oxidation pathway. (Ref. 0324)			[0278] / [0324]
287		1a,25-dihydroxy-24a-homo-22-thiavitamin D₃ / 1a,25-dihydroxy-24a-homo-22-thiacholecalciferol	(5Z,7E)-(1S,3R)-24a-homo-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0290	Sachiko Yamada	22-thia-24a-homo-1a,25-(OH)₂D₃	C₂₇H₄₄O₃S	448.702																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
288		1a,25-dihydroxy-24a-homo-22-thia-20-epivitamin D₃ / 1a,25-dihydroxy-24a-homo-22-thia-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-24a-homo-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0291	Sachiko Yamada	20-epi-22-thia-24a-homo-1a,25-(OH)₂D₃	C₂₇H₄₄O₃S	448.702																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
289		(5E)-1a,25-dihydroxyvitamin D₃ / (5E)-1a,25-dihydroxycholecalciferol	(5E,7E)-(1S,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0292	Sachiko Yamada	(5E)-1a,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636		The title compound was approximately 1/16 and 1/64 as active as 1,25-(OH)₂D₃ in intestinal calcium transport and bone calcium mobilization, respectively. The affinity for intestinal vitamin D receptor was 13% of that of 1,25-(OH)₂D₃. (Ref. 0221)																		[0221]
290		1b,25-dihydroxyvitamin D₃ / 1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0293	Sachiko Yamada	1b,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636		Binding affinity for intestinal vitamin D receptor was 1/3000 relative to 1,25-(OH)₂D₃. (Ref. 0176) Relative effect of 1a,25-(OH)₂D₃ and its A-ring diastereomers upon components of the vitamin D endocrine system. (Ref. 0183)							lmax (nm) 263 (Ref. 0176)		¹H-NMR (d, CDCl ₃) 0.55 and 1.22 (s, 13-Me, 25-Me₂), 4.11 (m, 3-H), 4.37 (m, 1-H), 5.01 [d, J = 1.9 Hz, 19(Z)-H], 5.29 (d, J = 1.9 Hz, 19(E)-H], 6.43 and 6.06 (AB q, J = 11.8 Hz, 6- and 7-H) (Ref. 0176)	m/z 416 (M⁺, 10%), 152 (100%), 134 (95%), 59 (85%) (Ref. 0176)				From 1a,25-dihydroxyvitamin D₃ : Selective oxidation of the 1-hydroxyl group yielded 25-hydroxy-1-oxoprevitamin D₃ which by LiAlH₄ reduction gave 1b,25-dihydroxyvitamin D₃ and its 1a-isomer in 3 : 1 ratio. (Ref. 0176)				[0176] / [0183]
291		1b,25-dihydroxy-3-epivitamin D₃ / 1b,25-dihydroxy-3-epicholecalciferol	(5Z,7E)-(1R,3S)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0294	Sachiko Yamada	3-epi-1b,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636		Affinity to chick intestinal vitamin D receptor : 1/500 as active as 1,25-(OH)₂D₃. (Ref. 0182) Relative effect of 1a,25-(OH)₂D₃ and its A-ring diastereomers upon components of the vitamin D endocrine system.: Table (Ref. 0183)							(95% EtOH) lmax (nm) (emax) 264 (17000) (Ref. 0182)		¹H-NMR (d, CDCl₃, 300MHz) 0.54 (3H, s, 18C-CH₃), 0.93 (3H, d, J = 6.0 Hz, 21C-CH₃), 1.21 (6H, s, 26, 27C-2CH₃), 2.30 (1H, dd, J = 13.0, 7.5 Hz, 4b-H), 2.62 (1H, dd, J = 13.0, 3.7, 4a-H), 2.82 (1H, dd, J = 11.8, 3.0 Hz, 9b-H), 4.15-4.30 (1H, m, 3-H), 4.40-4.50 (1H, m, 1-H), 5.0 (1H, narrow m, 19-H), 5.32 (1H, narrow m, 19-H), 6.01 and 6.39 (2H, AB pattern, J = 11.4 Hz, 6-,7-H) (Ref. 0182) ¹³C-NMR (d, CDCl₃, 75.5MHz) 12.0, 18.8, 20.8, 22.3, 23.6, 27.6, 29.1, 29.2, 29.4, 29.7, 36.1, 36.4, 40.5, 42.8, 44.4, 45.5, 45.9, 56.3, 56.5, 66.8, 71.4, 112.6, 117.0, 125.0, 132.7, 143.3, 147.3 (Ref. 0182)	m/z 416 (M⁺, 21), 398 (M⁺-H₂O, 72), 380 (M⁺-2H₂O, 36), 362 (3), 329 (3), 285 (11), 251 (10), 227 (9), 197 (8), 152 (A-ring portion after C₇,₈-cleavage, 29), 134 (152-H₂O, base) (Ref. 0182)				Ethynylated chiral A-ring synthon derived from (R)-carvone was combined with upper half synthon (CD-ring plus side chain), the triple bond was partially reduced, and the resulting previtamin D was isomerized thermally. (Ref. 0182)				[0182] / [0183]
292		18,25-dihydroxyvitamin D₃ / 18,25-dihydroxycholecalciferol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19)-cholestatriene-3,18,25-triol	VVD0295	Sachiko Yamada	18,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636																By Wittig-Horner coupling of 18,25-dihydroxylated des-AB vitamin D 8-ketone with A-ring phosphine oxide. Functionalization of C-18 methyl was achieved by treatment of 8-hydroxy-des AB vitamin D with lead tetraacetate yielding the corresponding 8,18-cyclic ether (62% yield). (Ref. 0313)				[0313]
293		(22R)-22,25-dihydroxyvitamin D₃ / (22R)-22,25-dihydroxycholecalciferol	(5Z,7E)-(3S,22R)-9,10-seco-5,7,10(19)-cholestatriene-3,22,25-triol	VVD0296	Sachiko Yamada	22R,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636									(EtOH) lmax (nm) 263, lmin (nm) 228 (Ref. 0163)			m/z 416 (M⁺), 398 (M⁺-H₂O), 383 (M⁺-Me-H₂O), 365 (M⁺-Me-H₂O), 357 (C₂₄-C₂₅ cleavage), 311 (C₂₂-C₂₃ cleavage-H₂O), 300 (C₂₀-C₂₂ cleavage), 269, 267, 253, 251, 118 (Ref. 0163)								[0163]
294		(22S)-22,25-dihydroxyvitamin D₃ / (22S)-22,25-dihydroxycholecalciferol	(5Z,7E)-(3S,22S)-9,10-seco-5,7,10(19)-cholestatriene-3,22,25-triol	VVD0297	Sachiko Yamada	22S,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636									(EtOH) lmax (nm) 263, lmin (nm) 228 (Ref. 0163)			m/z 416 (M⁺), 398 (M⁺-H₂O), 383 (M⁺-Me-H₂O), 365 (M⁺-Me-H₂O), 357 (C₂₄-C₂₅ cleavage), 311 (C₂₂-C₂₃ cleavage-H₂O), 300 (C₂₀-C₂₂ cleavage), 269, 267, 253, 251, 118 (Ref. 0163)								[0163]
295		(23R)-23,25-dihydroxyvitamin D₃ / (23R)-23,25-dihydroxycholecalciferol	(5Z,7E)-(3S,23R)-9,10-seco-5,7,10(19)-cholestatriene-3,23,25-triol	VVD0298	Sachiko Yamada	23R,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636									lmax (nm) 265, lmin (nm) 228 (Ref. 0107)		¹H-NMR (d, CDCl₃) 6.23 (1H, d, J = 11 Hz, C-6), 6.03 (1H, d, J = 11 Hz, C-7), 5.05 (1H, m, C-19E), 4.81 (1H, m, C-19Z), 4.13 (1H, m, C-23), 3.94 (1H, m, C-3), 1.33 (3H, s, C-26), 1.26 (3H, s, C-27), 1.00 (3H, d, J = 7 Hz, C-21), 0.58 (3H, s, C-18) (Ref. 0107)	m/z 416.3319 (calcd, 416.3290 ) (27, M⁺), 398 (2.5, M⁺-H₂O), 383 (13, M⁺-H₂O-CH₃), 271 (8.5, M⁺-side chain), 253 (9.7, M⁺-side chain-H₂O), 136 (100, A ring+C₆+C₇⁺), 118 (96, 136-H₂O); spectrum (Ref. 0107) Tris(trimethylsilyl) ether; spectrum (Ref. 0107)		HPLC: (Ref. 0107/0108)	Produced by incubating kidney homogenates from vitamin D supplemented chickens with 25-OHD₃. (Ref. 0107)	Synthesis of 23x,25-(OH)₂D₃ from 3b,23x-dihydroxy-27-nor-5,7-cholestadien-25-one by methylation, UV irradiation and thernal isomerization. (Ref. 0107) Synthesis of two epimers at C(23) of 23,25-(OH)₂D₃ from cholenic acid ester, determination of the C(23) stereochemistry of a synthetic intermediate by X-ray analysis and determination of the C(23) configuration of the natural metabolite. (Ref. 0108)				[0107] / [0108]
296		(23S)-23,25-dihydroxyvitamin D₃ / (23S)-23,25-dihydroxycholecalciferol	(5Z,7E)-(3S,23S)-9,10-seco-5,7,10(19)-cholestatriene-3,23,25-triol	VVD0299	Sachiko Yamada	23S,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636									lmax (nm) 265, lmin (nm) 228 (Ref. 0107)		¹H-NMR (d, CDCl₃) 6.23 (1H, d, J = 10.5 Hz, C-6), 6.03 (1H, d, J = 10.5 Hz, C-7), 5.05 (1H, m, C-19E), 4.82 (1H, m, C-19Z), 4.10 (1H, m, C-23), 3.95 (1H, m, C-3), 1.32 (3H, s, C-26), 1.28 (3H, s, C-27), 0.98 (3H, d, J = 6 Hz, C-21), 0.56 (3H, s, C-18) (Ref. 0107)	m/z 416.3273 (calcd, 416.3290 ) (18, M⁺), 398 (2, M⁺-H₂O), 383 (10, M⁺-H₂O-CH₃), 271 (7, M⁺-side chain), 253 (8, M⁺-side chain-H₂O), 136 (100, A ring+C₆+C₇⁺), 118 (97, A ring+C₆+C₇⁺-H₂O); spectrum (Ref. 0107) Tris(trimethylsilyl) ether; spectrum (Ref. 0107)		HPLC: Co-chromatography of the natural metabolite with synthetic two C(23) epimers.(Ref. 0107/0108)	Produced by incubating kidney homogenates from vitamin D supplemented chickens with 25-OHD₃. (Ref. 0107)	Synthesis of 23x,25-(OH)₂D₃ from 3b,23x-dihydroxy-27-nor-5,7-cholestadien-25-one by methylation, UV irradiation and thernal isomerization. (Ref. 0107) Synthesis of two epimers at C(23) of 23,25-(OH)₂D₃ from Cholenic acid ester, determination of the C(23) stereochemistry of a synthetic intermediate by X-ray analysis and determination of the C(23) configuration of the natural metabolite. (Ref. 0108)	23S,25-(OH)₂D₃ was efficiently converted to 25-OHD₃ 26,23-lactone by incubating with vitamin D-supplemented chickens kidney homogenates. (Ref. 0109)			[0107] / [0108] / [0109]
297		(24R)-24,25-dihydroxyvitamin D₃ / (24R)-24,25-dihydroxycholecalciferol	(5Z,7E)-(3S,24R)-9,10-seco-5,7,10(19)-cholestatriene-3,24,25-triol	VVD0300	Sachiko Yamada	24R,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636		The increase in serum calcium concentration and intestinal calcium transport in response to the isomers of 24,25-(OH)₂D₃.: Table (Ref. 0089) Serum inorganic phosphorus and epiphyseal plate calcification response to the 24,25-(OH)₂D₃: Table (Ref. 0089) HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 1.1 10^-⁶ M, 9.5 10^-⁷ M and 9.5 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)							lmax (nm) 265 (Ref. 0088/0090)		¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.93 (3H, d, J = 4 Hz) , 1.17 (3H, s), 1.22 (3H, s), 3.33 (1H, m), 3.95 (1H, m), 4.85 (1H, bs), 5.07 (1H, bs), 6.08 (1H, d, J = 11 Hz), 6.25 (1H, d, J = 11 Hz) (Ref. 0090)	m/z 416 (M⁺), 271, 253, 136, 118; spectrum (Ref. 0088) m/z 416, 136, 118 (Ref. 0090)		HPLC: The stereochemistry at C(24) of the natural 24,25-(OH)₂D₃ was determined to be R by co-chromatography on HPLC with synthetic (24R)- and (24S)- 24,25-(OH)₂D₃ in a form of tris-trimethylsilyl ether.(Ref. 0089) .	Isolation and identification: from chicken kidney homogenates incubated with 24-OHD₃. (Ref. 0088)	Stereoselective synthesis from dinor-5,7-choladien-3b-ol and a chiral side-chain fragment. (Ref. 0090) Synthesis of epimeric mixture of 24x,25-(OH)₂D₃ from 3b-acetoxy-27-nor-5-cholesten-25-one. (Ref. 0091) The stereochemistry at C(24) of the natural 24,25-(OH)₂D₃ was determined to be R by Co-chromatography on HPLC with synthetic (24R)- and (24S)-24,25-(OH)₂D₃. (Ref. 0089)	In vitro, 24R,25-(OH)₂D₃ is oxidized at C(24) to yield 25-hydroxy-24-oxovitamin D₃ (Ref. 0096) , then hydroxylated at C(23) to give 23S,25-dihydroxy-24-oxovitamin D₃ (Ref. 0102) , and cleaved at 23,24-bond to afford 23-hydroxy-24,25,26,27-tetranorvitamin D₃ (Ref. 0105) . All these metabolic transformations were demonstrated to be catalyzed by vitamin D₃ 24-hydroxylase (CYP24)(Ref. 0266) . In vivo, 24R,25-(OH)₂D₃ has long half-life (17 days in dog) and metabolized similarly as found in the in vitro studies up to 23S,25-(OH)₂-24-oxo-D₃. However in vivo 23S,25-(OH)₂-24-oxo-D₃ is conjugated as it is produced in a form of 23b-glucuronide and excreted to bile (Ref. 0106) .	Cloning of the enzyme to produce 24R,25-dihydroxyvitamin D₃ from 25-hydroxyvitamin D₃, vitamin D-24-hydroxylase (Ref. 0031/0033)		[0031] / [0033] / [0088] / [0089] / [0090] / [0091] / [0096] / [0102] / [0105] / [0106] / [0228] / [0266]
298		(24S)-24,25-dihydroxyvitamin D₃ / (24S)-24,25-dihydroxycholecalciferol	(5Z,7E)-(3S,24S)-9,10-seco-5,7,10(19)-cholestatriene-3,24,25-triol	VVD0301	Sachiko Yamada	24S,25-(OH)₂D₃	C₂₇H₄₄O₃	416.636		The increase in serum calcium concentration and intestinal calcium transport in response to the isomers of 24,25-(OH)₂D₃.: Table (Ref. 0089) Serum inorganic phosphorus and epiphyseal plate calcification response to the 24,25-(OH)₂D₃: Table (Ref. 0089)												HPLC : The stereochemistry at C(24) was determined by co-chromatography of tris(trimethylsilyl) ethers of the natural and synthetic (24R)- and (24S)-24,25-(OH)₂D₃. on HPLC (Ref. 0092/0089)	Isolation and identification from kidney homogenates from either vitamin D-supplemented or deficient chickens incubated with 25-OH-24-oxo-D₃. (Ref. 0092)	Synthesis of epimeric mixture of 24x,25-(OH)₂D₃ from 3b-acetoxy-27-nor-5-cholesten-25-one. (Ref. 0091) Asymmetric synthesis of (24R)- and (24S)-24,25-dihydroxyprovitamin D₃ from 5-Cholen-24-oic acid via asymmetric reduction of 4,25-Cholestadien-24-one as a key step.(Ref. 0129)	Incubation of 25-OH-24-oxo-D₃ with kidney homogenates from either vitamin D-supplemented or deficient chickens yielded 24S,25-(OH)₂ D₃ (Ref. 0092)			[0089] / [0091] / [0092] / [0129]
299		(25R)-25,26-dihydroxyvitamin D₃ / (25R)-25,26-dihydroxycholecalciferol	(5Z,7E)-(3S,25R)-9,10-seco-5,7,10(19)-cholestatriene-3,25,26-triol	VVD0302	Sachiko Yamada	25R,26-(OH)₂D₃	C₂₇H₄₄O₃	416.636		Effect of intrajugular administration of 0.25 or 2.5 mg of 25,26-(OH)₂D₃ on calcium transport and serum calcium of rats on a low calcium diet. : Table I (Ref. 0126) Stimulation of intestinal calcium transport by a epimeric mixture of synthetic 25,26-(OH)₂D₃.; Table (Ref. 0128) Effect of a synthetic mixture of (25S)- and (25R)-25,26-(OH)₂D₃ on calcium mobilization from bone at dose levels of 0.25 and 2.5 mg: Table (Ref. 0128)	126-128 C (Ref. 0131/0132)				[a]_D +88 (c = 0.5 in CH₃OH) (Ref. 0131)		lmax (nm) 265, lmin (nm) 228 (Ref. 0126) lmax (EtOH) (nm) (e) 265 (18000) (Ref. 0129) lmax (nm) (e) 264 (17700) (Ref. 0132)		¹H-NMR (d, CDCl₃) 0.54 (3H, s, 13-Me), 0.94 (3H, d, J = 6 Hz, 20-Me), 1.20 (3H, s, 25-Me), 3.43 (1H, d, J = 12 Hz, 26-H), 3.48 (1H, d, J = 12 Hz, 26-H), 3.95 (1H, m, 3a-H), 4.86 (1H, d, J = 3 Hz, 19-H), 5.09 (1H, d, J = 3 Hz, 19-H), 6.03 (1H, d, J = 12 Hz, 6- or 7-H), 6.25 (1H, d, J = 12 Hz, 6- or 7-H) (Ref. 0129) ¹H-NMR (d, CDCl₃, 270Hz) 0.54 [s, H₃C (18)], 0.95 [d, J = 7 Hz, 3H-C (21)], 1.2 [s, H₃C-C (25)], ca. 1.0-2.9 (m, CH and CH₂), 3.45 [AB-System, J = 12 Hz, dn = 16, 2H-C (26)], 3.95 [m, H-C (3)], 4.86 and 5.09 [AB-System, J = 3 Hz, 2H-C (19)], 6.03 and 6.25 [AB-System, J = 12 Hz, H-C (6), H-C (7)] (Ref. 0132)	m/z 416 (M⁺), 398, 383, 367, 271, 253, 136, 118; spectrum(Ref. 0126)	CD [ 1:1 complexes of Eu(fod)₃, substrate (c 0.0002 M) in CHCl₃] 318 nm (e -2.9) (Ref. 0131)	HPLC: (Ref. 0127)	Isolation and identification from the plasma of pigs given large doses of vitamin D₃. (Ref. 0126) 25,26-(OH)₂D₃ obtained either by incubating vitamin D supplemented chick kidney with 25-OHD₃ or from rat serum was shown to be a epimeric mixture of (25S)- and (25R)- isomers. (Ref. 0127)	Synthesis of an epimeric mixture of (25S)- and (25R)-25,26-(OH)₂D₃ from 3-hydroxy-27-nor-5-cholesten-25-one. (Ref. 0128/0130) Asymmetric synthesis of (25R)- and (25S)-25,26-(OH)₂D₃ from 5-Cholen-24-oic acid via asymmetric epoxidation of 5,24-Cholestadien-26-ol as a key step and determination of the configuration at C(25) of the natural metabolite. (Ref. 0129) (25R)- and (25S)-25,26-(OH)₂D₃ were stereoselectively synthesized from C(21) steroid carboxylic acid ester and chiral C(6) side chain synthons and the stereochemistry at C(25) of the natural human metabolite was determined to be S. (Ref. 0131) Stereoselective synthesis of (25S)- and (25R)-25,26-(OH)₂D₃ from stigmasterol-derived C(22) steroid-units and chiral C(5) side chain synthons via Grignard- or Wittig -coupling as key step. (Ref. 0132)				[0126] / [0127] / [0128] / [0129] / [0130] / [0131] / [0132]
300		(25S)-25,26-dihydroxyvitamin D₃ / (25S)-25,26-dihydroxycholecalciferol	(5Z,7E)-(3S,25S)-9,10-seco-5,7,10(19)-cholestatriene-3,25,26-triol	VVD0303	Sachiko Yamada	25S,26-(OH)₂D₃	C₂₇H₄₄O₃	416.636		Effect of intrajugular administration of 0.25 or 2.5 mg of 25,26-(OH)₂D₃ on calcium transport and serum calcium of rats on a low calcium diet. : Table(Ref. 0126) Stimulation of intestinal calcium transport by a epimeric mixture of synthetic 25,26-(OH)₂D₃.; Table (Ref. 0128) Effect of a synthetic mixture of (25S)- and (25R)-25,26-(OH)₂D₃ on calcium mobilization from bone at dose levels of 0.25 and 2.5 mg: Table (Ref. 0128)	140-142 C (Ref. 0131) 139-140 C (Ref. 0132)				[a]_D +91 (c = 0.5 in CH₃OH) (Ref. 0131)		lmax (nm) 265, lmin (nm) 228 (Ref. 0126) lmax (EtOH) (nm) (e) 265 (18000) (Ref. 0129) lmax (nm) (e) 264 (17700) (Ref. 0132)		¹H-NMR (d, CDCl₃) 0.54 (3H, s, 13-Me), 0.94 (3H, d, J = 6 Hz, 20-Me), 1.20 (3H, s, 25-Me), 3.43 (1H, d, J = 12 Hz, 26-H), 3.48 (1H, d, J = 12 Hz, 26-H), 3.95 (1H, m, 3a-H), 4.86 (1H, d, J = 3 Hz, 19-H), 5.09 (1H, d, J = 3 Hz, 19-H), 6.03 (1H, d, J = 12 Hz, 6- or 7-H), 6.25 (1H, d, J = 12 Hz, 6- or 7-H) (Ref. 0129) ¹H-NMR (d, CDCl₃, 270Hz) 0.54 [s, H₃C (18)], 0.95 [d, J = 7 Hz, 3H-C (21)], 1.2 [s, H₃C-C (25)], ca. 1.0-2.9 (m, CH and CH₂), 3.45 [AB-System, J = 12 Hz, dn = 16, 2H-C (26)], 3.95 [m, H-C (3)], 4.86 and 5.09 [AB-System, J = 3 Hz, 2H-C (19)], 6.03 and 6.25 [AB-System, J = 12 Hz, H-C (6), H-C (7)] (Ref. 0132)	m/z 416 (M⁺), 398, 383, 367, 271, 253, 136, 118; spectrum(Ref. 0126)	CD [ 1:1 complexes of Eu(fod)₃, substrate (c 0.0002 M) in CHCl₃] 318 nm (e -2.3) (Ref. 0131)	HPLC: (Ref. 0127)	Isolation and identification from the plasma of pigs given large doses of vitamin D₃. (Ref. 0126) 25,26-(OH)₂D₃ obtained either by incubating vitamin D supplemented chick kidney with 25-OHD₃ or from rat serum was shown to be a epimeric mixture of (25S)- and (25R)- isomers. (Ref. 0127)	Synthesis of an epimeric mixture of (25S)- and (25R)-25,26-(OH)₂D₃ from 3-hydroxy-27-nor-5-cholesten-25-one. (Ref. 0128/0130) Asymmetric synthesis of (25R)- and (25S)-25,26-(OH)₂D₃ from 5-Cholen-24-oic acid via asymmetric epoxidation of 5,24-Cholestadien-26-ol as a key step and determination of the configuration at C(25) of the natural metabolite. (Ref. 0129) (25R)- and (25S)-25,26-(OH)₂D₃ were stereoselectively synthesized from C(21) steroid carboxylic acid ester and chiral C(6) side chain synthons and the stereochemistry at C(25) of the natural human metabolite was determined to be S. (Ref. 0131) Stereoselective synthesis of (25S)- and (25R)-25,26-(OH)₂D₃ from stigmasterol-derived C(22) steroid-units and chiral C(5) side chain synthons via Grignard- or Wittig -coupling as key step. (Ref. 0132)				[0126] / [0127] / [0128] / [0129] / [0130] / [0131] / [0132]
301		(6R)-6,19-epidioxy-1a-hydroxy-6,19-dihydrovitamin D₃ / (6R)-6,19-epidioxy-1a-hydroxy-6,19-dihydrocholecalciferol	(7E)-(1S,3R,6R)-6,19-epidioxy-9,10-seco-5(10),7-cholestadiene-1,3-diol	VVD0304	Sachiko Yamada		C₂₇H₄₄O₄	432.636		Binding affinity for the vitamin D receptor in HL-60 cells : < 1/10000 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : > 1/1000 as active as 1,25-(OH)₂D₃. (Ref. 0339)									¹H-NMR (d, CDCl₃) 0.58 (3H, s, 18-H), 0.89 (6H, d, J = 6 Hz, 26- and 27-H), 0.93 (3H, d, J = 6 Hz, 21-H), 4.24 (1H, m, 3-H), 4.41 (1H, m, 1-H), 4.52 (1H, d, J = 8 Hz, 19-H), 4.82 (1H, d, J = 18 Hz, 19-H), 5.03 (1H, d, J = 9 Hz, 6- or 7-H), 5.19 (1H, d, J = 9 Hz, 7- or 6-H) (Ref. 0339)	m/z 414 (M⁺-H₂O), 301, 283, 167 (Ref. 0339)	CD : 208 nm (e -50.1) (in MeOH) (Ref. 0339)			As a major product by the reaction of 1a-hydroxyvitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0339)				[0339]
302		(6S)-6,19-epidioxy-1a-hydroxy-6,19-dihydrovitamin D₃ / (6S)-6,19-epidioxy-1a-hydroxy-6,19-dihydrocholecalciferol	(7E)-(1S,3R,6S)-6,19-epidioxy-9,10-seco-5(10),7-cholestadiene-1,3-diol	VVD0305	Sachiko Yamada		C₂₇H₄₄O₄	432.636		Binding affinity for the vitamin D receptor in HL-60 cells : < 1/10000 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : > 1/1000 as active as 1,25-(OH)₂D₃. (Ref. 0339)	135-136 C (Ref. 0339)								¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-H), 0.86 (6H, d, J = 6 Hz, 26- and 27-H), 0.91 (3H, d, J = 6 Hz, 21-H), 4.12 (1H, m, 3-H), 4.25 (1H, m, 1-H), 4.67 (2H, s, 19-H), 4.74 (1H, d, J = 9 Hz, 6- or 7-H), 5.33 (1H, d, J = 9 Hz, 7- or 6-H) (Ref. 0339)	m/z 414 (M⁺-H₂O), 301, 206, 167 (Ref. 0339)	CD : 212 nm (e +13.4) (in MeOH) (Ref. 0339)			As a major product by the reaction of 1a-hydroxyvitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0339)				[0339]
303		(6R)-25-hydroxyvitamin D₃ 6,19-sulfur dioxide adduct / (6R)-25-hydroxycholecalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6R)-6,19-epithio-9,10-seco-5(10),7-cholestadiene-3,25-diol S,S-dioxide	VVD0306	Sachiko Yamada	25-OHD₃ 6R,19-sulfur dioxide adduct	C₂₇H₄₄O₄S	464.702																From 25-hydroxyvitamin D₃ by treatment with liquid sulfur dioxide. (Ref. 0267/0331)				[0267] / [0331]
304		(6S)-25-hydroxyvitamin D₃ 6,19-sulfur dioxide adduct / (6S)-25-hydroxycholecalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6S)-6,19-epithio-9,10-seco-5(10),7-cholestadiene-3,25-diol S,S-dioxide	VVD0307	Sachiko Yamada	25-OHD₃ 6S,19-sulfur dioxide adduct	C₂₇H₄₄O₄S	464.702																From 25-hydroxyvitamin D₃ by treatment with liquid sulfur dioxide. (Ref. 0267/0331)				[0267] / [0331]
305		(6R)-6,19-epidioxy-25-hydroxy-6,19-dihydrovitamin D₃ / (6R)-6,19-epidioxy-25-hydroxy-6,19-dihydrocholecalciferol	(7E)-(3S,6R)-6,19-epidioxy-9,10-seco-5(10),7-cholestadiene-3,25-diol	VVD0308	Sachiko Yamada		C₂₇H₄₄O₄	432.636		Binding affinity for the vitamin D receptor in HL-60 cells : 1/3000 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : 1/120 as active as 1,25-(OH)₂D₃. (Ref. 0339)	137-138 C (Ref. 0339)								¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-H), 0.94 (3H, d, J = 6 Hz, 21-H), 1.22 (6H, s, 26- and 27-H), 4.10 (1H, m, 3-H), 4.36 (1H, d, J = 15 Hz, 19-H), 4.44 (1H, d, J = 15 Hz, 19-H), 4.92 (1H, d, J = 10 Hz, 6-H), 5.20 (1H, d, J = 10 Hz, 7-H) (Ref. 0339)	m/z 432 (M⁺), 414, 396, 151 (Ref. 0339)	CD : 210 nm (e -39.4) (in MeOH) (Ref. 0339)			As a major product by the reaction of 25-hydroxyvitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0339)				[0339]
306		(6S)-6,19-epidioxy-25-hydroxy-6,19-dihydrovitamin D₃ / (6S)-6,19-epidioxy-25-hydroxy-6,19-dihydrocholecalciferol	(7E)-(3S,6S)-6,19-epidioxy-9,10-seco-5(10),7-cholestadiene-3,25-diol	VVD0309	Sachiko Yamada		C₂₇H₄₄O₄	432.636		Binding affinity for the vitamin D receptor in HL-60 cells : 1/3000 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : 1/130 as active as 1,25-(OH)₂D₃. (Ref. 0339)	148-150 C (Ref. 0339)								¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-H), 0.94 (3H, d, J = 6 Hz, 21-H), 1.22 (6H, s, 26- and 27-H), 3.96 (1H, m, 3-H), 4.20 (1H, d, J = 16 Hz, 19-H), 4.60 (1H, d, J = 16 Hz, 19-H), 4.80 (1H, d, J = 9 Hz, 6- or 7-H), 5.28 (1H, d, J = 9 Hz, 7- or 6-H) (Ref. 0339)		CD : 213 nm (e +9.9) (in MeOH) (Ref. 0339)			As a major product by the reaction of 25-hydroxyvitamin D₃ with singlet oxygen generated by dye-sensitized photochemical method.(Ref. 0339)				[0339]
307		1a,25-dihydroxy-24a-homo-22-oxavitamin D₃ / 1a,25-dihydroxy-24a-homo-22-oxacholecalciferol	(5Z,7E)-(1S,3R)-24a-homo-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0310	Sachiko Yamada	22-oxa-24a-homo-1a,25-(OH)₂D₃	C₂₇H₄₄O₄	432.636		The activity inducing differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : ED50 = 1.58 10^-⁹ M [ED50 of 1,25-(OH)₂D₃ : 1.70 10^-⁸ M, ED50 of OCT : 1.78 10^-⁸ M] the binding properties to the chick embryonic intestinal 1,25-(OH)₂D₃ receptor : 9%, 1,25-(OH)₂D₃ : 100%, OCT : 12.5%. (Ref. 0203)							(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0203)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 1.17 (3H, d, J = 6.1 Hz), 1.22 (6H, s), 3.26 (2H, m), 3.59 (1H, m), 4.23 (1H, m), 4.43 (1H, m), 5.00 (1H, t, J = 1.7 Hz), 5.33 (1H, t, J = 1.7 Hz), 6.02 (1H, d, J = 11.4 Hz), 6.37 (1H, d, J = 11.4 Hz) (Ref. 0203)	m/z 432 (M⁺), 83 (100%) (Ref. 0203)	Colorless foam. (Ref. 0203)	Flash column chromatography with AcOEt/n-hexane (5;1) (Ref. 0203)		Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-(4-hydroxy-4-methylpentyloxy)pregna-5,7-diene by photochemical method. (Ref. 0203)				[0203]
308		1a,25-dihydroxy-24a-homo-22-oxa-20-epivitamin D₃ / 1a,25-dihydroxy-24a-homo-22-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-24a-homo-22-oxa-9,10-seco-5,7,10(19)-cholestatrien-1,3,25-triol	VVD0311	Sachiko Yamada		C₂₇H₄₄O₄	432.636		Biological activity (% of 1,25-(OH)₂D₃ effect) Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 8200 (IC50 : the title compound, 1.7 10^-¹⁰ M ; 1,25-(OH)₂D₃, 1.4 10^-⁸ M) ; Induction of U 937 cell differentiation : 117600 ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 9 ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 270. (Ref. 0278)																		[0278]
309		1a,25-dihydroxy-10,19-methano-23-oxavitamin D₃ / 1a,25-dihydroxy-10,19-methano-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-10,19-methano-23-oxa-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0312	Sachiko Yamada	10,19-methano-23-oxa-1a,25-(OH)₂D₃	C₂₇H₄₄O₄	432.636																From protected (5E)-1a,22-dihydroxy-23,24,25,26,27-pentanorvitamin D₃ via alkylation under phase-transfer conditions, Grignard reaction, photoisomerization, deprotection of the 1-hydroxyl group, Simmons-Smith methylenation and deprotection. (Ref. 0299/0300)				[0299] / [0300]
310		1a,2,25-trihydroxyvitamin D₃ / 1a,2,25-trihydroxycholecalciferol	(5Z,7E)-(1,2,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,2,3,25-tetrol	VVD0313	Sachiko Yamada	1a,2,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636
311		1a,11a,25-trihydroxyvitamin D₃ / 1a,11a,25-trihydroxycholecalciferol	(5Z,7E)-(1S,3R,11S)-9,10-seco-5,7,10(19)-cholestatriene-1,3,11,25-tetrol	VVD0314	Sachiko Yamada	1a,11a,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636
312		1a,11b,25-trihydroxyvitamin D₃ / 1a,11b,25-trihydroxycholecalciferol	(5Z,7E)-(1S,3R,11R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,11,25-tetrol	VVD0315	Sachiko Yamada	1a,11b,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636
313		1a,18,25-trihydroxyvitamin D₃ / 1a,18,25-trihydroxycholecalciferol	(5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,18,25-tetrol	VVD0316	Sachiko Yamada	1a,18,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636																By palladium-catalyzed coupling of des-AB 8-triflate with 5(10)-en-6-yne A-ring fragment as key step. Functionalization of C-18 methyl was achieved by treatment of 8-hydroxy-des AB vitamin D with lead tetraacetate yielding the corresponding 8,18-cyclic ether (62% yield). (Ref. 0313)				[0313]
314		(20S)-1a,20,25-trihydroxyvitamin D₃ / (20S)-1a,20,25-trihydroxycholecalciferol	(5Z,7E)-(1S,3R,20S)-9,10-seco-5,7,10(19)-cholestatriene-1,3,20,25-tetrol	VVD0317	Sachiko Yamada	1a,20S,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 50% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 0.006% ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 0.6%. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by photochemical isomerization and deprotection. (Ref. 0279)				[0279]
315		(22R)-1a,22,25-trihydroxy-20-epivitamin D₃ / (22R)-1a,22,25-trihydroxy-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,22,25-tetrol	VVD0318	Sachiko Yamada	20-epi-1a,22R,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 10 ; Inhibition of proliferation, 10. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with Grignard reagent of side chain fragment giving major (19:1) 22R-hydroxy product as a key step. (Ref. 0321)				[0321]
316		(23S)-1a,23,25-trihydroxyvitamin D₃ / (23S)-1a,23,25-trihydroxycholecalciferol	(5Z,7E)-(1S,3R,23S)-9,10-seco-5,7,10( 19)-cholestatriene-1,3,23,25-tetrol	VVD0319	Sachiko Yamada	1a,23S,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 0 ; Bone calcium mobilization in rat, 0 ; Differentiation of human leukemia cells (HL-60), 14. (Ref. 0237)																		[0237]
317		(24R)-1a,24,25-trihydroxyvitamin D₃ / (24R)-1a,24,25-trihydroxycholecalciferol	(5Z,7E)-(1S,3R,24R)-9,10-seco-5,7,10(19)-cholestatriene-1,3, 24,25-tetrol	VVD0320	Sachiko Yamada	1a,24R,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636		Antirachitic activity of 1,24,25-(OH)₂D₃ and vitamin D₃: Table (Ref. 0065) HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 3.5 10^-⁸ M, 3.5 10^-⁸ M and 3.5 10^-⁸ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228) Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 93 ; Bone calcium mobilization in rat, 17 ; Competitive binding to rat intestinal vitamin D receptor, 2 ; Differentiation of human leukemia cells (HL-60), 20. (Ref. 0237)							lmax (nm) 265, lmin (nm) 228 (Ref. 0064)		: ¹H-NMR (d, Aceton-d6) 0.58 (3H, s, 18-Me), 1.12 (6H, s, 26- ,27-Me), 3.25 (1H, m, 24C-H), 4.15 (1H, m, 1C-H), 4.39 (1H, m, 3C-H), 5.30 and 4.93 (2H, two s, 19-CH₂), and 6.18 ppm (2H, BAq, J = 11 Hz, 6C-, 7C-Hs) (Ref. 0064)	m/z 432 (M⁺), 414, 396, 287, 269, 251, 134 (Ref. 0064) m/z 432 (M⁺), 414, 396, 287, 269, 251, 152, 134; spectrum (Ref. 0065)				From 24x,25-dihydroxycholesterol via 1a-hydroxylation, separation of the 24-epimers, dehydration, UV irradiation and thernal isomerization. (Ref. 0064) Generated in vivo in rats from 25-OHD₃ and in vitro from 24,25-(OH)₂D₃ by incubating with chicken kidney homogenate. (Ref. 0065) Production in vivo in vitamin D-deficient rats from either 25-OHD₃ or 1,25-(OH)₂D₃ and determination of the structure including the stereochemistry at C(24). (Ref. 0066)	Produced from 1,25-dihydroxyvitamin D₃ by hydroxylation catalyzed by vitamin D₃ 24-hydroxylase. (Ref. 0031/0033) 1a,24R,25-Trihydroxyvitamin D₃ is further oxidized by the same enzyme to 1-OH-tetranor-D₃ 23-carboxylic acid (calcitroic acid) (Ref. 0070/0073) via 1,25-(OH)₂-24-oxo-D₃ (Ref. 0068/0067), 1,23,25-(OH)₃D₃-24-oxo-D₃ (Ref. 0067) and 1,23-(OH)₂-tetranor-D₃ (Ref. 0069) .	Vitamin D responsive elements (VDRE) of rat 24-hydroxylase,distal : GGTTCA GCG GGTGCG (Ref. 0049) ; Human 24-hydroxylase, distal : AGTTCA CCG GGTGTG (Ref. 0050) ; Rat 24-hydroxylase,proximal : GAGTCA GCG AGGTGA GTG AGGGCG (Ref. 0051) ; Human 24-hydroxylase,proximal : GAGTCA GCG AGGTGA GCG AGGGCG (Ref. 0050) .		[0031] / [0033] / [0049] / [0050] / [0051] / [0064] / [0065] / [0066] / [0067] / [0068] / [0069] / [0070] / [0073] / [0228] / [0237]
318		(24S)-1a,24,25-trihydroxyvitamin D₃ / (24S)-1a,24,25-trihydroxycholecalciferol	(5Z,7E)-(1S,3R,24S)-9,10-seco-5,7,10(19)-cholestatriene-1,3,24,25-tetrol	VVD0321	Sachiko Yamada	1a,24S,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636
319		(5E)-(25R)-1a,25,26-trihydroxyvitamin D₃ / (5E)-(25R)-1a,25,26-trihydroxycholecalciferol	(5E,7E)-(1S,3R,25R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25,26-tetrol	VVD0322	Sachiko Yamada	(5E)-1a,25R,26-(OH)₃D₃	C₂₇H₄₄O₄	432.636		Affinity for the chick intestinal receptor : 1/8 as active as 1,25-(OH)₂D₃. (Ref. 0242)																		[0242]
320		(25S)-1a,25,26-trihydroxyvitamin D₃ / (25S)-1a,25S,26-trihydroxycholecalciferol	(5Z,7E)-(1S,3R,25S)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25,26-tetrol	VVD0323	Sachiko Yamada	1a,25S,26-(OH)₃D₃	C₂₇H₄₄O₄	432.636		Biological activity (% of 1,25-(OH)₂D₃ effect) : Vitamin D receptor binding (chick intestine), 9% ; Inhibition of cell (HL-60) proliferation, 50% ; Induction cell (HL-60) differentiation, 100% ; ⁴⁵Ca retention in kidney in rats, <10%. (Ref. 0297)	163-164 C (Ref. 0291)				[a] +58.8 (c = 0.5 in MeOH) (Ref. 0291)		(EtOH) lmax (nm) (e) 265 (17080) (Ref. 0291)	(KBr) 3400, 1050 cm^-¹ (Ref. 0291)	¹H-NMR (d, CD₃OD, 200MHz) 0.57 (3H, s), 0.96 (3H, d, J = 6.4 Hz), 1.12 (3H, s), 4.87 (1H, br s), 5.28 (1H, br s), 6.08 (1H, d of AB, J = 10.4 Hz), 6.34 (1H, d of AB, J = 10.4 Hz) (Ref. 0291)	m/z 432 (M⁺, 6), 414 (8), 396 (6), 287 (8), 269 (10), 251 (10), 152 (36), 134 (100) (Ref. 0291)				Stereoselective synthesis of (25S)- and (25R)-1,25,26-(OH)₃D₃ from C(17) steroid and C(6)-chiral side chain synthons. The stereochemistry at C(25) of metabolite isolated from bovine serum was determined to be S. (Ref. 0086) Total convergent synthesis via Wittig-Horner coupling of CD ring 8-ketone with A ring phosphine oxide. The upper half was constructed via 1,3-dipolar cycloaddition of C-23 nitrone with methyl methacrylate as key step. (Ref. 0291)	1,25,26-Trihydroxyvitamin D₃ was produced from either 1,25-(OH)₂D₃ incubated with kidney homogenate from vitamin D-supplemented chickens or from 25,26-(OH)₂D₃ incubated with vitamin D-deficient chicken kidney homogenate. (Ref. 0087)			[0086] / [0087] / [0291] / [0297]
321		22,24,25-trihydroxyvitamin D₃ / 22,24,25-trihydroxycholecalciferol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19)-cholestatriene-3,22,24,25-tetrol	VVD0324	Sachiko Yamada	22,24,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636									(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0193)		Isomer A : ¹H-NMR (d, CDCl₃) 0.56 (3H, s, 13-Me), 0.97 (3H, d, J = 6 Hz, 20-Me), 1.20 and 1.24 (each 3H, s, 25-Me₂), 3.60 (1H, m, 22- or 24-H), 4.00 (2H, m, 22- or 24-H and 3a-H), 4.85 and 5.08 (each 1H, br s, 19-H₂), 6.07 and 6.27 (each 1H, d, J = 11 Hz, 6- and 7-H). Isomer B : ¹H-NMR (d, CDCl₃) 0.54 (3H, s, 13-Me), 0.98 (3H, d, J = 6 Hz, 20-Me), 1.17 and 1.21 (each 3H, s, 25-Me₂), 3.73 (3H, m, 3a-, 22- and 24-H), 4.84 and 5.06 (each 1H, br s, 19-H₂), 6.05 and 6.25 (each 1H, d, J = 11 Hz, 6- and 7-H) (Ref. 0193)	Isomer A : m/z 432.3217, Isomer B : m/z 432.3235 (Ref. 0193)								[0193]
322		(23S)-23,24,25-trihydroxyvitamin D₃ / (23S)-23,24,25-trihydroxycholecalciferol	(5Z,7E)-(3S,23S)-9,10-seco-5,7,10(19)-cholestatriene-3,23,24,25-tetrol	VVD0325	Sachiko Yamada	23S,24,25-(OH)₃D₃	C₂₇H₄₄O₄	432.636									lmax (nm) 265 (Ref. 0100)			m/z 432 (M⁺), 399, 271, 253, 136, 118; spectrum(Ref. 0102)			Isolation and identification from Chicken kidney homogenate incubated with 25-OH-24-oxo D₃. (Ref. 0102) Isolated and identified from blood plasma of chicks given large doses of vitamin D₃. (Ref. 0100)		Isolated as one of the metabolites produced from 25-hydroxy-24-oxovitamin D₃ when the latter vitamin D metabolite was incubated with kidney homogenate from vitamin D supplemented chicks. (Ref. 0102)			[0100] / [0102]
323		(23S,25R)-23,25,26-trihydroxyvitamin D₃ / (23S,25R)-23,25,26-trihydroxycholecalciferol	(5Z,7E)-(3S,23S,25R)-9,10-seco-5,7,10(19)-cholestatriene-3,23,25,26-tetrol	VVD0326	Sachiko Yamada	23S,25R,26-(OH)₃D₃	C₂₇H₄₄O₄	432.636									lmax (95% EtOH) (nm) 265 (Ref. 0125)		¹H-NMR (d, CD₃OD) 0.56 (3 H, s, H-18), 1.22 (3 H, s, H-27), 3.57 (2 H, AB q, J = 11 Hz, H-26), 3.8-4.2 (2 H, m, H-3 and H-23), 4.82 (1 H, br s, H-19), 5.04 (1 H, br s, H-19), 6.13 (2 H, AB q, J = 11 Hz, H-6 and -7). (Ref. 0125)				Isolated and identified from chick kidney homogenates incubated with 23S,25-(OH)₂D₃. (Ref. 0110)	From triazolinedione adduct of (3S,23S,25R)-3,25-dihydroxy-5,7-cholestadiene 26,23-lactone (an intermediate of the synthesis of 25R-OHD₃ 26,23S-lactone) by reduction with LiAlH₄ followed by photochemical and thernal isomerization. (Ref. 0125/0113)	Metabolized to (23S,25R)-25-OHD₃ 26,23-lactone via (23S,25R)-25-OHD₃ 26,23-lactol by incubation with vitamin D supplemented chick kidney homogenates. (Ref. 0124)			[0110] / [0113] / [0124] / [0125]
324		24,25,26-trihydroxyvitamin D₃ / 24,25,26-trihydroxycholecalciferol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19)-cholestatriene-3,24,25,26-tetrol	VVD0327	Sachiko Yamada	24,25,26-(OH)₃D₃	C₂₇H₄₄O₄	432.636									lmax (nm) 265 (Ref. 0100)			m/z 432 (12%, M⁺), 399 (3%, M⁺-H₂O-CH₃), 136 [100%, (A ring+C₆+C₇)⁺], 118 (74%, 136-H₂O); spectrum (Ref. 0100)			Isolated and identified from blood plasma of chicks given large doses of vitamin D₃. (Ref. 0100)					[0100]
325		(24R)-6,19-epidioxy-1a,24-dihydroxy-6,19-dihydrovitamin D₃ / (24R)-6,19-epidioxy-1a,24-di hydroxy-6,19-dihydrocholecalciferol	(7E)-(1S,3R,24R)-6,19-epidioxy-9,10-seco-5(10),7-cholestadiene-1,3,24-triol	VVD0328	Sachiko Yamada		C₂₇H₄₄O₅	448.635		Less polar epimer : Binding affinity for the vitamin D receptor in HL-60 cells : 1/800 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : 1/150 as active as 1,25-(OH)₂D₃. More polar epimer : Binding affinity for the vitamin D receptor in HL-60 cells : 1/800 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : 1/200 as active as 1,25-(OH)₂D₃. (Ref. 0339)										Less polar C(6)-epimer : m/z 430 (M⁺-H₂O), 412, 394, 379. More polar C(6)-epimer : m/z 430 (M⁺-H₂O), 412, 394, 379 (Ref. 0339)								[0339]
326		(6R)-6,19-epidioxy-1a,25-dihydroxy-6,19-dihydrovitamin D₃ / (6R)-6,19-epidioxy-1a,25-dihydroxy-6,19-dihydrocholecalciferol	(7E)-(1S,3R)-6,19-epidioxy-9,10-seco-5(10),7-cholestadiene-1,3,25-triol	VVD0329	Sachiko Yamada		C₂₇H₄₄O₅	448.635		Less polar epimer : Binding affinity for the vitamin D receptor in HL-60 cells : 1/800 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : 1/130 as active as 1,25-(OH)₂D₃. (Ref. 0339) More polar epimer : Binding affinity for the vitamin D receptor in HL-60 cells : 1/800 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : 1/200 as active as 1,25-(OH)₂D₃. (Ref. 0339)										Less polar C(6)-epimer : m/z 430 (M⁺-H₂O), 412, 394, 379. More polar C(6)-epimer : m/z 430 (M⁺-H₂O), 412, 394, 379 (Ref. 0339)								[0339]
327		(6R)-1a,25-dihydroxyvitamin D₃ 6,19-sulfur dioxide adduct / (6R)-1a,25-dihydroxycholecalciferol 6,19-sulfur dioxide adduct	(7E)-(1S,3R,6R)-6,19-epithio-9,10-seco-5(10),7-cholestadiene-1,3,25-triol S,S-dioxide	VVD0330	Sachiko Yamada	1a,25-(OH)₂D₃ 6R,19-sulfur dioxide adduct	C₂₇H₄₄O₅S	480.701											1-Methoxymethyl-3-t-butyldimethylsilyl-25-triethylsilyl derivative : ¹H-NMR (d, CDCl₃) 0.05 and 0.07 (each 3H, s, 2 Si-CH₃), 0.561(3H, s, 18-H), 0.564 (6H, q, J = 8.0 Hz, 3 CH₂CH₃), 0.88 (9H, s, Si-tBu), 0.95 (9H, t, J = 8.0 Hz, 3 CH₂CH₃), 1.19 (6H, s, 26- and 27-H), 3.39 (3H, s, OCH₂OCH₃), 3.67 and 3.96 (each 1H, m, 19-H), 4.13 (1H, m, 3-H), 4.22 (1H, m, 1-H), 4.60 and 4.73 (each 1H, d, J = 7.0 Hz, OCH₂OCH₃), 4.62 and 4.80 (each 1H, d, J = 10.1 Hz, 6- and 7-H) (Ref. 0333)	1-Methoxymethyl-3-t-butyldimethylsilyl-25-triethylsilyl derivative : m/z 688 (M⁺-SO₂, 28.6), 626 (30.2), 556 (57.7), 494 (65.7), 379 (12.3), 248 (100), 115 (15.9), 103 (20.2), 75 (29.2) (Ref. 0333)				From 1a,25-dihydroxyvitamin D₃ derivative by treatment with liquid sulfur dioxide. (Ref. 0267/0331/0333)				[0267] / [0331] / [0333]
328		(6S)-1a,25-dihydroxyvitamin D₃ 6,19-sulfur dioxide adduct / (6S)-1a,25-dihydroxycholecalciferol 6,19-sulfur dioxide adduct	(7E)-(1S,3R,6S)-6,19-epithio-9,10-seco-5(10),7-cholestadiene-1,3,25-triol S,S-dioxide	VVD0331	Sachiko Yamada	1a,25-(OH)₂D₃ 6S,19-sulfur dioxide adduct	C₂₇H₄₄O₅S	480.701											1-Methoxymethyl-3-t-butyldimethylsilyl-25-triethylsilyl derivative : ¹H-NMR (d, CDCl₃) 0.06 and 0.07 (each 3H, s, 2 Si-CH₃), 0.56 (6H, q, J = 8.0 Hz, 3 CH₂CH₃), 0.65 (3H, s, 18-H), 0.88 (9H, s, Si-tBu), 0.94 (9H, t, J = 8.0 Hz, 3 CH₂CH₃), 1.184 and 1.187 (each 3H, s, 26- and 27-H), 3.38 (3H, s, OCH₂OCH₃), 3.66 and 3.98 (each 1H, m, 19-H), 4.16 (1H, m, 3-H), 4.21 (1H, m, 1-H), 4.59 and 4.72 (each 1H, d, J = 7.1 Hz, OCH₂OCH₃), 4.65 and 4.72 (each 1H, d, J = 9.5 Hz, 6- and 7-H) (Ref. 0333)	1-Methoxymethyl-3-t-butyldimethylsilyl-25-triethylsilyl derivative : m/z 688 (M⁺-SO₂, 8.4), 626 (16.8), 556 (25.4), 512 (26.7), 494 (49.2), 380 (11.3), 248 (100), 134 (17.2), 103 (18.7), 75 (41.1) (Ref. 0333)				From 1a,25-dihydroxyvitamin D₃ derivative by treatment with liquid sulfur dioxide. (Ref. 0267/0331/0333)				[0267] / [0331] / [0333]
329		(6RS,24R)-24,25-dihydroxyvitamin D₃ 6,19-sulfur dioxide adduct / (6RS,24R)-24,25-dihydroxycholecalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6RS,24R)-6,19-epithio-9,10-seco-5(10),7-cholestadiene-3,24,25-triol S,S-dioxide	VVD0332	Sachiko Yamada	24R,25-(OH)₂D₃ 6RS,19-sulfur dioxide adduct	C₂₇H₄₄O₅S	480.701										(KBr) 3500, 2980, 1310, 1150, 1115 cm^-¹ (Ref. 0332)	¹H-NMR (d, CDCl₃) 0.58 and 0.66 (3H, s, 18-H), 0.96 (3H, d, J = 5.0 Hz, 21-H), 1.17 and 1.22 (each 3H, s, 26- and 27-H), 3.33 (1H, m, 24-H), 3.67 (2H, m, 19-H), 4.05 (1H, m, 3-H), 4.70 (2H, m, 6- and 7-H) (Ref. 0332)	m/z 416 (M⁺-SO₂, 70), 398 (55), 380 (28), 271 (56), 253 (76), 176 (50), 159 (71), 147 (71), 118 (72), 105 (100) (Ref. 0332)				From 24R,25-dihydroxyvitamin D₃ by treatment with liquid sulfur dioxide. (Ref. 0332)				[0332]
330		(23S,25R)-1a,23,25,26-tetrahydroxyvitamin D₃ / (23S,25R)-1a,23,25,26-tetrahydroxycholecalciferol	(5Z,7E)-(1S,3R,23S,25R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,23,25,26-pentol	VVD0333	Sachiko Yamada	1a,23S,25R,26-(OH)₄D₃	C₂₇H₄₄O₅	448.635		Affinity for the chick intestinal receptor : 1/216 as active as 1,25-(OH)₂D₃. (Ref. 0242)																		[0242]
331		dihydrotachysterol₃ / (5E)-(10S)-10,19-dihydrovitamin D₃ / (5E)-(10S)-10,19-dihydrocholecalciferol	(5E,7E)-(3S,10S)-9,10-seco-5,7-cholestatrien-3-ol	VVD0334	Sachiko Yamada	DHT₃	C₂₇H₄₆O	386.654											¹H-NMR (d, CDCl₃, 300MHz) (Ref. 0004)									[0004]
332		toxisterol₃ R1 / 6,19-dihydrovitamin D₃ / 6,19-dihydrocholecalciferol	(7E)-(3S)-9,10-seco-5(10),7-cholestadien-3-ol	VVD0335	Sachiko Yamada	6,19-dihydro-D₃	C₂₇H₄₆O	386.654							Dinitrobenzoate : [a] +34 (in CHCl₃) (Ref. 0011)		lmax (nm) (emax) (diethyl ether) no absorption maximum at l > 210 (Ref. 0011)	(Neat) 3330, 3020, 2940, 2920, 2860, 1660, 1470, 1380, 1370, 1040, 675 cm ^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.93 (1H, m), 2.80 (1H, d, J = 7 Hz), 4.80 (1H, t, J = 7 Hz), 0.55 (3H, s), 1.68 (3H, s), 0.95 (3H, d, J = 6 Hz), 0.88 (6H, d, J = 6 Hz) (Ref. 0011)	m/z 386 (M⁺) (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzene/acetone] 0.80 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 1.56 (Ref. 0011)		Obtained as one of overirradiation products of 7-dehydrocholesterol in EtOH or MeOH. (Ref. 0011)				[0011]
333		1-methyl-1,25-dihydroxy-4-nor-2,3-secovitamin D₃ / 1-methyl-1,25-dihydroxy-4-nor-2,3-secocholecalciferol	(5E,7E)-1-methyl-A-nor-(2,3)-(9,10)-diseco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0336	Sachiko Yamada		C₂₇H₄₆O₃	418.652
334		26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxyvitamin D₂ / 26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxyergocalciferol	(5Z,7E,22E)-(1S,3R)-26,26,26,27,27,27-hexadeuterio-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0337	Sachiko Yamada	1a,25-(OH)₂-[26,26,26,27,27,27-²H]D₂	C₂₈H₃₈D₆O₃	434.600
335		26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxy-24-epivitamin D₂ / 26,26,26,27,27,27-hexadeuterio-1a,25-dihydroxy-24-epiergocalciferol	(5Z,7E,22E)-(1S,3R,24R)-26,26,26,27,27,27-hexadeuterio-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0338	Sachiko Yamada	1a,25-(OH)₂-24-epi-[26,26,26,27,27,27-²H]D₂	C₂₈H₃₈D₆O₃	434.600
336		26,26,26,27,27,27-hexafluoro-25-hydroxyvitamin D₂ / 26,26,26,27,27,27-hexafluoro-25-hydroxyergocalciferol	(5E,7E,22E)-(3S)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19),22-ergostatetraene-3,25-diol	VVD0339	Sachiko Yamada	26,27-F₆-25-OHD₂	C₂₈H₃₈F₆O₂	520.591		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 1.3 10^-⁷ M, 1.2 10^-⁷ M and 1.3 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)																		[0228]
337		26,26,26,27,27,27-hexafluoro-25-hydroxyvitamin D₂ / 26,26,26,27,27,27-hexafluoro-25-hydroxyergocalciferol	(5Z,7E,22E)-(3S)-26,26,26,27,27,27-hexafluoro-9,10-seco-5,7,10(19),22-ergostatetraene-3,25-diol	VVD0340	Sachiko Yamada		C₂₈H₃₈F₆O₂	520.591														HPLC of two 24-epimers. (Ref. 0197)		Two 24-epimers were synthesized starting from C(22) steroid aldehyde having 5,7-diene structure. and side chain fragment with phenylsulfonyl group. (Ref. 0197)				[0197]
338		1a-hydroxy-22-(3-hydroxyphenyl)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-22-(3-hydroxyphenyl)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-22-(3-hydroxyphenyl)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0341	Sachiko Yamada	1a-OH-22-(3-hydroxyphenyl)-23,24,25,26,27-pentanor-D₃	C₂₈H₃₈O₃	422.600		(% of 1,25-(OH)₂D₃ effect) Intestinal calcium absorption: 0.28; bone calcium mobilization: 1.0; affinity for chick intestinal receptor, HL-60 cell receptor and serum vitamin D binding protein: 28, 26 and 980, respectively; Inhibition of 1a-hydroxylase activity: 97; differentiation of HL-60 cells: 60. (Ref. 0364)														By coupling of enol trifltes of modified CD steroid fragment with the vitamin D A-ring enyne. (Ref. 0364)				[0364]
339		1a-hydroxy-22-(4-hydroxyphenyl)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-22-(4-hydroxyphenyl)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-22-(4-hydroxyphenyl)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0342	Sachiko Yamada	1a-OH-22-(4-hydroxyphenyl)-23,24,25,26,27-pentanor-D₃	C₂₈H₃₈O₃	422.600		(% of 1,25-(OH)₂D₃ effect) Intestinal calcium absorption: 0.04; bone calcium mobilization: 0.08; affinity for chick intestinal receptor, HL-60 cell receptor and serum vitamin D binding protein: 5, 8 and 1980, respectively; Inhibition of 1a-hydroxylase activity: 104; differentiation of HL-60 cells: 15. (Ref. 0364)														By coupling of enol trifltes of modified CD steroid fragment with the vitamin D A-ring enyne. (Ref. 0364)				[0364]
340		(22E,24E,26E)-1a,26b-dihydroxy-22,23,24,25,26,26a-hexadehydro-26a,26b-dihomo-27-norvitamin D₃ / (22E,24E,26E)-1a,26b-dihydroxy-22,23,24,25,26,26a-hexadehydro-26a,26b-dihomo-27-norcholecalciferol	(5Z,7E,22E,24E,26E)-(1S,3R)-26a,26b-dihomo-27-nor-9,10-seco-5,7,10(19),22,24,26(26a)-cholestahexaene-1,3,26b-triol	VVD0343	Sachiko Yamada	(22E,24E,26E)-22,23,24,25,26,26a-hexadehydro-26a,26b-dihomo-27-nor-1a,26b-(OH)₂D₃	C₂₈H₄₀O₃	424.615		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, < 80% ; Induction of differentiation of U 937 cells, 100%. (Ref. 0285)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction, photoisomerization and deprotection. (Ref. 0285)				[0285]
341		(24RS)-28,28,28-trifluoro-25-hydroxyvitamin D₂ / (24RS)-28,28,28-trifluoro-25-hydroxyergocalciferol	(5Z,7E,22E)-(3S,24RS)-28,28,28-trifluoro-9,10-seco-5,7,10(19),22-ergostatetraene-3,25-diol	VVD0344	Sachiko Yamada		C₂₈H₄₁F₃O₂	466.619									(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0197)			m/z 466, 433, 271, 253, 136, 118, 591 (Ref. 0197)				From C(22) steroid aldehyde having 5,7-diene structure. and side chain fragment with phenylsulfonyl group. The side chain fragment was prepared from 3,3,3-trifluoro-1-phenylsulfonyl-1-propene (Ref. 0197)				[0197]
342		calicoferol D	(22E)-(8S)-3-hydroxy-22-methyl-9,10-seco-1,3,5(10),22-cholestatetraen-9-one	VVD0345	Sachiko Yamada	calicoferol D	C₂₈H₄₂O₂	410.632		Exhibits potent activity against Herpes simplex viruses I and II and polio virus. (Ref. 0317)													Isolated from a gorgonian of the genus Muricella. (Ref. 0320)					[0317] / [0320]
343		(22E,24E)-1a,25-dihydroxy-22,23,24,24a-tetradehydro-24a-homovitamin D₃ / (22E,24E)-1a,25-dihydroxy-22,23,24,24a-tetradehydro-24a-homocholecalciferol	(5Z,7E,22E,24E)-(1S,3R)-24a-homo-9,10-seco-5,7,10(19),22,24-cholestapentaene-1,25-diol	VVD0346	Sachiko Yamada		C₂₈H₄₂O₃	426.631		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 140% ; Induction of differentiation of U 937 cells, 600% ; Calciuric activity, 70%. (Ref. 0288)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by Wittig reaction followed by Grignard reaction, photoisomerization and deprotection. (Ref. 0288)				[0288]
344		(22S)-1a,22,25-trihydroxy-23,24-tetradehydro-24a-homo-20-epivitamin D₃ / (22S)-1a,22,25-trihydroxy-23,24-tetradehydro-24a-homo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0347	Sachiko Yamada	23,24-tetradehydro-24a-homo-20-epi-1a,22S,25-(OH)₃D₃	C₂₈H₄₂O₄	442.631		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 10; Inhibition of proliferation, 17 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.007. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
345		(24R)-24-fluoro-1a,25-dihydroxyvitamin D₂ / (24R)-24-fluoro-1a,25-dihydroxyergocalciferol	(5Z,7E,22E)-(1S,3R,24R)-24-fluoro-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0348	Sachiko Yamada	24-F-1a,25-(OH)₂D₂	C₂₈H₄₃FO₃	446.638		Chick intestinal VDR binding : 100. HL-60 cell antiproliferative activity : 100. HL-60 cell differentiation (phagocytosis) : 100. HL-60 cell differentiation (NBT reduction) : 100. DBP binding : 50. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) The analogue was as active as 1a,25-dihydroxyvitamin D₃ and 1a,25-dihydroxyvitamin D₂ in both in vivo and in vitro bone calcium mobilization test. The analogue was also shown to stimulate intestinal calcium transport as much as 1a,25-dihydroxyvitamin D₃ and 1a,25-dihydroxyvitamin D₂. (Ref. 0250)					[a]_D +0.4 (c = 0.01 in EtOH) (Ref. 0249)		(EtOH) lmax (nm) (emax) 264 (18800) (Ref. 0249)	(CHCl₃) 3420, 1576, 1541, 1047 cm^-¹ (Ref. 0249)	¹H-NMR (d, CDCl₃, 400 MHz) 0.57 (3H, s), 1.06 (3H, d, J = 6.4 Hz), 1.23 (3H, s), 1.26 (3H, s), 1.43 (3H, d, J = 22.8 Hz), 2.32 (1H, dd, J = 6.4, 13.8 Hz), 2.60 (1H, dd, J = 3.2, 13.8 Hz), 2.83 (1H, dd, J = 3.9, 12.1 Hz), 4.19-4.26 (1H, m), 4.42-4.46 (1H, m), 5.00 (1H, s), 5.32 (1H, t, J = 1.5 Hz), 5.55 (1H, dd, J = 7.2, 15.3 Hz ), 5.60 (1H, t, J = 15.3 Hz), 6.02 (1H, d, J = 11.1 Hz), 6.38 (1H, d, J = 11.1 Hz) (Ref. 0249)	m/z 426 (M⁺-HF), 408 (M⁺-HF-H₂O), 390 (M⁺-HF-2H₂O), 372 (M⁺-HF-3H₂O) (Ref. 0249)		HPLC : Lichrosorb RP-18, 10 250 mm ; mobile phase, H₂O-MeCN (55 : 45) ; 4 ml/min ; tR = 17.6 min (Ref. 0249)		Starting with 1a,3b-bis[(tert-butyldimethylsilyl)oxy]-24-norchol-5,7-dien-23-al, a mixture of 24-Fluoro-1a,25-dihydroxyvitamin D₂ and its 24-Epimer was obteined in 3 % overall yield. (Ref. 0249)				[0249] / [0250]
346		(24S)-24-fluoro-1a,25-dihydroxyvitamin D₂ / (24S)-24-fluoro-1a,25-dihydroxyergocalciferol	(5Z,7E,22E)-(1S,3R,24S)-24-fluoro-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0349	Sachiko Yamada	24-epi-24-F-1a,25-(OH)₂D₂	C₂₈H₄₃FO₃	446.638		Chick intestinal VDR binding : 10. HL-60 cell antiproliferative activity : 100. HL-60 cell differentiation (phagocytosis) : 100. HL-60 cell differentiation (NBT reduction) : 100. DBP binding : 10. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) The analogue showed weak response in both in vivo and in vitro bone calcium mobilization test. The analogue had weak activity to stimulate intestinal calcium transport. (Ref. 0250)					[a]_D +1.6 (c = 0.03 in EtOH) (Ref. 0249)		(EtOH) lmax (nm) (emax) 264 (18900) (Ref. 0249)	(CHCl₃) 3420, 1576, 1541, 1047 cm^-¹ (Ref. 0249)	¹H-NMR (d, CDCl₃, 400MHz) 0.57 (3H, s), 1.05 (3H, d, J = 6.7 Hz), 1.23 (3H, s), 1.26 (3H, s), 1.43 (3H, d, J = 22.8 Hz), 2.32 (1H, dd, J = 6.4, 13.9 Hz), 2.60 (1H, dd, J = 3.1, 13.9 Hz), 2.83 (1H, dd, J = 3.8, 12.1 Hz), 4.19-4.26 (1H, m), 4.42-4.45 (1H, m), 5.00 (1H, s), 5.32 (1H, t, J = 1.6 Hz), 5.54 (1H, t, J = 16.0 Hz ), 5.61 (1H, dd, J = 8.3, 16.0 Hz), 6.01 (1H, d, J = 11.3 Hz), 6.38 (1H, d, J = 11.3 Hz) (Ref. 0249)	m/z 426 (M⁺-HF), 408 (M⁺-HF-H₂O), 390 (M⁺-HF-2H₂O), 372 (M⁺-HF-3H₂O) (Ref. 0249)		HPLC : Lichrosorb RP-18, 10 250 mm ; mobile phase, H₂O-MeCN (55 : 45) ; 4 ml/min ; tR = 18.2 min (Ref. 0249)		Starting with 1a,3b-bis[(tert-butyldimethylsilyl)oxy]-24-norchol-5,7-dien-23-al, a mixture of 24-Fluoro-1a,25-dihydroxyvitamin D₂ and its 24-Epimer was obteined in 3 % overall yield. (Ref. 0249)				[0249] / [0250]
347		24,24-difluoro-1a,25-dihydroxy-24a-homovitamin D₃ / 24,24-difluoro-1a,25-dihydroxy-24a-homocholecalciferol	(5Z,7E)-(1S,3R)-24,24-difluoro-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-1,3,25-triol	VVD0350	Sachiko Yamada	24,24-difluoro-24-homo-1a,25-(OH)₂D₃	C₂₈H₄₄F₂O₃	466.644		Binding affinity for chick intestinal receptor : 28% of that of 1,25-(OH)₂D₃ ; Binding affinity for rat serum vitamin D binding protein : 15% of that of 1,25-(OH)₂D₃. Potency of the title compound in ⁴⁵Ca release from neonatal mouse parietal bones in culture : significantly higher than that of 1,25-(OH)₂D₃. Potency in the formation of osteoclast-like cells : 100 times of that of 1,25-(OH)₂D₃. Potency in bone calcium mobilization in vitamin D deficient rats : significantly lower than that of 1,25-(OH)₂D₃. Potency in intestinal Ca transport response in situ : similar to 1,25-(OH)₂D₃. (Ref. 0246)							lmax (nm) 265, lmin (nm) 228 (Ref. 0245)			m/z 466 (M⁺), 448, 430, 415, 407, 287, 269, 251, 134, 43 (Ref. 0245)				The desired provitamin D was synthesized from 1a-hydroxy-5-cholen-24-ol derivative by introducing the desired side chain and a double bond to the 7-position. The provitamin D was converted to the title compound by photochemical method. (Ref. 0245)				[0245] / [0246]
348		vitamin D₂ / ergocalciferol / ercalciol	(5Z,7E,22E)-(3S)-9,10-seco-5,7,10(19),22-ergostatetraen-3-ol	VVD0351	Sachiko Yamada	D₂	C₂₈H₄₄O	396.648		Effect of vitamins D₂ and D₃ on serum calcium and phosphorus and on bone ash in rachitic chicks was evaluated. Dose-response curves based on the 3 parameters indicated a flatter response to vitamin D₂ than vitamin D₃. When based on CD50 (curative dose giving a response midway between animals on rachitogenic and standard chick diets), the vitamin D₃ to D₂ efficacy ratio was estimated at about 8:1 to 11:1. (Ref. 0273)	115-116 C (Ref. 0139)				[a]_D +48.2 (in CHCl₃), +85 C (in benzene) (Ref. 0139)		lmax (nm) (emax) 265 (18300) (Ref. 0139)	887 cm^-¹ (Ref. 0139)	¹H-NMR (d, CCl₄, 100MHz) 0.57 (3 H, s, 18-CH₃), 2.24 (1 H, dd, J = 13 and 7.4 Hz, 4-H), 2.51 (1 H, dd, J = 13 and 3.7 Hz, 4-H), 2.80 (1 H, dd, J = 10.5 and 2.5 Hz, 14-H), 3.82 (1 H, tt, J = 7.4 and 3.7 Hz, 3-H), 4.73 (1 H, d, J = 2.4 Hz, 19-H), 4.97 (1 H, dt, J = 2.4 and 1.0 Hz, 19-H), 5.17 (2 H, m, 22- and 23-H), 5.94 (1 H, dd, J = 11.3 and 0.8 Hz, 7-H), 6.14 (1 H, d, J = 11.3 Hz, 6-H) (Ref. 0140) ¹³C-NMR (d, CCl₄, 22.6MHz) 32.0 (1), 35.3 (2), 69.2 (3), 46.2 (4), 135.4 (5), 122.4 (6), 117.8 (7), 142.2 (8), 29.1 (9),* 145.3 (10), 22.4 (11), 40.4 (12), 46.0 (13), 56.5 (14), 23.7 (15), 27.8 (16),* 56.5 (17), 12.3 (18), 112.5 (19), 40.4 (20), 19.7 (21), 132.0 (22), 135.7 (23), 42.8 (24), 33.2 (25), 20.0 (26), 21.1 (27), 17.7 (28) (Ref. 0003) * The assignments may be interchanged.					From ergosterol by photochemical followed by thermal isomerization. (Ref. 0272/0290) By convergent method using Wittig-Horner coupling of the A-ring fragment with Windaus-Grundmann ketone. (Ref. 0286)	Metabolism of vitamin D₂ is similar to that of vitamin D₃ : Vitamin D₂ is first metabolized to 25-hydroxyvitamin D₂ (Ref. 0263) and then to 1a,25-dihydroxyvitamin D₂. (Ref. 0146) 25-Hydroxyvitamin D₂ is metabolized to 24R,25-dihydroxyvitamin D₂ in normocalcemic and normophosphatemic animals receiving adequate intakes of vitamin D. (Ref. 0150/0264)			[0003] / [0139] / [0140] / [0146] / [0150] / [0263] / [0264] / [0272] / [0273] / [0286] / [0290]
349		(5E)-vitamin D₂ / 5,6-trans-vitamin D₂ / (5E)-ergocalciferol / (5E)-ercalciol	(5E,7E,22E)-(3S)-9,10-seco-5,7,10(19),22-ergostatetraen-3-ol	VVD0352	Sachiko Yamada	(5E)-D₂ / 5,6-trans-D₂	C₂₈H₄₄O	396.648			99-101 C (Ref. 0139)				[a]_D +223 (in benzene) (Ref. 0139)		E¹^% ₁_c_m (ether) 273 mn, 580 (Ref. 0141) lmax (nm) (emax) 272-273 (2400) (Ref. 0139)	887 cm^-¹ (Ref. 0139)						Treatment of vitamin D₂ in petroleum ether with I₂. (Ref. 0141)				[0139] / [0141]
350		previtamin D₂ / preergocalciferol	(6Z,24E)-(3S)-9,10-seco-5(10),6,8,22-ergostatetraen-3-ol	VVD0353	Sachiko Yamada	pre-D₂	C₂₈H₄₄O	396.648			101-102 C (Ref. 0139)				[a]_D +30 (in benzene) (Ref. 0139)		lmax (nm) (emax) 262 (9000) (Ref. 0139)							From ergosterol by ultraviolet light irradiation. (Ref. 0361)				[0139] / [0361]
351		tachysterol₂	(6E,22E)-(3S)-9,10-seco-5(10),6,8,22-ergostatetraen-3-ol	VVD0354	Sachiko Yamada	tachysterol₂	C₂₈H₄₄O	396.648			4-Methyl-3, 5-dinitro-benzoate : 154-155 C (Ref. 0139)				[a]_D -70 (Ref. 0139)		lmax (nm) (emax) 281 (24600) (Ref. 0139)	957 cm^-¹ (Ref. 0139)						From ergosterol by ultraviolet light irradiation. (Ref. 0361)				[0139] / [0361]
352		isotachysterol₂	(6E,22E)-(3S)-9,10-seco-5(10),6,8(14),22-ergostatetraen-3-ol	VVD0355	Sachiko Yamada	isotachysterol₂	C₂₈H₄₄O	396.648			4-methyl-3,5-dinitro-benzoate : 126-127.5 C (Ref. 0142) 125-126 C (Ref. 0362)				[a]_D -71 (in CHCl₃) (Ref. 0139) 4-methyl-3,5-dinitro-benzoate : [a]_D +55.6 (Ref. 0142)		lmax (nm) (e) 280 (31300), 290 (40800), 302 (30650); spectrum. (Ref. 0142)	955 cm^-¹ (Ref. 0139) (KBr) 3360, 1640, 1590, 1040, 972, 955 cm^-¹ (Ref. 0362)						Treatment of vitamin D₂ in benzene with BF₃-Et₂O. (Ref. 0142)				[0139] / [0142] / [0362]
353		(5Z)-isovitamin D₂ / 5,6-cis-isovitamin D₂ / (5Z)-isoergocalciferol / 5,6-cis-isoergocalciferol	(5Z,7E,22E)-(3S)-9,10-seco-1(10),5,7,22-ergostatetraen-3-ol	VVD0356	Sachiko Yamada	(5Z)-iso-D₂	C₂₈H₄₄O	396.648									lmax (isopropanol) nm (log e): 276 sh (4.51), 286.5 (4.58), 298 sh (4.42); spectrum. (Ref. 0362)	(KBr) 3380, 1635, 1582, 1045, 968, 825, 794, cm^-¹; spectrum. (Ref. 0362)	¹H-NMR (d, CDCl₃) 0.57 (3 H, s), 0.83 (6 H, d, J = 5.5 Hz), 0.93 (3 H, d, J = 6 Hz), 1.02 (3 H, d, J = 6 Hz), 1.75 (1 H, br s), 2.07 (3 H, m), 4.03 (1 H, m), 5.10 (2 H, n), 5.45 (1 H, m), 6.20 (2 H, s); spectrum. (Ref. 0362)		CD [c = 0.0134 (310-230 nm), isooctane] [q] (nm): 0 (310), -9800 (275), 0 (230); spectrum. (Ref. 0362)			From vitamin D₂ by treatment with CaHPO₄. (Ref. 0362)				[0362]
354		(5E)-isovitamin D₂ / (5E)-isoergocalciferol	(5E,7E,22E)-(3S)-9,10-seco-1(10),5,7,22-ergostatetraen 3-ol	VVD0357	Sachiko Yamada	(5E)-iso-D₂	C₂₈H₄₄O	396.648			108-110 C (Ref. 0139)				[a]_D +108 (in CHCl₃) (Ref. 0139)		lmax (nm) (e) 278 (33600), 288 (41800), 300 (30500) (Ref. 0142) spectrum (Ref. 0362)	(KBr) 3290, 1637, 1587, 1040, 970, 835, 792 cm^-¹; spectrum. (Ref. 0362)	¹H-NMR (d, CDCl₃) 0.55 (3 H, s), 0.82 (6 H, d, J = 5.5 Hz), 0.93 (3 H, d, J = 6 Hz), 1.02 (3 H, d, J = 6 Hz), 1.87 (3 H, br s), 3.93 (1					Pyrolytic dehydration of (5E)-10-hydroxy-10, 19-dihydrovitamin D₂. (Ref. 0142) By treatment of vitamin D₂ with BF₃-etherate in benzene. (Ref. 0362)				[0139] / [0142] / [0362]
355		provitamin D₂ / ergosterol / proergocalciferol	(22E)-(3S)-5,7,22-ergostatrien-3-ol	VVD0358	Sachiko Yamada	pro-D₂	C₂₈H₄₄O	396.648			168 (Nearly anhydrous), 175 (Semihydrous), 183 (Very hydrous) C (Ref. 0189)				[a] -132 (in CHCl₃) (Ref. 0189)		lmax (nm) (emax) 262.0 5 (6750), 271.0 5 (9700), 281.0 5 (10050), 293.0 10 (5800) (Ref. 0187)						Isolation from yeast. (Ref. 0233)					[0187] / [0189] / [0233]
356		lumisterol₂	(22E)-(3S)-9b,10a-ergosta-5,7,22-trien-3-ol	VVD0359	Sachiko Yamada	lumisterol₂	C₂₈H₄₄O	396.648			118-119 C (Ref. 0008)				[a] +186 (in 2% Aceton) (Ref. 0008)		lmax (nm) (e) 272 (9450) (Ref. 0008)							From ergosterol by ultraviolet light irradiation. (Ref. 0361)				[0008] / [0361]
357		pyrovitamin D₂ / pyroergocalciferol	(22E)-(3S)-10a-ergosta-5,7,22-trien-3-ol	VVD0360	Sachiko Yamada	pyro-D₂	C₂₈H₄₄O	396.648			93-94 C (Ref. 0008)				[a] +495 (in 0.25% EtOH) (Ref. 0008)		lmax (nm) (e) 274 (10250) (Ref. 0008)							By heating vitamin D₂ at 180 C (Ref. 0008).				[0008]
358		isopyrovitamin D₂ / isopyroergocalciferol	(22E)-(3S)-9b-ergosta-5,7,22-trien-3-ol	VVD0361	Sachiko Yamada	isopyro-D₂	C₂₈H₄₄O	396.648			112-116 C (Ref. 0008)				[a] +320 (in 0.5% CHCl₃) (Ref. 0008)		lmax (nm) (emax) 274 (10350) (Ref. 0008)							By heating vitamin D₂ at 180 C (Ref. 0008).				[0008]
359		photopyrovitamin D₂ / photopyroergocalciferol	(3S,5R,8R)-5,8-cyclo-10a-ergost-6-en-3-ol	VVD0362	Sachiko Yamada	photopyro-D₂	C₂₈H₄₄O	396.648			104-105 C (Ref. 0010)				[a] +52 (in CHCl₃) (Ref. 0010)			970, 750 cm^-¹ (Ref. 0010)						By ultraviolet light irradiation of pyrovitamin D₂. (Ref. 0010)				[0010]
360		photoisopyrovitamin D₂ / photoisopyroergocalciferol	(3S,5S,8S)-5,8-cyclo-9b-ergost-6-en-3-ol	VVD0363	Sachiko Yamada	photoisopyro-D₂	C₂₈H₄₄O	396.648			81-82 C (Ref. 0010)				[a] -11.5 (in CHCl₃) (Ref. 0010)			970, 748 cm^-¹(Ref. 0010)						By ultraviolet light irradiation of isopyrovitamin D₂. (Ref. 0010)				[0010]
361		suprasterol₂ I	(22E)-(3S,6R,7R,8S)-(6,8)-(7,19)-dicyclo-9,10-seco-5(10),22-ergostadien-3-ol	VVD0364	Sachiko Yamada	suprasterol₂ I	C₂₈H₄₄O	396.648			Dinitrobenzoate : 146-147 C (Ref. 0143)				[a] -53.2 (CHCl₃) (Ref. 0143)		lmax (nm) 210 (Ref. 0143)	(CCl₄) 3625 (3-OH), 1030 (3C-OH), 968 (22, 23CH=CH) cm^-¹ (Ref. 0143)	¹H-NMR (d, CDCl₃, 60MHz) 0.78 (s, 18-CH₃), 0.83 (d, J = 6.1 Hz, 26- and 27-CH₃), 0.92 (d, J = 5.5 Hz, 21- or 28-CH₃), 1.03 (d, J = 6.1Hz, 21- or 28-CH₃), 3.96 (1H, m, 3-CH), 5.22 (2H, m, 22- , 23-CH=CH) (Ref. 0143)	m/z 396 (M⁺), 378 (M⁺-H₂O), 271 (M⁺-side chain), 253 (M⁺-side chain-H₂O), 136, 118 (Ref. 0143)				Irradiation of vitamin D₂ in EtOH by high pressure mercury lamp. (Ref. 0143)				[0143]
362		suprasterol₂ II	(22E)-(3S,6R,7R,8S)-(6,8)-(7,19)-dicyclo-9,10-seco-5(10),22-ergostadien-3-ol	VVD0365	Sachiko Yamada	suprasterol₂ II	C₂₈H₄₄O	396.648			110 C (Ref. 0143)				[a] +47.8 (in CHCl₃) (Ref. 0143)		lmax (nm) 210 (Ref. 0143)	(CCl₄) 3650 (3-OH), 1030 (3C-OH), 968 (22, 23CH=CH) cm^-¹ (Ref. 0143)	¹H-NMR (d, CDCl₃, 60MHz) 0.78 (s, 18-CH₃), 0.83 (d, J = 5.5 Hz, 26- and 27-CH₃), 0.92 (d, J = 4.5 Hz, 21- or 28-CH₃), 1.02 (d, J = 6.3 Hz, 21- or 28-CH₃), 1.52 (1H, s, 3-OH), 4.03 (1H, m 3-CH), 5.22 (2H, m , 22-, 23-CH=CH) (Ref. 0143)	m/z 396 (M⁺), 378 (M⁺-H₂O), 271 (M⁺-side chain), 253 (M⁺-side chain-H₂O), 136 , 118 (Ref. 0143)	X-ray analysis : 4-ido-5nitrobenzoate derivative (Ref. 0144)			Irradiation of vitamin D₂ in EtOH by high pressure mercury lamp. (Ref. 0143)				[0143] / [0144]
363		1a-hydroxyvitamin D₂ / 1a-hydroxyergocalciferol	(5Z,7E,22E)-(1S,3R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3-diol	VVD0366	Sachiko Yamada	1a-OHD₂	C₂₈H₄₄O₂	412.648		Intestinal calcium transport and bone mineral mobilization. (Ref. 0173) HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity and nonspecific acid esterase activity are 5.8 10^-⁷ M, 5.8 10^-⁷ M and 6.0 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)							(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0174)		¹H-NMR (d, CDCl₃, 90MHz) 6.40 and 6.00 (2H, AB quartet, J = 12 Hz, 6-, 7-C), 5.32, 5.00 (2H, narrow multiplets, 19-C), 5.20 (2H, m, 22-, 23-C), 4.40 (1H, m, 1-C), 4.20 (1H, m, 3-C), 0.55 (3H, s, 18-C) (Ref. 0174)	m/z 412 (M⁺, 24), 394 (19), 376 (10), 287 (12), 269 (15), 251 (14), 152 (35), 135 (71), 134 (100) (Ref. 0174)				From ergosterol via epoxidation of 1,4,6-trien-3-one derivative followed by reductive deconjugation as the key step. (Ref. 0173)				[0173] / [0174] / [0228]
364		24-hydroxyvitamin D₂ / 24-hydroxyergocalciferol	(5Z,7E,22E)-(3S)-9,10-seco-5,7,10(19),22-ergostatetraene-3,24-diol	VVD0367	Sachiko Yamada	24S-OHD₂	C₂₈H₄₄O₂	412.648												m/z 412 (M⁺), 379, 369, 271, 253, 136, 118 (spectrum); bisTMS ether m/z 556 (M⁺), 513, 423, 333, 253, 208. (Ref. 0264)		HPLC in compared with 25-OHD₂: (Ref. 0264)	Isolation and identification from blood of rats: (Ref. 0264)					[0264]
365		25-hydroxyvitamin D₂ / 25-hydroxyergocalciferol	(5Z,7E,22E)-(3S)-9,10-seco-5,7,10(19),22-ergostatetraene-3,25-diol	VVD0368	Sachiko Yamada	25-OHD₂	C₂₈H₄₄O₂	412.648		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 3.8 10^-⁷ M, 4.6 10^-⁷ M and 3.4 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)					[a] +56.8 (c = 0.2 in EtOH) (Ref. 0232)		lmax (nm) (e) 265 (17950) (Ref. 0232)	3401 (OH), 1645, 1631 (C=C), 971 cm^-¹ (trans C=C) (Ref. 0232)	¹H-NMR (d, CDCl₃) 0.56 (3 H, s), 0.99 (3 H, d, J = 7.5 Hz), 1.03 (3 H, d, J = 6.5 Hz), 1.13 (3 H, s), 1.16 (3 H, s), 3.95 (1 H, m), 4.81 (1 H, d, J = 2 Hz), 5.03 (1 H, s), 5.33 (2 H, m), 6.01 (1 H, d, J = 11 Hz), 6.23 (1 H, d, J = 11 Hz) (Ref. 0363) . ¹H-NMR (d, CDCl₃) 0.57 (s, 18-H), 1.00 (d, J = 7 Hz, 28-H), 1.04 (d, J = 7 Hz, 21-H), 1.15 and 1.17 (2 s, 26- and 27-H), 3.95 (m, 1H, 3a-H), 4.82 and 5.05 (2 narrow m, 2 1H, 19(Z)- and 19(E)-H), 5.23-5.43 (m, 2H, 22- and 23-H), 6.05 and 6.22 (2 d, J = 11 Hz, 2 1H, 7- and 6-H) (Ref. 0232)	m/z (relative intensity) 412 (M⁺, 63), 394 (M⁺-H₂O, 10), 379 (M⁺-H₂O-Me, 23), 271 (M⁺-side chain, 37), 253 (M⁺-side chain-H₂O, 43), 136 (100), 118 (86), 59 (99) (Ref. 0232/0363)				Stereoselective synthesis from C(22) steroid aldehyde with 5,7-diene function and chiral side chain fragment which was synthesized enatiospecifically from prenol by Sharpless oxidation as key step. (Ref. 0363) Synthesis of epimeric isomers at C(24) from C(22) steroid aldehyde involving separation of the epimers by HPLC. (Ref. 0232)				[0228] / [0232] / [0363]
366		(22E)-(25R)-25-hydroxy-26-methyl-22,23-didehydrovitamin D₃ / (22E)-(25R)-25-hydroxy-26-methyl-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(3S,25R)-26-methyl-9,10-seco-5,7,10(19),22-cholestatetraene-3,25-diol	VVD0369	Sachiko Yamada	(22E)-26-methyl-22,23-didehydro-25R-OHD₃	C₂₈H₄₄O₂	412.648									(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0307)		¹H-NMR (d, CDCl₃, 500MHz) 0.67 (3H, s, 18-H), 0.90 (3H, t, J = 7.0 Hz, 26-CH₃), 1.03 (3H, d, J = 6.0 Hz, 21-H), 1.13 (3H, s, 27-H), 3.55 (1H, m, 3-H), 4.81 and 5.05 (2H, each br s, 19-H), 5.38 (2H, m, 22- and 23-H), 6.03 (1H, d, J = 11.5 Hz, 7-H), 6.24 (1H, d, J = 11.5 Hz, 6-H) (Ref. 0307)	m/z 412 (M⁺), 394 (M⁺-H₂O), 379, 340, 271, 253, 211, 136 (base peak), 118, 73 (Ref. 0307)				From 25-hydroxy-5,22-cholestadien-26-oic acid derivative via methylation of 25,26-epoxide as key step. Separation of 25-epimers was achieved via a chiral amide derivative of the starting 26-carboxylic acid. (Ref. 0307)				[0307]
367		(22E)-(25S)-25-hydroxy-26-methyl-22,23-didehydrovitamin D₃ / (22E)-(25S)-25-hydroxy-26-methyl-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(3S,25S)-26-methyl-9,10-seco-5,7,10(19),22-cholestatetraene-3,25-diol	VVD0370	Sachiko Yamada	(22E)-26-methyl-22,23-didehydro-25S-OHD₃	C₂₈H₄₄O₂	412.648									(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0307)		¹H-NMR (d, CDCl₃, 500MHz) 0.67 (3H, s, 18-H), 0.90 (3H, t, J = 7.0 Hz, 26-CH₃), 1.03 (3H, d, J = 6.0 Hz, 21-H), 1.13 (3H, s, 27-H), 3.55 (1H, m, 3-H), 4.81 and 5.05 (2H, each br s, 19-H), 5.39 (2H, m, 22- and 23-H), 6.03 (1H, d, J = 11.5 Hz, 7-H), 6.24 (1H, d, J = 11.5 Hz, 6-H) (Ref. 0307)	m/z 412 (M⁺), 394 (M⁺-H₂O), 379, 340, 271, 253, 211, 136 (base peak), 118, 73 (Ref. 0307)				From 25-hydroxy-5,22-cholestadien-26-oic acid derivative via methylation of 25,26-epoxide as key step. Separation of 25-epimers was achieved via a chiral amide derivative of the starting 26-carboxylic acid. (Ref. 0307)				[0307]
368		25-hydroxy-24-methyl-23,24-didehydrovitamin D₃ / 25-hydroxy-24-methyl-23,24-didehydrocholecalciferol	(5Z,7E,23E)-(3S)-9,10-seco-5,7,10(19),23-ergostatetraene-3,25-diol	VVD0371	Sachiko Yamada	24-methyl-23,24-didehyero-25-OHD₃	C₂₈H₄₄O₂	412.648		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 7.5 10^-⁷ M, 8.0 10^-⁷ M and 8.6 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)																		[0228]
369		24-epi-25-hydroxyvitamin D₂ / 24-epi-25-hydroxyergocalciferol	(5Z,7E,22E)-(3S,24R)-9,10-seco-5,7,10(19),22-ergostatetraene-3,25-diol	VVD0372	Sachiko Yamada	24-epi-25-OHD₂	C₂₈H₄₄O₂	412.648		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 3.0 10^-⁷ M, 2.8 10^-⁷ M and 2.8 10^-⁷ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)					[a] +50.7 (c = 0.2 in EtOH) (Ref. 0232)		lmax (nm) (emax) 265 (17300) (Ref. 0232)	(KBr) 3401 (OH), 1643, 1630 (C=C), 971 cm^-¹ (trans C=C) (Ref. 0232)	¹H-NMR (d, CDCl₃) 0.57 (s, 18-H), 0.99 (d, J = 7 Hz, 28-H), 1.03 (d, J = 7 Hz, 21-H), 1.14 and 1.16 (2 s, 26- and 27-H), 3.94 (m, 1H, 3a-H), 4.82 and 5.03 (2 narrow m, 2 1H, 19(Z)- and 19(E)-H), 5.20-5.40 (m, 2H, 22- and 23-H), 6.04 and 6.22 (2 d, J = 11 Hz, 2 1H, 7- and 6-H) (Ref. 0232)	m/z (relative intensity) 412 (M⁺, 62), 394 (M⁺-H₂O, 12), 379 (M⁺-H₂O-Me, 31), 271 (M⁺-side chain, 44), 253 (M⁺-side chain-H₂O, 55), 136 (100), 118 (67), 59 (38) (Ref. 0232)								[0228] / [0232]
370		(22E)-1a,25-dihydroxy-26-methyl-22,23-didehydrovitamin D₃ / (22E)-1a,25-dihydroxy-26-methyl-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R)-26-methyl-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0373	Sachiko Yamada	(22E)-26-methyl-22-ene-1a,25-(OH)₂D₃	C₂₈H₄₄O₃	428.647		Affinity for chick intestinal receptor : equal to that of 1,25-(OH)₂D₃. Bone calcium mobilization in hypocalcemic rat : equal to that of 1,25-(OH)₂D₃. (Ref. 0234)							lmax (nm) 265 lmin (nm) 228 (Ref. 0234)		¹H-NMR (d, CDCl₃, 400MHz) 0.56 (3H, s, 18-H₃), 0.91 (3H, t, J =7.6 Hz, -CH₂CH₃), 1.04 (3H, d, J = 6.8 Hz, 21-H₃), 1.13 (3H, s, 27-H₃), 4.23 (1H, m, W₁_/₂ = 18.4 Hz, 3a-H), 4.43 (1H, m, W₁_/₂ = 16.9 Hz, 1b-H), 5.00 (1H, br s, W₁_/₂ = 3.2 Hz, 19-H), 5.32 (1H, br s, W₁_/₂ = 3.2 Hz, 19-H), 5.37 (2H, m, 22- and 23-H), 6.02 (1H, d, J = 11.5 Hz, 7-H), 6.38 (1H, d, J = 11.5 Hz, 6-H) (Ref. 0234)	m/z 428 (M⁺), 410, 392, 356, 338, 320, 287, 269, 251, 152, 134, 73 (Ref. 0234)				Chemical method : The title vitamin D was synthesized from 1a-hydroxylated C(23) steroid precursor via introduction of the desired side chain and the double bond at C(7), and final photochemical and thermal isomerizations. Biological conversion : In vitro incubation of 24-epi-25-hydroxyvitamin D₂ with chicken kidney homogenate. (Ref. 0234)				[0234]
371		1a,25-dihydroxy-20-epivitamin D₂ / 1a,25-dihydroxy-20-epiergocalciferol	(5Z,7E,22E)-(1S,3R,20S)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0374	Sachiko Yamada	20-epi-1a,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U 937 cells, 4000% ; Induction of differentiation of U 937 cells, 200% ; Calciuric effects on normal rats, 80%. (Ref. 0284)														From protected (5E)-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by reaction with side chain fragment with terminal phenylsulfonyl group, reductive desulfonylation, separation of 22E/Z-isomers, dye-sensitized photoisomerization and deprotection. (Ref. 0284)				[0284]
372		(22Z)-1a,25-dihydroxy-20-epivitamin D₂ / (22Z)-1a,25-dihydroxy-20-epiergocalciferol	(5Z,7E,22Z)-(1S,3R,20S)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0375	Sachiko Yamada	(22Z)-20-epi-1a,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U 937 cells, 300% ; Induction of differentiation of U 937 cells, 100%. (Ref. 0284)														From protected (5E)-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by reaction with side chain fragment with terminal phenylsulfonyl group, reductive desulfonylation, separation of 22E/Z-isomers, dye-sensitized photoisomerization and deprotection. (Ref. 0284)				[0284]
373		(6R)-vitamin D₂ 6,19-sulfur dioxide adduct / (6R)-ergocalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6R)-6,19-epithio-9,10-seco-5(10),7,22-ergostatrien-3-ol S,S-dioxide	VVD0376	Sachiko Yamada	D₂ 6R,19-sulfur dioxide adduct	C₂₈H₄₄O₃S	460.713										(KBr) 1300, 1140 cm^-¹ (Ref. 0267)	¹H-NMR (d, C₆D₆) 4.55 and 4.95 (d, J = 9.0 Hz, 6- and 7-C), 3.75 (m, 3-C), 0.48 (s, 18-CH₃) (Ref. 0267)	m/z 397 [(M⁺+1)-SO₂], 379 [(M⁺+1)-SO₂-H₂O] (Ref. 0267)	CD (95% EtOH) 208 nm (e -26.2) (Ref. 0267)			From vitamin D₂ by treatment with liquid sulfur dioxide. (Ref. 0267)				[0267]
374		(6S)-vitamin D₂ 6,19-sulfur dioxide adduct / (6S)-ergocalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6S)-6,19-epithio-9,10-seco-5(10),7,22-ergostatrien-3-ol S,S-dioxide	VVD0377	Sachiko Yamada	D₂ 6S,19-sulfur dioxide adduct	C₂₈H₄₄O₃S	460.713										(KBr) 1300, 1140 cm^-¹ (Ref. 0267)	¹H-NMR (d, C₆D₆) 4.48 and 4.90 (d, J = 9.0 Hz, 6- and 7-C), 3.75 (m, 3-C), 0.75 (s, 18-CH₃) (Ref. 0267)	m/z 397 [(M⁺+1)-SO₂], 379 [(M⁺+1)-SO₂-H₂O] (Ref. 0267)	CD (95% EtOH) 203 nm (e +11.5) (Ref. 0267)			From vitamin D₂ by treatment with liquid sulfur dioxide. (Ref. 0267)				[0267]
375		(6R)-6,19-epidioxy-6,19-dihydrovitamin D₂ / (6R)-6,19-epidioxy-6,19-dihydroergocalciferol	(7E,22E)-(3S,6R)-6,19-epidioxy-9,10-seco-5(10),7,22-ergostatrien-3-ol	VVD0378	Sachiko Yamada		C₂₈H₄₄O₃	428.647			Benzoate : 132-133 C (Ref. 0335)				Benzoate : [a] +77.5 (c = 0.69 in CHCl₃) (Ref. 0335)		Benzoate : (95% EtOH ) lmax (nm) (logemax) 227 (4.19) (Ref. 0335/0338)	Benzoate : (KBr) 2960, 1710, 1275, 710 cm^-¹ (Ref. 0335/0338)	Benzoate : ¹H-NMR (d, CDCl₃) 0.59 (3H, s, 18-H), 0.82, 0.84, 0.92 and 1.02 (each 3H, d, J = 7 Hz, 21-, 26-, 27- and 28-H), 4.3 (1H, d, J = 15 Hz, 19-H), 4.56 (1H, d, J = 15 Hz, 19-H), 4.88 (1H, d, J = 10 Hz, 6- or 7-H), 5.18 (2H, m, 22- and 23-H), 5.32 (1H, d, J = 10 Hz, 7- or 6-H), 5.4 (1H, m, 3-H), 7.3-7.6 (3H, m, Ar-H), 8.01 (2H, dd, J = 8.2 Hz, Ar-H) (Ref. 0335/0338) ¹³C-NMR (d, CDCl₃) 125.9 (s, C-5), 125.4 (s, C-10), 114.9 (d, C-7), 148.9 (s, C-8), 69.0 (d, C-3), 76.7 (d, C-6), 72.1 (t, C-19) (Ref. 0335/0338)	m/z 532 (M⁺), 514, 392, 267 (Ref. 0335/0338)	CD : 210 nm (e -17.7) (in Hexane) (Ref. 0335/0338)			As a major product by the reaction of vitamin D₂ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0335/0337)				[0335] / [0337] / [0338]
376		(6S)-6,19-epidioxy-6,19-dihydrovitamin D₂ / (6S)-6,19-epidioxy-6,19-dihydroergocalciferol	(7E,22E)-(3S,6S)-6,19-epidioxy-9,10-seco-5(10),7,22-ergostatrien-3-ol	VVD0379	Sachiko Yamada		C₂₈H₄₄O₃	428.647			Benzoate : 126-127 C (Ref. 0335)				Benzoate : [a] -6.1 (c = 0.54 in CHCl₃) (Ref. 0335)		Benzoate : (95% EtOH ) lmax (nm) (logemax) 209 (4.30), 229 (4.18), 274 (3.09), 281 (3.04) (Ref. 0337)	(KBr) 2960, 1720, 1275, 710 cm^-¹ (Ref. 0335)	¹H-NMR (d, CDCl₃, 100MHz) 0.59 (3H, s), 0.83 (3H, d, J = 7 Hz), 0.84 (3H, d, J = 7 Hz), 0.92 (3H, d, J = 7 Hz), 1.03 (3H, d, J = 7Hz), 4.21 (1H, d, J = 16 Hz), 4.63 (1H, d, J = 16 Hz), 4.78 (1H, d, J = 10 Hz), 5.18 (2H, m), 5.30 (1H, d, J = 10 Hz), 5.25 (1H, m), 7.3-7.6 (3H, m), 8.01 (2H, dd, J = 8 and 2 Hz) (Ref. 0337) ¹³C-NMR (d, CDCl₃) 114.3, 125.9, 126.4, 128.2, 129.5, 130.4, 132.0, 132.8, 135.4, 149.6, 165.9 (Ref. 0337)	m/z 532 (M⁺), 514, 392, 267 (Ref. 0335)	CD : 211 nm (e +11.3) (in Hexane), (Benzoate) 206 nm (e +7.7), 219 nm (e +5.8) (in Hexane) (Ref. 0338)			As a major product by the reaction of vitamin D₂ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0335/0337)				[0335] / [0337] / [0338]
377			(7E,22E)-(3S,6R)-6-hydroperoxy-9,10-seco-4,7,10(19),22-ergostatetraen-3-ol	VVD0380	Sachiko Yamada		C₂₈H₄₄O₃	428.647									(95% EtOH ) lmax (nm) 235 (Ref. 0335)	(CHCl₃) 3350, 2950 cm^-¹ (Ref. 0335)	¹H-NMR (d, CDCl₃) 0.52 (s, 18-H), 4.97 (br s, 19-H), 5.0-5.4 (22- and 23-H), 5.54 (d, J = 8 Hz, 7-H), 6.04 (m, 4-H) (Ref. 0335)	m/z 428.412 (M⁺), 410.394 (Ref. 0335)				As a minor product by the reaction of vitamin D₂ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0335)				[0335]
378			(7E,22E)-(3S,6S)-6-hydroperoxy-9,10-seco-4,7,10(19),22-ergostatetraen-3-ol	VVD0381	Sachiko Yamada		C₂₈H₄₄O₃	428.647									(95% EtOH ) lmax (nm) 234 (Ref. 0335)	(CHCl₃) 3350, 2950 cm^-¹ (Ref. 0335)	¹H-NMR (d, CDCl₃) 0.61 (s, 18-H), 4.95 (br s, 19-H), 4.9-5.3 (22- and 23-H), 5.50 (d, J = 8 Hz, 7-H), 6.04 (m, 4-H) (Ref. 0335)	m/z 428.412 (M⁺), 410.394 (Ref. 0335)				As a minor product by the reaction of vitamin D₂ with singlet oxygen generated by dye-sensitized photochemical method. (Ref. 0335)				[0335]
379		1a,,25-dihydroxyvitamin D₂ / 1a,,25-dihydroxyergocalciferol	(5Z,7E,22E)-(1S,3R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0382	Sachiko Yamada	1a,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647		Antirachitic Activity of 1,25-(OH)₂D₂ in the Rat. Table (Ref. 0146) Biological Activity of 312 pmol of 1,25-(OH)₂D₂ in the Chick Duodenal Assay System. Table (Ref. 0147) Biological Activity of 625 and 1250 pmol of 1,25-(OH)₂D₂ in the Chick Duodenal Assay System. Table (Ref. 0147) HL-60 human promyelocytes differentiation: ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 2.0 10^-⁸ M, 2.0 10^-⁸ M and 2.6 10^-⁸ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)							lmax (nm) 265, lmin (nm) 228 (Ref. 0146) (EtOH) lmax (nm) 265.5, lmin (nm) 227.5 (Ref. 0148)		¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-H₃), 1.01 (3H, d, J = 6.5 Hz, 28-H₃), 1.04 (3H, d,J = 6.5 Hz, 21-H₃),1.14 and 1.18 (6H, each s, 26- and 27-H₃), 4.24 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.01 (1H, narrow m, 19-H), 5.34 (3H, broad m, 19-H, 22- and 23-H), 6.02 (1H, d, J = 11 Hz, 7-H), 6.39 (1H, d, J = 11 Hz, 6-H) (Ref. 0148)	m/z 428 (M⁺), 410, 370, 352, 287, 269, 251, 152, 134; spectrum (Ref. 0146) TMS-ether : m/z 644 (M⁺), 554, 296, 206, 131; spectrum (Ref. 0146) m/z 428 (M⁺, 6), 410 (4), 352 (4), 287 (6), 269 (10), 251 (10), 152 (42), 134 (100), 59 (99) (Ref. 0148)		Chromatography: Sephadex LH-20 column (1 150 cm packed and eluted with methanol) (Ref. 0146)	Isolation and identification from rachitic chick kidney mitochondria incubated with 25-OHD₂. (Ref. 0146)	Synthesis of 1,25-(OH)₂D₂ and its 24-epimer from 24x-25-OHD₂ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative. (Ref. 0148)				[0146] / [0147] / [0148] / [0228]
380		1a,25-dihydroxy-24-epivitamin D₂ / 1a,25-dihydroxy-24-epiergocalciferol	(5Z,7E,22E)-(1S,3R,24R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0383	Sachiko Yamada	24-epi-1a,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647									(EtOH) lmax (nm) 265.5, lmin (nm) 227.5 (Ref. 0148) (EtOH) lmax (nm) 264, lmin (nm) 229, A264/A229 = 1.57 (Ref. 0192)	(Film) 3411, 1643, 1630, 971 cm^-¹ (Ref. 0192)	¹H-NMR (d, CDCl₃, 270 or 400MHz) 0.54 (3H, s, 18-CH₃), 0.97 (3H, d, J = 6.9 Hz, 28-CH₃), 1.01 (3H, d, J = 6.6 Hz, 21-CH₃), 1.10 and 1.15 (3H and 3H, each s, 26- and 27-CH₃), 4.21 (1H, m, 3-H), 4.41 (1H, m, 1-H), 4.97 (1H, br s, 19Z-H), 5.29 (2H, m, 22- and 23-H), 5.31 (1H, br s, 19E-H), 5.99 (1H, d, J = 11.2 Hz, 7-H), 6.35 (1H, d, J = 11.2 Hz, 6-H) (Ref. 0192)	m/z 428 (M⁺, 13), 410 (9), 352 (7), 287 (11), 269 (15), 251 (13), 152 (52), 134 (100), 59 (97) (Ref. 0148) m/z 428 (3), 410 (9), 392 (10), 374 (3), 352 (8), 287 (2), 269 (6), 251 (6), 155 (11), 152 (10), 135 (28), 134 (33), 59 (100) (Ref. 0192)				Synthesis of 1,25-(OH)₂D₂ and its 24-epimer from 24x-25-OHD₂ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative. (Ref. 0148)				[0148] / [0192]
381		5(E)-1a,25-dihydroxyvitamin D₂ / 5(E)-1a,25-dihydroxyergocalciferol	(5E,7E,22E)-(1S,3R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0384	Sachiko Yamada	5(E)-1a,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647									(EtOH) lmax (nm) 273.5, lmin (nm) 230 (Ref. 0148)			m/z 428 (M⁺, 8), 410 (3), 287 (3), 269 (7), 251 (7), 152 (34), 134 (100), 59 (78) (Ref. 0148)				Synthesis of 5(E)-1,25-(OH)₂D₂ and its 24-epimer from 24x-25-OHD₂ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative. (Ref. 0148)				[0148]
382		5(E)-1a,25-dihydroxy-24-epivitamin D₂ / 5(E)-1a,25-dihydroxy-24-epiergocalciferol	(5E,7E,22E)-(1S,3R,24R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0385	Sachiko Yamada	5(E)-24-epi-1a,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647									(EtOH) lmax (nm) 273.5, lmin (nm) 230 (Ref. 0148)			m/z 428 (M⁺, 10), 410 (4), 352 (4), 287 (5), 269 (9), 251 (8), 152 (37), 134 (100), 59 (82) (Ref. 0148)				Synthesis of 5(E)-1,25-(OH)₂D₂ and its 24-epimer from 24x-25-OHD₂ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative. (Ref. 0148)				[0148]
383		1b,25-dihydroxyvitamin D₂ / 1b,25-dihydroxyergocalciferol	(5Z,7E,22E)-(1R,3R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0386	Sachiko Yamada	1b,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647									(EtOH) lmax (nm) 263.5, lmin (nm) 227 (Ref. 0149)			m/z 428 (M⁺, 9), 410 (27), 392 (12), 352 (8), 334 (7), 269 (12), 251 (15), 152 (48), 135 (68), 134 (53), 59 (100) (Ref. 0149)				Synthesis of 1b,25-(OH)₂D₂ and its 24-epimer from 24x-25-OHD₂ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative. (Ref. 0148)				[0148] / [0149]
384		1b,25-dihydroxy-24-epivitamin D₂ / 1b,25-dihydroxy-24-epiergocalciferol	(5Z,7E,22E)-(1R,3R,24R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0387	Sachiko Yamada	24-epi-1b,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647									(EtOH) lmax (nm) 263.5, lmin (nm) 227 (Ref. 0148)			m/z 428 (M⁺, 10), 410 (29), 392 (13), 352 (9), 334 (7), 269 (13), 251 (16), 152 (58), 135 (76), 134 (59), 59 (100) (Ref. 0148)				Synthesis of 1b,25-(OH)₂D₂ and its 24-epimer from 24x-25-OHD₂ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative. (Ref. 0148)				[0148]
385		5(E)-1b,25-dihydroxyvitamin D₂ / 1b,25-dihydroxyergocalciferol	(5E,7E,22E)-(1R,3R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0388	Sachiko Yamada	5(E)-1b,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647									(EtOH) lmax (nm) 270, lmin (nm) 229.5 (Ref. 0148)			m/z 428 (M⁺, 11), 410 (5), 351 (4), 287 (4), 269 (12), 251 (11), 152 (67), 135 (100), 134 (75), 59 (72) (Ref. 0148)				Synthesis of 5(E)-1b,25-(OH)₂D₂ and its 24-epimer from 24x-25-OHD₂ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative. (Ref. 0148)				[0148]
386		5(E)-1b,25-dihydroxy-24-epivitamin D₂ / 5(E)-1b,25-dihydroxy-24-epiergocalciferol	(5E,7E,22E)-(1R,3R,24R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0389	Sachiko Yamada	5(E)-24-epi-1b,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647									(EtOH) lmax (nm) 270, lmin (nm) 229.5 (Ref. 0148)			m/z 428 (M⁺, 11), 410 (4), 351 (4), 287 (4), 269 (13), 251 (12), 152 (64), 135 (100), 134 (70), 59 (63) (Ref. 0148)				Synthesis of 5(E)-1b,25-(OH)₂D₂ and its 24-epimer from 24x-25-OHD₂ via SeO₂ oxidation of its 3,5-cyclovitamin D derivative. (Ref. 0148)				[0148]
387		1a,25-dihydroxy-18-methylidenevitamin D₃ / 1a,25-dihydroxy-18-methylidenecholecalciferol	(5Z,7E)-(1S,3R)-18-methylidene-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0390	Sachiko Yamada		C₂₈H₄₄O₃	428.647		(% of 1,25-(OH)₂D₃ effect) Affinity for calf thymus receptor and vitamin D binding protein: 25 and 100 ,respectively; differentiation of HL-60 cells: 50; intestinal calcium transport activity evaluated using Caco-2 intestinal cancer cell line: much less than 1,25-(OH)₂D₃. (Ref. 0365)														From Inhoffen-Lythgoe diol (CD-ring plus 20-22 side chain) and A-ring enyne via palladium-catalyzed coupling. Modification of the methyl at C(18) was achieved by photo-irradiation in the presence of Pb(OAC)₄ and iodine as a key step. (Ref. 0365)				[0365]
388		(22E)-1a,25-dihydroxy-22,23-didehydro-24a-homovitamin D₃ / (22E)-1a,25-dihydroxy-22,23-didehydro-24a-homocholecalciferol	(5Z,7E,22E)-(1S,3R)-24a-homo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0391	Sachiko Yamada	(22E)-1a,25-(OH)₂-22-ene-24-homo-D₃	C₂₈H₄₄O₃	428.647									(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0196)		¹H-NMR (d, CDCl₃, 360MHz) 0.55 (3H, s, 18-H₃), 1.02 (3H, d, J = 6.6 Hz, 21-H₃), 1.22 (6H, s, 26- and 27-H₃), 2.32 (1H, dd, J = 13.2 and 6.7 Hz), 2.60 (1H, dd, J = 13.0 and 3.0 Hz), 2.83 (1H, dd, J = 12.0 and 3.0 Hz), 4.23 (1H, m, W₁_/₂ = 18.4 Hz, 3a-H), 4.43 (1H, m, W₁_/₂ = 16.9 Hz, 1b-H), 5.00 (1H, br s, W₁_/₂ = 3.2 Hz, 19-H), 5.30 (1H, dd, J = 15.0 and 7.1 Hz, 23- or 22-H), 5.33 (1H, br s, W₁_/₂ = 3.2 Hz, 19-H), 5.37 (1H, dd, J = 15.0 and 5.8 Hz, 22- or 23-H), 6.01 (1H, d, J = 11.0 Hz, 7-H), 6.32 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0196)	m/z 428 (M⁺ 3.9), 410 (82), 392 (100), 374 (20), 287 (4.8), 269 (21), 251 (38), 152 (10), 134 (30), 123 (54), 59 (4.2). (Ref. 0196)								[0196]
389		(22E)-(25R)-1a,25-dihydroxy-26-methyl-22,23-didehydrovitamin D₃ / (22E)-(25R)-1a,25-dihydroxy-26-methyl-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,25R)-26-methyl-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0392	Sachiko Yamada	(22E)-1a,25(R)-(OH)₂-26-methyl-22,23-didehydro-D₃	C₂₈H₄₄O₃	428.647		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for chick intestinal vitamin D receptor, 170% ; Intestinal calcium transport, 360% ; Bone calcium mobilization, 220%. (Ref. 0307) Induction of differentiation (NBT reduction) of HL-60 cells in compared with the effect of 1,25-(OH)₂D₃ (value in parentheses) : 26.2% (18.1%) at 10^-⁹ M and 72.3% (56.4%) at 10^-⁸ M. (Ref. 0308)														From chemically synthesized (22E)-(25R)-25-hydroxy-26-methyl-22,23-didehydrovitamin D₃ by enzymatic 1-a-hydroxylation using vitamin D-deficient chick kidney homogenates. (Ref. 0307)	(22E)-1a,25-dihydroxy-26-methyl-22,23-didehydrovitamin D₃ with unknown C-25 configuration has been isolated from chick kidney homogenates incubated with 25-hydroxy-24-epivitamin D₂. (Ref. 0234)			[0234] / [0307] / [0308]
390		(22E)-(25S)-1a,25-dihydroxy-26-methyl-22,23-didehydrovitamin D₃ / (22E)-(25S)-1a,25-dihydroxy-26-methyl-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R,25S)-26-methyl-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0393	Sachiko Yamada	22-ene-26-methyl-1a,25S-(OH)₂D₃	C₂₈H₄₄O₃	428.647		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for chick intestinal vitamin D receptor, 150% ; Intestinal calcium transport, 210% ; Bone calcium mobilization, 160%. (Ref. 0307) Induction of differentiation (NBT reduction) of HL-60 cells in compared with the effect of 1,25-(OH)₂D₃ (value in parentheses) : 37.6% (18.1%) at 10^-⁹ M and 76.5% (56.4%) at 10^-⁸ M. (Ref. 0308)														From chemically synthesized (22E)-(25S)-25-hydroxy-26-methyl-22,23-didehydrovitamin D₃ by enzymatic 1-a-hydroxylation using vitamin D-deficient chick kidney homogenates. (Ref. 0307)	(22E)-1a,25-dihydroxy-26-methyl-22,23-didehydrovitamin D₃ with unknown C-25 configuration has been isolated from chick kidney homogenates incubated with 25-hydroxy-24-epivitamin D₂. (Ref. 0234)			[0234] / [0307] / [0308]
391		(22E)-1a,25-dihydroxy-26-methyl-22,23-didehydrovitamin D₃ / (22E)-1a,25-dihydroxy-26-methyl-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R)-26-methyl-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0394	Sachiko Yamada		C₂₈H₄₄O₃	428.647		Affinity to chick intestinal receptor was equal to that of 1,25-(OH)₂D₂. (Ref. 0234)							(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0196)		¹H-NMR (d, CDCl₃, 400MHz) 0.56 (3H, s, 18-H₃), 0.91 (3H, t, J = 7.6 Hz, -CH₂CH₃), 1.04 (3H, d, J = 6.8 Hz, 21-H₃), 1.13 (3H, s, 27-H₃), 4.23 (1H, m, W₁_/₂ = 18.4 Hz, 3a-H), 4.43 (1H, m, W₁_/₂ = 16.9 Hz, 1b-H), 5.00 (1H, br s, W₁_/₂ = 3.2 Hz, 19-H), 5.32 (1H, br s, W₁_/₂ = 3.2 Hz, 19-H), 5.37 (2H, m, 22- and 23-H), 6.02 (1H, d, J = 11.5 Hz, 7-H), 6.38 (1H, d, J = 11.5 Hz, 6-H) (Ref. 0196)	m/z 428 (M⁺ 15), 410 (25), 392 (20), 374 (1.0), 338 (6.8), 320 (4.4), 287 (9.0), 269 (15), 251 (14), 141 (8.6), 134 (99), 123 (8.2), 73 (100) (Ref. 0196)			Produced from 24-epi-25-hydroxyvitamin D₂ by in vitro incubation with chicken kidney homogenate. (Ref. 0234)					[0196] / [0234]
392		(24R)-24,25-dihydroxyvitamin D₂ / (24R)-24,25-dihydroxyergocalciferol	(5Z,7E,22E)-(3S,24R)-9,10-seco-5,7,10(19),22-ergostatetraene-3,24,25-triol	VVD0395	Sachiko Yamada	24R,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647									lmax (nm) 265, lmin (nm) 228 (Ref. 0149) (EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0193)		¹H-NMR (d, CDCl₃) 4.84 and 5.08 (each 1H, br s, 19-H₂), 5.64 (2H, m, 22- and 23-H) (Ref. 0193)	m/z 428 (M⁺), 395, 370, 337, 271, 253, 136, 118 (Ref. 0149) m/z 428 (M⁺), 395, 370, 337, 271, 253, 136, 118,59 (Ref. 0150) m/z 428.3271 (Ref. 0193)		HPLC : Zorbax-SIL column, 5.5% / 94.5% : isopropyl alcohol / hexane, 2ml/min (Ref. 0150)		Asymmetric synthesis of (24R)- and (24S)-24,25-(OH)₂D₂ from C(22) steroid aldehyde via reduction of 3b,25-dihydroxy-5,22-cholestadien-24-one as a key step, the stereochemistry at C(24) being determined by X-ray analysis. The configuration of 24,25-(OH)₂D₂ produced by kidney was determined to be R using these synthetic compounds. (Ref. 0151) Asymmetric synthesis of (24R)- and (24S)-24,25-(OH)₂D₂ from C(22) steroid aldehyde via triazoline adduct of 3b-acetoxy-25-hydroxy-5,7,22-cholestadien-24-one. (Ref. 0152)	24,25-Dihydroxyvitamin D₂ was biologically generated from synthetic 25-hydroxyvitamin D₂ using an isolated perfused rat kidney incubated under normocalcemic and normophosphatemic conditions. (Ref. 0150)			[0149] / [0150] / [0151] / [0152] / [0193]
393		24,25-dihydroxy-24-epivitamin D₂ / 24,25-dihydroxy-24-epiergocalciferol	(5Z,7E,22E)-(3S,24S)-24-methyl-9,10-seco-5,7,10(19),22-cholestatetraene-3,24,25-triol	VVD0396	Sachiko Yamada	24-epi-24,25-(OH)₂D₂	C₂₈H₄₄O₃	428.647									(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0193)		¹H-NMR (d, CDCl₃) 0.50 (3H, s, 13-Me), 0.98 (3H, d, J = 6 Hz, 20-Me), 1.14, 1.16 and 1.20 (each 3H, s, 24-Me and 25-Me₂), 3.88 (1H, m, 3a-H), 4.76 and 4.99 (each 1H, br s, 19-H₂), 5.50 (2H, m, 22- and 23-H), 5.97 and 6.20 (each 1H, d, J = 11 Hz, 6- and 7-H) (Ref. 0193)	m/z 428.3307 (Ref. 0193)								[0193]
394		(24R)-24,26-dihydroxyvitamin D₂ / (24R)-24,26-dihydroxyergocalciferol	(5Z,7E,22E)-(3S,24R)-9,10-seco-5,7,10(19),22-ergostatetraene-3,24,26-triol	VVD0397	Sachiko Yamada	24R,26-(OH)₂D₂	C₂₈H₄₄O₃	428.647		Ability of Vitamin D Metabolites to Displace [³H]-25-OHD₃ from the Rat Plasma Vitamin D Binding Protein. (Ref. 0157) Biological Evaluation of 24,26-(OH)₂D₂. Using the Rat Bioassay. (Ref. 0157)										m/z 428 (M⁺), 410, 395, 380, 271, 253, 136, 118 (Ref. 0157)		HPLC : Zorbax-SIL column, methanol-acetinitrile-methylene chloride (1:20:180) (Ref. 0157)						[0157]
395		1a,25-dihydroxy-26,27-dimethyl-20,21-didehydro-23-oxavitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-20,21-didehydro-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-23-oxa-9,10-seco-5,7,10(19),20-cholestatetraene-1,3,25-triol	VVD0398	Sachiko Yamada	20-ene-23-oxa-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₈H₄₄O₄	444.647		Biological activity : Affinity for pig intestinal nuclear receptor, 33% of 1,25-(OH)₂D₃ effect ; Affinity for human vitamin D binding protein, < 0.02% of 25-OHD₃ effect ; Differentiation of HL-60 cells, 33% of 1,25-(OH)₂D₃ effect ; Calciuric effect, 20% of 1,25-(OH)₂D₃ effect. (Ref. 0299)																		[0299]
396		(24R)-1a,24,25-trihydroxyvitamin D₂ / (24R)-1a,24,25-trihydroxyergocalciferol	(5Z,7E,22E)-(1S,3R,24R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,24,25-tetrol	VVD0399	Sachiko Yamada	1a,24R,25-(OH)₃D₂	C₂₈H₄₄O₄	444.647									lmax (nm) 265, lmin (nm) 228 (Ref. 0155)		¹H-NMR (d, CDCl₃, 300MHz) : (Ref. 0156)	m/z 444 (M⁺), 426, 408, 390, 368, 350, 287, 269, 251, 152, 134, 59 (Ref. 0155) m/z 444 (M⁺),426, 408, 390, 368, 350, 285, 269, 251, 155, 134, 59 (Ref. 0156)		HPLC : Zorbax-SIL column (25 cm 4.6 mm), methyolene chloric-2-propanol (98 : 2), 2mL/min (Ref. 0155) HPLC : Zorbax-SIL column , isopropanol-methylen chloride (7 : 93) (Ref. 0156)						[0155] / [0156]
397		(25S)-1a,25,26-trihydroxyvitamin D₂ / (25S)-1a,25,26-trihydroxyergocalciferol	(5Z,7E,22E)-(1S,3R,25S)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25,26-tetrol	VVD0400	Sachiko Yamada	1a,25S,26-(OH)₃D₂	C₂₈H₄₄O₄	444.647														HPLC: (Ref. 0156)						[0156]
398		1a,25,28-trihydroxyvitamin D₂ / 1a,25,28-trihydroxyergocalciferol	(5Z,7E,22E)-(1S,3R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25,28-tetrol	VVD0401	Sachiko Yamada	1a,25,28-(OH)₃D₂	C₂₈H₄₄O₄	444.647														HPLC: (Ref. 0156)						[0156]
399		(24R)-1a,24,25,26-tetrahydroxyvitamin D₂ / (24R)-1a,24,25,26-tetrahydroxyergocalciferol	(5Z,7E,22E)-(1S,3R,24R,25)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,24,25,26-pentol	VVD0402	Sachiko Yamada	1a,24R,25,26-(OH)₄D₂	C₂₈H₄₄O₅	460.646									lmax (nm) 265, lmin (nm) 228 (Ref. 0155)			m/z 460 (M⁺), 442, 424, 406, 384, 368, 366, 350, 348, 287, 269, 251, 152, 134, 75 (Ref. 0155)		HPLC : Zorbax-SIL column (25 cm 4.6 mm), methyolene chloric-2-propanol (98 : 2), 2mL/min (Ref. 0155)						[0155]
400		1a,24,25,28-tetrahydroxyvitamin D₂ / 1a,24,25,28-tetrahydroxyergocalciferol	(5Z,7E,22E)-(1S,3R)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,24,25,28-pentol	VVD0403	Sachiko Yamada	1a,24S,25,28-(OH)₄D₂	C₂₈H₄₄O₅	460.646									lmax (nm) 265, lmin (nm) 228 (Ref. 0155)			m/z 460 (M⁺), 442, 424, 406, 384, 366, 351, 348, 333, 287, 269, 251, 152, 134 (Ref. 0155)		HPLC : Zorbax-SIL column (25 cm 4.6 mm), methyolene chloric-2-propanol (98 : 2), 2mL/min (Ref. 0155)						[0155]
401		11a-(chloromethyl)-1a,25-dihydroxyvitamin D₃ / 11a-(chloromethyl)-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,11S)-11-(chloromethyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0404	Sachiko Yamada	11a-(chloromethyl)-1a,25-(OH)₂D₃	C₂₈H₄₅ClO₃	465.108																By Horner coupling of 11-substituted CD-ring ketone with the A-ring phosphine oxide. (Ref. 0366)				[0366]
402		(24R)-25-fluoro-1a,24-dihydroxy-24-methylvitamin D₃ / (24R)-25-fluoro-1a,24-dihydroxy-24-methylcholecalciferol	(5Z,7E)-(1S,3R,24R)-25-fluoro-24-methyl-9,10-seco-5,7,10(19)-cholestatrien-1,3,24-triol	VVD0405	Sachiko Yamada		C₂₈H₄₅FO₃	448.654
403		11a-(fluoromethyl)-1a,25-dihydroxyvitamin D₃ / 11a-(fluoromethyl)-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,11S)-11-(fluoromethyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0406	Sachiko Yamada	11a-(fluoromethyl)-1a,25-(OH)₂D₃	C₂₈H₄₅FO₃	448.654		Biological activity of C-ring analogs of 1a,25-(OH)₂D₃ : (Ref. 0224)														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of vinylcopper reagent to 9(11)-en-8-one of the CD-ring fragment followed by appropriate modification of the vinyl group. (Ref. 0224)				[0224]
404		1a-hydroxy-25-methoxyvitamin D₃ / 1a-hydroxy-25-methoxycholecalciferol	(5Z,7E)-(1S,3R)-25-methoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0407	Sachiko Yamada	1a-OH-25-methoxy-D₃	C₂₈H₄₅O₃	429.655		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 6.5 10^-⁸ M, 6.5 10^-⁸ M and 6.5 10^-⁸ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)																		[0228]
405		6-methylvitamin D₃ / 6-methylcholecalciferol	(5Z,7E)-(3S)-6-methyl-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0408	Sachiko Yamada	6-methyl-D₃	C₂₈H₄₆O	398.664									(Hexane) lmax (nm) 240 (sh) (Ref. 0265)		¹H-NMR (d, CD₃COCD₃) 0.59 (3H, s, 18-H), 1.79 (3H, s, 6-Me), 4.64 (1H, bs, 19-H), 4.85 (1H, bs, 19-H), 5.59 (1H, bs, 7-H) (Ref. 0265)	m/z 398 (M⁺), 365, 150, 132 (Ref. 0265)				From vitamin D₃ via methylation of its sulfur dioxide adduct using NaH as a base. (Ref. 0265)				[0265]
406		(5E)-6-methylvitamin D₃ / (5E)-6-methylcholecalciferol	(5E,7E)-(3S)-6-methyl 9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0409	Sachiko Yamada	(5E)-6-methyl-D₃	C₂₈H₄₆O	398.664									(95% EtOH) lmax (nm) 240 (Ref. 0265)		¹H-NMR (d, CDCl₃) 0.61 (3H, s, 18-H), 1.81 (3H, s, 6-Me), 3.85 (1H, m, 3-H), 4.74 (1H, bs, 19-H), 5.03 (1H, bs, 19-H), 5.44 (1H, bs, 7-H) (Ref. 0265)	m/z 398 (M⁺), 150, 132 (Ref. 0265)				From vitamin D₃ via methylation of its sulfur dioxide adduct using NaH as a base. (Ref. 0265)				[0265]
407		6-methylprevitamin D₃ / 6-methylprecholecalciferol	(6E)-(3S)-6-methyl-9,10-seco-5(10),6,8-cholestatrien-3-ol	VVD0410	Sachiko Yamada	6-methylpre-D₃	C₂₈H₄₆O	398.664									(95% EtOH) lmax (nm) 248 (Ref. 0265)		¹H-NMR (d, CDCl₃) 0.68 (3H, s, 18-H), 1.76 (3H, s, 6-Me), 1.54 (3H, s, 19-H), 3.90 (1H, m, 3-H), 5.50 (2H, m, 7- and 9-H) (Ref. 0265)	m/z 398 (M⁺), 365, 285 (Ref. 0265)				From vitamin D₃ via methylation of its sulfur dioxide adduct using NaH as a base. (Ref. 0265)				[0265]
408		(10E)-19-methylvitamin D₃ / (10E)-19-methylcholecalciferol	(5Z,7E,10E)-(3S)-19-methyl-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0411	Sachiko Yamada	(10E)-19-methyl-D₃	C₂₈H₄₆O	398.664									(95% EtOH) lmax (nm) 268 (Ref. 0265)		¹H-NMR (d, CDCl₃) 0.54 (3H, s, 18-H), 1.72 (3H, d, J = 7.0 Hz, 19-Me), 3.95 (1H, m, 3-H), 5.37 (1H, q, J = 7.0 Hz, 19-H), 5.93 (1H, d, J = 11.0 Hz, 7-H), 6.16 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0265)	m/z 398 (M⁺), 150, 132 (Ref. 0265)				From vitamin D₃ via methylation of its sulfur dioxide adduct using a bulky base. (Ref. 0265)				[0265]
409		(5E,10E)-19-methylvitamin D₃ / (5E,10E)-19-methylcholecalciferol	(5E,7E,10E)-(3S)-19-methyl-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0412	Sachiko Yamada	(5E,10E)-19-methyl-D₃	C₂₈H₄₆O	398.664									(95% EtOH) lmax (nm) 264 (Ref. 0265)		¹H-NMR (d, CDCl₃) 0.58 (3H, s, 18-H), 1.70(3H, d, J = 7.0 Hz, 19-Me), 3.88 (1H, m, 3-H), 5.36 (1H, q, J = 7.0 Hz, 19-H), 5.95 (1H, d, J = 11.0 Hz, 7-H), 6.28 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0265)	m/z 398 (M⁺), 150, 132 (Ref. 0265)				From vitamin D₃ via methylation of its sulfur dioxide adduct using a bulky base. (Ref. 0265)				[0265]
410		dihydrotachysterol₂ / (5E)-(10S)-10,19-dihydrovitamin D₂ / (5E)-(10S)-10,19-dihydroergocalciferol	(5E,7E,22E)-(3S,10S)-9,10-seco-5,7,22-ergostatrien-3-ol	VVD0413	Sachiko Yamada	dihydrotachysterol₂ / (5E)-10S,19-dihydro-D₂	C₂₈H₄₆O	398.664			125-127 C (Ref. 0145)				[a] +97.5 (in CHCl₃) (Ref. 0145)		lmax (nm) (E¹^%₁_c_m) 242 (870), 251 (1010), 261 (650) (Ref. 0145)		¹H-NMR (d, CDCl₃) 6.1 (1H, J = 11.1 Hz, 6-H), 5.9 (1H, J = 11.1 Hz, 7-H), 3.6 (1H, J = 4.8 Hz, 3-H), 0.5 (3H, 18-H) (Ref. 0165) ¹³C-NMR (d, CDCl₃, 20MHz) 33.20 (1), 34.95 (2), 70.90 (3), 38.30 (4), 139.75 (5), 117.05 (6), 115.75 (7), 142.15 (8), 29.00 (9), 37.80 (10), 22.40 (11), 40.55 (12), 45.70 (13), 56.60 (14), 23.60 (15), 27.80 (16), 56.60 (17), 12.40 (18), 17.85 (19) (Ref. 0165)									[0145] / [0165]
411		3-epidihydrotachysterol₂ / (5E)-(10S)-10,19-dihydro-3-epivitamin D₂ / (5E)-(10S)-10,19-dihydro-3-epiergocalciferol	(5E,7E,22E)-(3R,10S)-9,10-seco-5,7,22-ergostatrien-3-ol	VVD0414	Sachiko Yamada	3-epidihydrotachysterol₂	C₂₈H₄₆O	398.664			p-nitrobenzoate : 100-101 C (Ref. 0165)				p-nitrobenzoate : [a]_D -141 (c = 1.0 in CHCl₃) (Ref. 0165)		lmax (nm) (emax) 242, 251 and 261 (34500, 40000 and 26000) (Ref. 0165)		¹H-NMR (d, CDCl₃) 6.2 (1H, J = 11.2 Hz, 6-H), 5.8 (1H, J = 11.2 Hz, 7-H), 3.8 (1H, J = 3.7 Hz, 3-H), 0.5 (3H, 18-H) (Ref. 0165) ¹³C-NMR (d, CDCl₃, 20MHz) 31.30 (1), 32.05 (2), 69.65 (3), 35.65 (4), 139.30 (5), 119.15 (6), 115.60 (7), 142.20 (8), 28.95 (9), 38.40 (10), 22.35 (11), 40.45 (12), 45.65 (13), 56.55 (14), 23.50 (15), 27.80 (16), 56.55 (17), 12.40 (18), 18.70 (19) (Ref. 0165)					From dihydrotachysterol by inverting the configuration at C(3). (Ref. 0165)				[0165]
412		vitamin D₄ / 22,23-dihydroergocalciferol	(5Z,7E)-(3S)-9,10-seco-5,7,10(19)-ergostatrien-3-ol	VVD0415	Sachiko Yamada	D₄	C₂₈H₄₆O	398.664		Antirachitic activity: 75% of the effect of vitamin D₃. (Ref. 0368)																		[0368]
413		provitamin D₄	(3S)-5,7-ergostadien-3-ol	VVD0416	Sachiko Yamada	pro-D₄	C₂₈H₄₆O	398.664
414		vitamin D₇ / 24R-methylvitamin D₃	(5Z,7E)-(3S,24R)-24-methyl-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0417	Sachiko Yamada	D₇	C₂₈H₄₆O	398.664		Antirachitic activity: 10% of the effect of vitamin D₃. (Ref. 0369)																		[0369]
415		provitamin D₇	(3S,24R)-24-methyl-5,7-cholestadien-3-ol	VVD0418	Sachiko Yamada	pro-D₇	C₂₈H₄₆O	398.664
416		1a-hydroxy-3a-methyl-3-deoxyvitamin D₃ / 1a-hydroxy-3a-methyl-3-deoxycholecalciferol	(5Z,7E)-(1S,3S)-3-methyl-9,10-seco-5,7,10(19)-cholestatrien	VVD0419	Sachiko Yamada	3-deoxy-3a-methyl-1a-OHD₃	C₂₈H₄₆O	398.664									lmax (nm) 262, lmin (nm) 227 (Ref. 0180)		¹H-NMR (d, CDCl₃, 300MHz) 628 and 6.06 (AB q, J = 11.5 Hz, 6-, 7-H), 5.36 (dd, J = 2.5, 2.5 Hz, 19-H), 4.98 (dd, J = 2.5, 2.5 Hz, 19E-H), 4.08 (d with fine splittings, J = 11.5 Hz, 1b-H), 2.82 (d, J = 13 Hz, 9b-H), 2.28 (1H, d, J = 12.5 Hz), 2.13 (1H, d, J = 11.5 Hz), 0.97 (d, J = Hz, 3C-CH₃), 0.93 (d, J = 6 Hz, 21C-CH₃), 0.87 (d, J = 7 Hz, 26, 27C-2CH₃), 0.55 (s, 18C-CH₃) (Ref. 0180)	(80 eV) m/e (rel intensity ; at m/e > 130, > 7%, and at m/e < 130, > 10%) 398 (M⁺, 7), 380 (M⁺-H₂O, 8), 190 (8), 175 (7), 173 (11), 172 (7), 171 (8), 161 (8), 159 (11), 157 (12), 151 (26), 150 (base, A-ring portion by C₇,₈ cleavage), 149 (37), 147 (12), 145 (12), 143 (7), 138 (14), 135 (22), 133 (18), 133 (11), 131 (10), 119 (12), 109 (10), 107 (13), 105 (15), 95 (13), 93 (11), 91 (14) (Ref. 0180)				From 1a-hydroxycholesterol 3-tosylate via the following steps: selective 3a-methylation with Me₂CuLi, oxidation of the 1-hydroxyl group, bromination, dehydrobromination, reduction and photochemical followed by thermal isomerization. (Ref. 0180)				[0180]
417		1a,25-dihydroxy-3a-methyl-3-deoxyvitamin D₃ /1a,25-dihydroxy-3a-methyl-3-deoxycholecalciferol	(5Z,7E)-(1S,3S)-3-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,25-diol	VVD0420	Sachiko Yamada	3-deoxy-3a-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₂	414.664									lmax (nm) 262, lmin (nm) 227 (Ref. 0180)			(70 eV) m/e (rel intensity ; 7% for m/e 130-200 and 45% for m/e < 130) 414 (M⁺, 0.7), 396 (M⁺-H₂O, 0.8), 378 (M⁺-2H₂O, 0.4) 190 (8), 189 (10), 187 (7), 175 (12), 172 (13), 172 (8), 171 (8), 169 (8), 161 (16), 159 (16), 157 (11), 155 (11), 151 (35), 150 (100, A-ring portion by C7,8 cleavage), 149 (35), 148 (8), 147 (17), 145 (20), 143 (9), 141 (11), 138 (14), 137 (11), 135 (25), 134 (14), 133 (45), 132 (8), 131 (22), 95 (59), 91 (45), 81 (74), 69 (49), 67 (48), 59 (C₃H₇O, 58) (Ref. 0180)				From 1a,25-dihydroxycholesterol 3-tosylate via the following steps: selective 3a-methylation with Me₂CuLi, oxidation of the 1-hydroxyl group, bromination, dehydrobromination, reduction and photochemical followed by thermal isomerization. (Ref. 0180)				[0180]
418		(6R)-6-methylvitamin D₃ 6,19-sulfur dioxide adduct / (6R)-6-methylcholecalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6R)-6-methyl-6,19-epithio-9,10-seco-5(10),7-cholestadien-3-ol S,S-dioxide	VVD0421	Sachiko Yamada	6R-methyl-D₃ 6,19-sulfur dioxide adduct	C₂₈H₄₆O₃S	462.729										3-Tetrahydropyranyl ether : (CHCl₃) 1305, 1120 cm^-¹ (Ref. 0265)	3-Tetrahydropyranyl ether : ¹H-NMR (d, C₆D₆) 0.82 (3H, s, 18-H), 1.47 (3H, s, 6-Me), 3.13 (2H, bs, 19-H), 4.75 (1H, bs, 7-H) (Ref. 0265)	3-Tetrahydropyranyl ether : m/z 482 (M⁺-SO₂) (Ref. 0265)	CD (95% EtOH) 208 nm (e -34.0) (Ref. 0265)			From vitamin D₃ SO₂ adduct by treatment with methyl iodide in the presence of NaH as a 1:1 mixture of C(6) epimers. (Ref. 0265)				[0265]
419		(6S)-6-methylvitamin D₃ 6,19-sulfur dioxide adduct / (6S)-6-methylcholecalciferol 6,19-sulfur dioxide adduct	(7E)-(3S,6S)-6-methyl-6,19-epithio-9,10-seco-5(10),7-cholestadien-3-ol S,S-dioxide	VVD0422	Sachiko Yamada	6S-methyl-D₃ 6,19-sulfur dioxide adduct	C₂₈H₄₆O₃S	462.729										3-Tetrahydropyranyl ether : (CHCl₃) 1305, 1120 cm^-¹ (Ref. 0265)	3-Tetrahydropyranyl ether : ¹H-NMR (d, C₆D₆) 0.73 (3H, s, 18-H), 1.53 (3H, s, 6-Me), 3.10 (2H, bs, 19-H), 4.82 (1H, bs, 7-H) (Ref. 0265)	3-Tetrahydropyranyl ether : m/z 482 (M⁺-SO₂) (Ref. 0265)	CD (95% EtOH) 212 nm (e +17.3) (Ref. 0265)			From vitamin D₃ SO₂ adduct by treatment with methyl iodide in the presence of NaH as a 1:1 mixture of C(6) epimers. (Ref. 0265)				[0265]
420		25-methyl-1a,26-dihydroxyvitamin D₃ / 25-methyl-1a,26-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-25-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,26-triol	VVD0423	Sachiko Yamada	1a-OH-25-hydroxymethyl-D₃	C₂₈H₄₆O₃	430.663
421		(1R)-25-hydroxy-1-(hydroxymethyl)vitamin D₃ / (1R)-25-hydroxy-1-(hydroxymethyl)cholecalciferol	(5Z,7E)-(1R,3R)-1-(hydroxymethyl)-9,10-seco-5,7,10,(19)-cholestatriene-3,25-diol	VVD0424	Sachiko Yamada	25-OH-1R-(hydroxymethyl)D₃	C₂₈H₄₆O₃	430.663		The title compound was less than 0.1% as effective as 1,25-(OH)₂D₃ for binding to the 1,25-(OH)₂D₃ receptor. However this compound and 1,25-(OH)₂D₃ were equipotent at inhibiting growth of PE cells (murine keratinocyte cell line) and inhibiting the effect of TPA (12-O-tetradecanoylphorbol-13-acetate) on the activity of ornithinedecarboxylase (ODC). (Ref. 0223)					[a] +24 (c = 0.74 in CH₂Cl₂) (Ref. 0223)		(MeOH) lmax (nm) 265 (Ref. 0223)		¹H-NMR (d, CDCl₃) 6.31 (1H, d, J = 11.3 Hz), 5.94 (1H, d, J = 11.3 Hz), 5.15 (1H, dd, J = 2.1 and 1.0 Hz), 4.99 (1H, d, J = 2.0 Hz), 4.03-3.97 (1H, m), 3.63-3.55 (2H, m), 2.83-2.78 (1H, m), 2.65-2.57 (1H, m), 2.30-2.24 (1H, m), 0.93 (3H, d, J = 9.8 Hz), 0.50 (3H, s) (Ref. 0223) ¹³C-NMR (d, CDCl₃) 145.4, 143.3, 134.1, 123.7, 117.0, 113.9, 71.1, 67.2, 64.4, 56.5, 56.3, 46.3, 45.9, 44.5, 44.4, 40.5, 37.5, 36.4, 36.1, 29.4, 29.2, 29.1, 27.7, 23.6, 22.3, 20.8, 18.8, 11.9 (Ref. 0223)	m/z (M⁺) calcd for C₂₈H₄₆O₃ 430.3447, found 430.3453 (Ref. 0223)				The title compound was synthesized in a convergent manner by combining enatiomerically pure 25-hydroxylated C,D-ring ketone with highly enantiomerically enriched A-ring phosphine oxide, which was prepared starting from thermal [2+4] cycloaddition of 3-bromo-2-pyrone and acrolein. (Ref. 0223)				[0223]
422		(1S)-25-hydroxy-1-(hydroxymethyl)vitamin D₃ / (1S)-25-hydroxy-1-(hydroxymethyl)cholecalciferol	(5Z,7E)-(1S,3S)-1-(hydroxymethyl)-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0425	Sachiko Yamada	25-OH-1S-(hydroxymethyl)D₃	C₂₈H₄₆O₃	430.663		The title compound was less than 0.1% as effective as 1,25-(OH)₂D₃ for binding to the 1,25-(OH)₂D₃ receptor. However this compound and 1,25-(OH)₂D₃ were equipotent at inhibiting growth of PE cells (murine keratinocyte cell line) and inhibiting the effect of TPA (12-O-tetradecanoylphorbol-13-acetate) on the activity of ornithinedecarboxylase (ODC). (Ref. 0223)					[a] -64 (c = 0.09 in CH₂Cl₂) (Ref. 0223)		(MeOH) lmax (nm) 264 (Ref. 0223)		¹H-NMR (d, CDCl₃) 6.32 (1H, d, J = 11.2 Hz), 5.95 (1H, d, J = 11.2 Hz), 5.18 (1H, d, J = 2.0 Hz), 5.02 (1H, d, J = 2.0 Hz), 0.93 (3H, d, J = 6.4 Hz), 0.54 (3H, s) (Ref. 0223) ¹³C-NMR (d, CD₃OD) 147.7, 142.6, 136.7, 124.0, 119.0, 114.1, 71.5, 67.4, 64.7, 58.0, 57.6, 47.4, 47.0, 46.5, 45.3, 41.9, 37.8, 37.6, 37.5, 30.0, 29.3, 29.1, 28.7, 24.7, 23.3, 22.0, 19.4, 12.3 (Ref. 0223)	m/z (M⁺) calcd for C₂₈H₄₆O₃ 430.3447, found 430.3449 (Ref. 0223)				The title compound was synthesized in a convergent manner by combining enatiomerically pure 25-hydroxylated C,D-ring ketone with highly enantiomerically enriched A-ring chiron, which was prepared starting from thermal [2+4] cycloaddition of 3-bromo-2-pyrone and acrolein. (Ref. 0223)				[0223]
423		(22R)-25-hydroxy-22-methoxyvitamin D₃ / (22R)-25-hydroxy-22-methoxycholecalciferol	(5Z,7E)-(3S,22R)-22-methoxy-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0426	Sachiko Yamada	22R-methoxy-25-OHD₃	C₂₈H₄₆O₃	430.663									(EtOH) lmax (nm) 267, lmin (nm) 228 (Ref. 0163)			m/z 430 (M⁺), 412 (M⁺-H₂O), 398 (M⁺-MeOH), 397 (M⁺-H₂O-Me), 383 (M⁺-Me-MeOH), 380 (M⁺-H₂O-MeOH), 379 (M⁺-2H₂O-Me), 365 (M⁺-H₂O-MeOH-Me), 362 (M⁺-2H₂O-MeOH), 347 (M⁺-2H₂O-MeOH-Me), 343 (C₂₂-C₂₃ cleavage), 325 (343-H₂O), 293 (343-H₂O-MeOH), 271, 269, 253, 251, 136 (C₇-C₈ cleavage), 118 (Ref. 0163)								[0163]
424		(22S)-25-hydroxy-22-methoxyvitamin D₃ / (22S)-25-hydroxy-22-methoxycholecalciferol	(5Z,7E)-(3S,22S)-22-methoxy-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0427	Sachiko Yamada	22S-methoxy-25-OHD₃	C₂₈H₄₆O₃	430.663									(EtOH) lmax (nm) 267, lmin (nm) 228 (Ref. 0163)			m/z 430 (M⁺), 412 (M⁺-H₂O), 398 (M⁺-MeOH), 397 (M⁺-H₂O-Me), 383 (M⁺-Me-MeOH), 380 (M⁺-H₂O-MeOH), 379 (M⁺-2H₂O-Me), 365 (M⁺-H₂O-MeOH-Me), 362 (M⁺-2H₂O-MeOH), 347 (M⁺-2H₂O-MeOH-Me), 343 (C₂₂-C₂₃ cleavage), 325 (343-H₂O), 293 (343-H₂O-MeOH), 271, 269, 253, 251, 136 (C₇-C₈ cleavage), 118 (Ref. 0163)								[0163]
425		25-hydroxy-3,3-dimethyl-3-deoxy-A-homo-2,4-dioxavitamin D₃ / 25-hydroxy-3,3-dimethyl-3-deoxy-A-homo-2,4-dioxacholecalciferol	(5Z,7E)-3,3-dimethyl-A-homo-2,4-dioxa-9,10-seco-5,7,10(19)-cholestatrien-25-ol	VVD0428	Sachiko Yamada		C₂₈H₄₆O₃	430.663		Affinity for chick intestinal receptor: 4% of the effect of 1,25-(OH)₂D₃. (Ref. 0359)																		[0359]
426		1a,25-dihydroxy-1b-methylvitamin D₃ / 1a,25-dihydroxy-1b-methylcholecalciferol	(5Z,7E)-(1S,3R)-1-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0429	Sachiko Yamada	1b-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Binding affinity for calf thymus vitamin D receptor : 1/150 relative to 1,25-(OH)₂D₃. (Ref. 0181)							(95% EtOH) lmax (nm) 264.6, 252 (sh) (Ref. 0181)	(Neat) 3366, 2937, 2870, 1467, 1377, 1148, 1086, 1037, 912, 895 cm^-¹ (Ref. 0181)	¹H-NMR (d, CDCl₃) 0.53 (3H, s), 0.93 (3H, d, J = 6.4 Hz), 1.21 (6H, s), 1.46 (3H, s), 4.15 (1H, tt, J = 9.2 and 4.3 Hz), 4.95 and 5.32 (each 1H, d, J = 1.5 Hz), 5.93 and 6.41 (each 1H, d, J = 11.3 Hz) (Ref. 0181)	m/z 430 (M⁺, 3), 412 (23), 394 (28), 379 (10), 376 (12), 361 (8), 265 (18), 169 (49), 166 (41), 155 (100), 151 (92) (Ref. 0181)				From bisnorchola-5,7-diene-1a,3b,22-triol N-phenyltriazolinedione (PTAD) adduct: selective oxidation of the 1a-hydroxyl group, methylation, removal of PTAD group and introduction of the side chain gave 1a,25-dihydroxy-1b-methylprovitamin D3. UV irradiation of the provitamin D gave the corresponding previtamin D as a minor product which was converted to the target compound by thermal isomerization. (Ref. 0181) From 1a,25-dihydroxyvitamin D₃: Oxidation of the 1-hydroxyl group, methylation (MeLi) of the 1-ketone and thermal isomerization gave 1a,25-dihydroxy-1b-methylvitamin D₃ and its 1-epimer (1b,25-dihydroxy-1a-methylvitamin D₃) in 66:25 ratio. (Ref. 0181)				[0181]
427		1b,25-dihydroxy-1a-methylvitamin D₃ / 1b,25-dihydroxy-1a-methylcholecalciferol	(5Z,7E)-(1R,3R)-1-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0430	Sachiko Yamada	1a-methyl-1b,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Binding affinity for calf thymus vitamin D receptor : < 1/1000 relative to 1,25-(OH)₂D₃. (Ref. 0181)							(95% EtOH) lmax (nm) 262 (Ref. 0181)	(Neat) 3371, 2927, 2852, 1557, 1467, 1378, 1129, 1104, 936, 912 cm^-¹ (Ref. 0181)	¹H-NMR (d, CDCl₃) 0.54 (3H, s), 0.94 (3H, d, J = 6.4 Hz), 1.22 (6H, s), 1.39 (3H, s), 4.08 (1H, m), 4.95 and 5.32 (each 1H, d, J = 1.5 Hz), 5.98 and 6.41 (each 1H, d, J = 11.0 Hz) (Ref. 0181)	m/z 430 (M⁺, 3), 412 (32), 394 (20), 379 (10), 265 (12), 166 (59), 155 (54), 151 (100) (Ref. 0181)				From 1a,25-dihydroxyvitamin D₃: Oxidation of the 1-hydroxyl group, methylation (MeLi) of the 1-ketone and thermal isomerization gave 1b,25-dihydroxy-1a-methylvitamin D₃ and its 1-epimer (1a,25-dihydroxy-1b-methylvitamin D₃) in 25:66 ratio. (Ref. 0181)				[0181]
428		1a,25-dihydroxy-8(14)a-homovitamin D₃ / 1a,25-dihydroxy-8(14)a-homocholecalciferol	(5Z,7E)-(1S,3R)-8(14)a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0431	Sachiko Yamada		C₂₈H₄₆O₃	430.663		The title compound was bound to the pig intestinal receptor with an affinity slightly less than 1,25-(OH)₂D₃, showed the same potency in inducing HL-60 cell differentiation and inhibition of keratinocyte proliferation as 1,25-(OH)₂D₃, and was found to be approximately 10-fold less potent in inducing hypercalcemia and hypercalciuria after a single injection in normal rats. (Ref. 0220)														Convergent synthesis by Horner coupling of 25-hydroxylated C-homo-CD-ring ketone with A-ring phosphine oxide. C-homo-CD-ring ketone was derived from 25-hydroxylated Grundmann's ketone via ring enlargement by Tiffeneau-Demyanov reaction as key step. (Ref. 0220)				[0220]
429		2b-methyl-1a,25-dihydroxyvitamin D₃ / 2b-methyl-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,2R,3R)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0432	Sachiko Yamada	2b-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : 13. Bone calcium mobilization : 2. HL-60 cell differentiation : 10. DBP binding : 79. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0260)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0260)				[0260]
430		2a-methyl-3-epi-1a,25-dihydroxyvitamin D₃ / 2a-methyl-3-epi-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,2S,3S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0433	Sachiko Yamada	2a-methyl-3-epi-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : 4. HL-60 cell differentiation : 13. DBP binding : 45. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0260)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0260)				[0260]
431		2b-methyl-3-epi-1a,25-dihydroxyvitamin D₃ / 2b-methyl-3-epi-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,2R,3S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0434	Sachiko Yamada	2b-methyl-3-epi-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : 0.3. HL-60 cell differentiation : 1.5. DBP binding : 21. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0260)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0260)				[0260]
432		2a-methyl-1b,25-dihydroxyvitamin D₃ / 2a-methyl-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,2S,3R)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0435	Sachiko Yamada	2a-methyl-1b,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : < 0.1. HL-60 cell differentiation : 1.0. DBP binding : 200. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0260)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0260)				[0260]
433		2b-methyl-1b,25-dihydroxyvitamin D₃ / 2b-methyl-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,2R,3R)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0436	Sachiko Yamada	2b-methyl-1b,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : < 0.1. HL-60 cell differentiation : 1.5. DBP binding : 1000. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0260)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0260)				[0260]
434		2a-methyl-3-epi-1b,25-dihydroxyvitamin D₃ / 2a-methyl-3-epi-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,2S,3S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0437	Sachiko Yamada	2a-methyl-3-epi-1b,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : < 0.1. HL-60 cell differentiation : 0.5. DBP binding : 1200. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0260)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0260)				[0260]
435		2b-methyl-3-epi-1b,25-dihydroxyvitamin D₃ / 2b-methyl-3-epi-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,2R,3S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0438	Sachiko Yamada	2b-methyl-3-epi-1b,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : 0.8. HL-60 cell differentiation : 3.0. DBP binding :1300. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0260)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0260)				[0260]
436		2a-methyl-20-epi-1a,25-dihydroxyvitamin D₃ / 2a-methyl-20-epi-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,2S,3R,20S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0439	Sachiko Yamada	2a-methyl-20-epi-1a,25-(OH)₂D₃.........................................	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : 1200. Bone calcium mobilization : 655. HL-60 cell differentiation : 59000. DBP binding : < 0.3 (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0261)							(EtOH) lmax (nm) 266 (Ref. 0261)		¹H-NMR (d, CDCl₃-D₂O, 400MHz) 0.53 (3H, s), 0.85 (3H, d, J = 6.7 Hz), 1.08 (3H, d, J = 6.8 Hz), 1.21 (6H, s), 2.23 (1H, dd, J = 7.9, 13.4 Hz), 2.67 (1H, dd, J = 4.0, 13.2 Hz), 2.83 (1H, dd, J= 4,0, 12.5 Hz), 3.83 (1H, ddd, J = 7.9, 4.4, 4.0 Hz), 4.29 (1H, d, J = 3.3 Hz), 5.01 (1H, m), 5.28 (1H, m), 6.01 (1H, d, J = 11.3 Hz), 6.39 (1H, d, J = 11.3 Hz) (Ref. 0261)	m/z 430 (M⁺), 412 (M⁺-H₂O), 394 (M⁺-2H₂O) (Ref. 0261)				The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0261)				[0261]
437		2b-methyl-20-epi-1a,25-dihydroxyvitamin D₃ / 2b-methyl-20-epi-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,2R,3R,20S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0440	Sachiko Yamada	2b-methyl-20-epi-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : 160. Bone calcium mobilization : 115. HL-60 cell differentiation : 2600. DBP binding : < 0.3. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0261)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0261)				[0261]
438		2a-methyl-3-epi-20-epi-1a,25-dihydroxyvitamin D₃ / 2a-methyl-3-epi-20-epi-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,2S,3S,20S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0441	Sachiko Yamada	2a-methyl-3-epi-20-epi-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : 17. Bone calcium mobilization : 144. HL-60 cell differentiation : 730. DBP binding : < 0.3. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0261)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0261)				[0261]
439		2b-methyl-3-epi-20-epi-1a,25-dihydroxyvitamin D₃ / 2b-methyl-3-epi-20-epi-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,2R,3S,20S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0442	Sachiko Yamada	2b-methyl-3-epi-20-epi-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : < 0.1. HL-60 cell differentiation : 6. DBP binding : < 0.3. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0261)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0261)				[0261]
440		2a-methyl-20-epi-1b,25-dihydroxyvitamin D₃ / 2a-methyl-20-epi-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,2S,3R,20S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0443	Sachiko Yamada	2a-methyl-20-epi-1b,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : < 0.1. HL-60 cell differentiation : 3. DBP binding : < 0.3. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0261)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0261)				[0261]
441		2b-methyl-20-epi-1b,25-dihydroxyvitamin D₃ / 2b-methyl-20-epi-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,2R,3R,20S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0444	Sachiko Yamada	2b-methyl-20-epi-1b,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : < 0.1. HL-60 cell differentiation : 1. DBP binding : < 0.3. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0261)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0261)				[0261]
442		2a-methyl-3-epi-20-epi-1b,25-dihydroxyvitamin D₃ / 2a-methyl-3-epi-20-epi-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,2S,3S,20S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0445	Sachiko Yamada	2a-methyl-3-epi-20-epi-1b,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : < 0.1. HL-60 cell differentiation : 1. DBP binding : < 0.3. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0261)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0261)				[0261]
443		2b-methyl-3-epi-20-epi-1b,25-dihydroxyvitamin D₃ / 2b-methyl-3-epi-20-epi-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,2R,3S,20S)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0446	Sachiko Yamada	2b-methyl-3-epi-20-epi-1b,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : 7. Bone calcium mobilization : 19. HL-60 cell differentiation : 190. DBP binding : < 0.3. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0261)														The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0261)				[0261]
444		1a,25-dihydroxy-11a-methylvitamin D₃ / 1a,25-dihydroxy-11a-methylcholecalciferol	(5Z,7E)-(1S,3R,11S)-11-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0447	Sachiko Yamada	11a-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		(% of 1a,25-(OH)₂D₃ effect) Affinity for rat duodenum receptor, UMR 106 cell receptor and human vitamin D binding protein: 230, 80 and 340, respectively; Differentiation of HL-60 cells: 113; Inhibition of the proliferation of peripheral blood mononuclear cells (PBMC): 90; Bone resorption: 100 (3 day), 100 (6 day); Biological activity in rachitic chick: serum calcium, 40; bone calcium, 46; serum osteocalcin, 50; calbindin D-28K, 60. <0224>>														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of organocopper reagent to 9(11)-en-8-one of the CD-ring fragment. (Ref. 0224)				[0224]
445		1a,25-dihydroxy-11b-methylvitamin D₃ / 1a,25-dihydroxy-11b-methylcholecalciferol	(5Z,7E)-(1S,3R,11R)-11-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0448	Sachiko Yamada	11b-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		(% of 1a,25-(OH)₂D₃ effect) Affinity for rat duodenum receptor and human vitamin D binding protein: 37 and 86, respectively; Differentiation of HL-60 cells: 19; Inhibition of the proliferation of peripheral blood mononuclear cells (PBMC): 1.4; Bone resorption: <1 (3 day), 1 (6 day); Biological activity in rachitic chick: serum calcium, 2; bone calcium, 5; serum osteocalcin, 5; calbindin D-28K, 3. <0224>>														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of organocopper reagent to 9(11)-en-8-one of the CD-ring fragment and inversion of the configuration at C(11) by introducing 9(11)-double bond followed by catalytic hydrogenation. (Ref. 0224)				[0224]
446		1a,25-dihydroxy-18-methylvitamin D₃ / 1a,25-dihydroxy-18-methylcholecalciferol	(5Z,7E)-(1S,3R)-18-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0449	Sachiko Yamada	18-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		(% of 1,25-(OH)₂D₃ effect) Affinity for calf thymus receptor and vitamin D binding protein: 100 and 100 ,respectively; differentiation of HL-60 cells: 50; intestinal calcium transport activity evaluated using Caco-2 intestinal cancer cell line: similarly potent as 1,25-(OH)₂D₃. (Ref. 0365)														From Inhoffen-Lythgoe diol (CD-ring plus 20-22 side chain) and A-ring enyne via palladium-catalyzed coupling. Modification of the methyl at C(18) was achieved via photo-irradiation in the presence of Pb(OAC)₄ and iodine as a key step. (Ref. 0365)				[0365]
447		1a,25-dihydroxy-24a-homovitamin D₃ / 1a,25-dihydroxy-24a-homocholecalciferol	(5Z,7E)-(1S,3R)-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0450	Sachiko Yamada	1a,25-(OH)₂-24a-homo-D₃	C₂₈H₄₆O₃	430.663		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 1.2 10^-⁹ M, 1.6 10^-⁹ M and 1.3 10^-⁹ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)							(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0196)			m/z 430 (M⁺ 5.5), 412 (51), 394 (100), 376 (18), 287 (3.8), 269 (9.4), 251 (21), 152 (9), 134 (28), 59 (7.1) (Ref. 0196)				From hydroxy protected (5E)-23,24,25,26,27-pentanorvitamin D₃ 22-bis(methylseleno)acetal via displacement of one methylseleno group by side chain fragment, reduction of the other methylseleno group via 6,19-SO₂ adduct, desulfonylation, dye-sensitized photoisomerization and deprotection. From hydroxy protected (5E)-22-tosyloxy-23,24,25,26,27-pentanorvitamin D₃ via cuprate catalyzed Grignard reaction, photoisomerization and deprotection. (Ref. 0285)				[0196] / [0228] / [0285]
448		(24R)-1a,25-dihydroxy-24-methylvitamin D₃ /(24R)-1a,25-dihydroxy-24-methylcholecalciferol	(5Z,7E)-(1S,3R,24R)-24-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0451	Sachiko Yamada	24R-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663
449		1a,25-dihydroxy-24a-homo-20-epivitamin D₃ / 1a,25-dihydroxy-24a-homo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20S)-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-1,3,25-triol	VVD0452	Sachiko Yamada		C₂₈H₄₆O₃	430.663		Biological activity (% of 1,25-(OH)₂D₃ effect) Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 31800 (IC50 : the title compound, 4.4 10^-¹¹ M ; 1,25-(OH)₂D₃, 1.4 10^-⁸ M) ; Induction of U 937 cell differentiation : 20000 ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 110 ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 500. Inhibitory effects on murine thymocyte activation : 38000 (IC50 : the title compound, 5.0 10^-¹³ M ; 1,25-(OH)₂D₃, 1.9 10^-¹⁰ M). (Ref. 0278)														From protected (5E)-1a-hydroxy-22-p-toluenesulfonyloxy-23,24,25,26,27-pentanorvitamin D₃ via introduction of the side chain by the reaction with Grignard reagent in the presence of copper catalyst, photoisomerization and deprotection. (Ref. 0284)				[0278] / [0284]
450		1a,25-dihydroxy-24a,24b-didihomo-22-thia-20-epivitamin D₃ / 1a,25-dihydroxy-24a,24b-didihomo-22-thia-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-24a,24b-dihomo-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0453	Sachiko Yamada	20-epi-22-thia-24a,24b-dihomo-1a,25-(OH)₂D₃	C₂₈H₄₆O₃S	462.729																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
451		1a,25-dihydroxy-24a,24b-dihomo-22-thiavitamin D₃ / 1a,25-dihydroxy-24a,24b-dihomo-22-thiacholecalciferol	(5Z,7E)-(1S,3R)-24a,24b-dihomo-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0454	Sachiko Yamada	22-thia-24a,24b-dihomo-1a,25-(OH)₂D₃	C₂₈H₄₆O₃S	462.729																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
452		1a,25-dihydroxy-26-methylvitamin D₃ / 1a,25-dihydroxy-26-methylcholecalciferol	(5Z,7E)-(1S,3R)-26-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0455	Sachiko Yamada	26-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		HL-60 human promyelocytes differentiation : ED50 in nitro blue tetrazplium reduction, phagocytic activity, and nonspecific acid esterase activity are 1.2 10^-⁹ M, 1.6 10^-⁹ M and 1.3 10^-⁹ M, respectively, when 1,25-(OH)₂D₃ shows the respective ED50 values of 1.0 10^-⁸ M, 1.0 10^-⁸ M and 1.1 10^-⁸ M, respectively. (Ref. 0228)																		[0228]
453		1a,25-dihydroxy-26-methylvitamin D₃ / 1a,25-dihydroxy-26-methylcholecalciferol	(5Z,7E)-(1S,3R)-26-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol(5Z,7E)-(1S,3R)-26-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0456	Sachiko Yamada	26-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663									(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0196)			m/z 430 (M⁺ 2.9), 412 (9.7), 394 (8.8), 379 (2.3), 376 (0.9), 287 (2.0), 269 (4.1), 251 (5.9), 152 (30), 134 (100), 116 (17), 73 (89), 55 (69) (Ref. 0196)								[0196]
454		1a,25-dihydroxy-26,27-dimethyl-22-thiavitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22-thiacholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0457	Sachiko Yamada	1a,25-(OH)₂-26,27-dimethyl-22-thia-D₃	C₂₈H₄₆O₃S	462.729																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
455		1a,25-dihydroxy-26,27-dimethyl-22-thia-20-epivitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22-thia-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-dimethyl-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0458	Sachiko Yamada	1a,25-(OH)₂-20-epi-26,27-dimethyl-22-thia-D₃	C₂₈H₄₆O₃S	462.729																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
456		(24R)-1a,24-dihydroxy-26,27-dimethyl-22-oxavitamin D₃ / (24R)-1a,24-dihydroxy-26,27-dimethyl-22-oxacholecalciferol	(5Z,7E)-(1S,3R,24R)-26,27-dimethyl-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0459	Sachiko Yamada	1a,24R-(OH)₂-26,27-dimethyl-22-oxa-D₃	C₂₈H₄₆O₄	446.662		The activity to induce differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation was shown in comparison with 1,25-(OH)₂D₃. (Ref. 0205)					[a] 43.47 (c = 0.115 in EtOH) (Ref. 0205)		(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0205)		¹H-NMR (d) 0.54 (3H, s), 0.89 (6H, t, J = 6.8 Hz), 1.19 (3H, d, J = 6.2 Hz), 3.16 (1H, t, J = 9.6 Hz) 3.30 (1H, br t, J = 6.4 Hz), 3.61-3.76 (2H, m), 4.16-4.28 (1H, br), 4.37-4.48 (1H, br), 4.99 (1H, s), 5.33 (1H, s), 6.02 (1H, d, J = 11.4 Hz), 6.37 (1H, d, J = 11.4 Hz) (Ref. 0205)	m/z 446 (M⁺), 97 (100%) (Ref. 0205)	HRMS Calcd 446.3396, Found 446.3394 (Ref. 0205)			Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-[2(R)-hydroxy-3-methylbutyloxy]pregna-5,7-diene by photochemical method. (Ref. 0205)				[0205]
457		(24S)-1a,24-dihydroxy-26,27-dimethyl-22-oxavitamin D₃ / (24S)-1a,24-dihydroxy-26,27-dimethyl-22-oxacholecalciferol	(5Z,7E)-(1S,3R,24S)-26,27-dimethyl-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,24-triol	VVD0460	Sachiko Yamada	1a,24S-(OH)₂-22-oxa-26,27-dimethyl-D₃	C₂₈H₄₆O₄	446.662		The activity to induce differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation was shown in comparison with 1,25-(OH)₂D₃. (Ref. 0205)					[a]_D 38.99 (c = 0.159 in EtOH) (Ref. 0205)		(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0205)		¹H-NMR (d) 0.53 (3H, s), 0.89 (6H, t, J = 6.8 Hz), 1.17 (3H, d, J = 6.2 Hz), 3.21-3.36 (2H, m), 3.46 (1H, t, J = 8.6 Hz), 3.60-3.72 (1H, br), 4.15-4.27 (1H, br), 4.36-4.46 (1H, br), 4.99 (1H, s), 5.33 (1H, s), 6.03 (1H, d, J = 11.6 Hz), 6.37 (1H, d, J = 11.6 Hz) (Ref. 0205)	m/z 446 (M⁺), 97 (100%) (Ref. 0205)	HRMS Calcd 446.3396, Found 446.3394 (Ref. 0205)			Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-[2(S)-hydroxy-3-methylbutyloxy]pregna-5,7-diene by photochemical method. (Ref. 0205)				[0205]
458		1a,25-dihydroxy-11a-methoxyvitamin D₃ / 1a,25-dihydroxy-11a-methoxycholecalciferol	(5Z,7E)-(1S,3R,11S)-11-methoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0461	Sachiko Yamada	1a,25-(OH)₂-11a-methoxy-D₃	C₂₈H₄₆O₄	446.662
459		1a,25-dihydroxy-11a-(hydroxymethyl)vitamin D₃ / 1a,25-dihydroxy-11a-(hydroxymethyl)cholecalciferol	(5Z,7E)-(1S,3R,11S)-11-(hydroxymethyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0462	Sachiko Yamada		C₂₈H₄₆O₄	446.662		Biological activity of C-ring analogs of 1a,25-(OH)₂D₃ (Ref. 0224)														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of vinylcopper reagent to 9(11)-en-8-one of the CD-ring fragment followed by appropriate modification of the vinyl group. (Ref. 0224)				[0224]
460		1a,25-dihydroxy-11b-methoxyvitamin D₃ / 1a,25-dihydroxy-11b-methoxycholecalciferol	(5Z,7E)-(1S,3R,11R)-11-methoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0463	Sachiko Yamada	1a,25-(OH)₂-11b-methoxy-D₃	C₂₈H₄₆O₄	446.662
461		(20S)-1a,25-dihydroxy-20-methoxyvitamin D₃ / (20S)-1a,25-dihydroxy-20-methoxycholecalciferol	(5Z,7E)-(1S,3R,20S)-20-methoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0464	Sachiko Yamada	20S-methoxy-1a,25-(OH)₂D₃	C₂₈H₄₆O₄	446.662		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 900% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 2% ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 8%. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by methylation, photochemical isomerization and deprotection. (Ref. 0279)				[0279]
462		1a,25-dihydroxy-24a,24b-dihomo-22-oxavitamin D₃ / 1a,25-dihydroxy-24a,24b-dihomo-22-oxacholecalciferol	(5Z,7E)-(1S,3R)-24a,24b-dihomo-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0465	Sachiko Yamada	22-oxa-24a,24b-dihomo-1a,25-(OH)₂D₃	C₂₈H₄₆O₄	446.662		The activity inducing differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : ED50 = 8.61 10^-⁹ M [ED50 of 1,25-(OH)₂D₃ : 1.70 10^-⁸ M, ED50 of OCT : 1.78 10^-⁸ M]. (Ref. 0203)							(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0203)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 1.16 (3H, d, J = 6.1 Hz), 1.21 (6H, s), 3.17-3.25 (2H, m), 3.51- 3.58 (1H, m), 4.23 (1H, m), 4.41 (1H, m), 5.00 (1H, br t), 5.33 (1H, br t), 6.03 (1H, d, J = 10.9 Hz), 6.38 (1H, d, J = 10.9 Hz) (Ref. 0203)	m/z 446 (M⁺), 96 (100%) (Ref. 0203)	Colorless foam. (Ref. 0203)	1)Flash column chromatography with CH₂Cl₂/EtOH (9 : 1), 2)Preparative TLC developed twice with AcOEt. (Ref. 0203)		Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-(5-hydroxy-5-methylhexyloxy)pregna-5,7-diene by photochemical method. (Ref. 0203)				[0203]
463		1a,25-dihydroxy-24a,24b-dihomo-22-oxa-20-epivitamin D₃ / 1a,25-dihydroxy-24a,24b-dihomo-22-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-24a,24b-dihomo-22-oxa-9,10-seco-5,7,10(19) -cholestatrien-1,3,25-triol	VVD0466	Sachiko Yamada		C₂₈H₄₆O₄	446.662		Biological activity (% of 1,25-(OH)₂D₃ effect) Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 33300 (IC50 : the title compound, 4.2 10^-¹¹ M ; 1,25-(OH)₂D₃, 1.4 10^-⁸ M) ; Induction of U 937 cell differentiation : 40000 ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 35 ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 140. (Ref. 0278)																		[0278]
464		1a,25-dihydroxy-26,27-dimethyl-22-oxavitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22-oxacholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0467	Sachiko Yamada	1a,25-(OH)₂-22-oxa-26,27-dimethyl-D₃	C₂₈H₄₆O₄	446.662		The activity inducing differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : ED50 = 1.48 10^-⁹ M, ED50 of 1,25-(OH)₂D₃ : 1.70 10^-⁸ M, ED50 of OCT : 1.78 10^-⁸ M. the binding properties to the chick embryonic intestinal 1,25-(OH)₂D₃ receptor : 50%, 1,25-(OH)₂D₃ : 100%, OCT : 12.5%. (Ref. 0203)							(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0203)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 0.86 (6H, t, J = 8.0 Hz), 1.18 (3H, d, J = 7.9 Hz), 3.25 (1H, br t, J = 7.4 Hz), 3.38-3.51 (1H, m), 3.72-3.88 (1H, m), 4.14-4.28 (1H, br), 4.36-4.48 (1H, br), 4.98 (1H, s), 5.31 (1H, s), 6.01 (1H, d, J = 11.4 Hz), 6.35 (1H, d, J = 11.4 Hz) (Ref. 0203)	m/z 446 (M⁺), 97 (100%) (Ref. 0203)	colorless foam (Ref. 0203)	Flash column chromatography with CH₂Cl₂/EtOH (12.5 : 1) (Ref. 0203)		Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-(3-ethyl-3-hydroxypentyloxy)pregna-5,7-diene by photochemical method. (Ref. 0203)				[0203]
465		1a,25-dihydroxy-24a,24b-dihomo-23-oxavitamin D₃ / 1a,25-dihydroxy-24a,24b-dihomo-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-24a,24b-dihomo-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0468	Sachiko Yamada	23-oxa-24a,24b-dihomo-1a,25-(OH)₂D₃	C₂₈H₄₆O₄	446.662		Biological activity : Affinity for pig intestinal nuclear receptor, 50% of 1,25-(OH)₂D₃ effect ; Affinity for human vitamin D binding protein, < 0.02% of 25-OHD₃ effect ; Differentiation of HL-60 cells, 100% of 1,25-(OH)₂D₃ effect ; Calciuric effect, 1% of 1,25-(OH)₂D₃ effect. (Ref. 0299)														From protected (5E)-1a,22-dihydroxy-23,24,25,26,27-pentanorvitamin D₃ via alkylation under phase-transfer conditions, Grignard reaction, photoisomerization, and deprotection. (Ref. 0299/0300/0153)				[0153] / [0299] / [0300]
466		1a,25-dihydroxy-24a,24b-dihomo-23-oxa-20-epivitamin D₃ / 1a,25-dihydroxy-24a,24b-dihomo-23-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-24a,24b-dihomo-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0469	Sachiko Yamada	20-epi-23-oxa-24a,24b-dihomo-1a,25-(OH)₂D₃	C₂₈H₄₆O₄	446.662		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of cell (U 937) proliferation, 100000% ; Induction of cell (U 937) differentiation, 200000%; Inhibition of T-cell (murine MLR) activation, 8000% ; Vitamin D receptor (chick intestine) binding, 60% ; Calciuric effect (urinary calcium excretion in rats), 60%. (Ref. 0292)							(EtOH) lmax (nm) (emax) 264 (17400) (Ref. 0292)		¹H-NMR (d, CDCl₃, SiMe₄, 300MHz) 0.56 (3H, s, 18-H₃), 0.95 (3H, d, J = 6.6 Hz, 21-H₃), 1.23 (6H, s, 26- and 27-H₃), 2.31 (1H, dd, J = 7 and 13 Hz, 4b-H), 2.52 (1H, bs, exchanges with D₂O, 25-OH), 2.59 (1H, bd, J = 13 Hz, 4a-H), 2.83 (1H, bd, J = 12 Hz, 9b-H), 3.20 (1H, dd, J = 7.5 and 9 Hz, 22-H), 3.42 (2H, m, 24-H₂), 3.51 (1H, dd, J = 4 and 9 Hz, 22-H), 4.23 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.00 (1H, br s, 19E-H), 5.33 (1H, br s, 19Z-H), 6.02 and 6.38 (each 1H, J = 11.3 Hz, 7- and 6-H) (Ref. 0292)					From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via C-20 epimerization, reduction, coupling with side chain bromide, photoisomerization and deprotection. (Ref. 0292)				[0292]
467		1a,25-dihydroxy-26,27-dimethyl-23-oxavitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0470	Sachiko Yamada	23-oxa-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₄	446.662		Biological activity : Affinity for pig intestinal nuclear receptor, 50% of 1,25-(OH)₂D₃ effect ; Affinity for human vitamin D binding protein, < 0.02% of 25-OHD₃ effect ; Differentiation of HL-60 cells, 143% of 1,25-(OH)₂D₃ effect ; Calciuric effect, < 20% of 1,25-(OH)₂D₃ effect. (Ref. 0299)														From protected (5E)-1a,22-dihydroxy-23,24,25,26,27-pentanorvitamin D₃ via alkylation under phase-transfer conditions, Grignard reaction, photoisomerization, and deprotection. (Ref. 0299/0300/0153)				[0153] / [0299] / [0300]
468		(20S)-1a,20,25-trihydroxy-24a-homovitamin D₃ / (20S)-1a,20,25-trihydroxy-24a-homocholecalciferol	(5Z,7E)-(1S,3R,20S)-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,20,25-tetrol	VVD0471	Sachiko Yamada	24a-homo-1a,20S,25-(OH)₃D₃	C₂₈H₄₆O₄	446.662		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 70% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 0.04% ; Calcemic activity : not determined. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by photochemical isomerization and deprotection. (Ref. 0279)				[0279]
469		(23R)-1a,23,25-trihydroxyvitamin D₃ / (23R)-1a,23,25-trihydroxycholecalciferol	(5Z,7E)-(1S,3R,23R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,23,25-tetrol	VVD0472	Sachiko Yamada	1a,23R,25-(OH)₃D₃	C₂₈H₄₆O₄	446.662		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of human keratinocytes in culture, 100 ; Intestinal calcium absorption in rat, 6 ; Bone calcium mobilization in rat, 0 ; Competitive binding to rat intestinal vitamin D receptor, 1 ; Differentiation of human leukemia cells (HL-60), 50. (Ref. 0237)																		[0237]
470		(23R)-1a,23,25-trihydroxy-23-methylvitamin D₃ / (23R)-1a,23,25-trihydroxy-23-methylcholecalciferol	(5Z,7E)-(1S,3R,23R)-23-methyl-9,10-seco-5,7,10(19)-cholestatrien-1,3,23,25-tetrol	VVD0473	Sachiko Yamada	1a,23R,25-(OH)₃-23-methyl-D₃	C₂₈H₄₆O₄	446.662
471		1a-hydroxy-22-(3-methylphenyl)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-22-(3-methylphenyl)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-22-(3-methylphenyl)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0474	Sachiko Yamada		C₂₉H₄₀O₂	420.627		(% of 1,25-(OH)₂D₃ effect) Intestinal calcium absorption: 0.3; bone calcium mobilization: 0.06; affinity for chick intestinal receptor and HL-60 cell receptor 1.4 and 3.5, respectively; Inhibition of 1a-hydroxylase activity: 96; differentiation of HL-60 cells: 15. (Ref. 0364)																		[0364]
472		(17Z)-1a,25-dihydroxy-26,27-dimethyl-17,20,22,22,23,23-hexadehydrovitamin D₃ / (17Z)-1a,25-dihydroxy-26,27-dimethyl-17,20,22,22,23,23-hexadehydrocholecalciferol	(5Z,7E,17Z)-(1S,3R)-26,27-dimethyl-9,10-seco-5,7,10(19),17(20)-cholestatetraen-22-yne-1,3,25-triol	VVD0475	Sachiko Yamada	17(20)Z-ene-22-yne-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₂O₃	438.642		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 3200% ; Affinity for chicken intestinal vitamin D receptor, 7%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ via reaction with appropriate lithium acetylide, treatment with acid, separation of regio- and stereoisomers, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
473		1a,25-dihydroxy-26,27-dimethyl-20,21,22,22,23,23-hexadehydrovitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-20,21,22,22,23,23-hexadehydrocholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-9,10-seco-5,7,10(19),20-cholestatetraen-22-yne-1,3,25-triol	VVD0476	Sachiko Yamada	20-ene-22-yne-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₂O₃	438.642		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 140% ; Affinity for chicken intestinal vitamin D receptor, 87%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ via reaction with appropriate lithium acetylide, treatment with acid, separation of regio- and stereoisomers, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
474		24a,24b-epoxy-23-tetradehydro-24a,24b-dihomo-1a,25-dihydroxyvitamin D₃ / 24a,24b-epoxy-23-tetradehydro-24a,24b-dihomo-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-24a,24b-dihomo-24a,24b-epoxy-9,10-seco-5,7,10(19)-cholestatriene-23-yne-1,3,25-triol	VVD0477	Sachiko Yamada	24a,24b-epoxy-23-yne-24a,24b-dihomo-1a,25-(OH)₂D₃	C₂₉H₄₂O₄	454.641		Biological activity (% of 1,25-(OH)₂D₃ effect) : Affinity for pig intestinal receptor and human vitamin D binding protein : 3 and, respectively. Inhibition of proliferation or differentiation induction of human promyeloid leukemia (HL-60) and osteosarcoma (MG-63) cells : 4 and 1, respectively. (Ref. 0240)														By epoxidation of the corresponding olefinic precursor which was constructed from Inhoffen-Lythgoe diol. (Ref. 0240)				[0240]
475		11a-ethynyl-1a,25-dihydroxyvitamin D₃ / 11a-ethynyl-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,11S)-11-ethynyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0478	Sachiko Yamada	11a-ethynyl-1a,25-(OH)₂D₃	C₂₉H₄₄O₃	440.658
476		(22E,24E)-1a,25-dihydroxy-22,23,24,24a-tetradehydro-24a,24b-dihomovitamin D₃ / (22E,24E)-1a,25-dihydroxy-22,23,24,24a-tetradehydro-24a,24b-dihomocholecalciferol	(5Z,7E,22E,24E)-(1S,3R)-24a,24b-dihomo-9,10-seco-5,7,10(19),22,24-cholestapentaene-1,3,25-triol	VVD0479	Sachiko Yamada	(22E,24E)-22,23,24,24a-tetradehydro-24a,24b-dihomo-1a,25-(OH)₂D₃	C₂₉H₄₄O₃	440.658		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 500% ; Induction of differentiation of U 937 cells, 600% ; Calciuric activity, 30%. (Ref. 0285)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction, photoisomerization and deprotection. (Ref. 0285)				[0285]
477		1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydrovitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-cholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatrien-22-yne-1,3,25-triol	VVD0480	Sachiko Yamada	22-yne-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₄O₃	440.658		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 350% ; Affinity for chicken intestinal vitamin D receptor, 89%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-22,22,23,23-tetradehydro-24,25,26,27-tetranorvitamin D₃, which was derived from corresponding 22-aldehyde, via side chain introduction, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
478		1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-20-epivitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatrien-22-yne-1,3,25-triol	VVD0481	Sachiko Yamada	20-epi-22-yne-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₄O₃	440.658		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 390% ; Affinity for chicken intestinal vitamin D receptor, 27%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-22,22,23,23-tetradehydro-24,25,26,27-tetranor-20-epivitamin D₃, which was derived from corresponding 22-aldehyde, via side chain introduction, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
479		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydrovitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydrocholecalciferol	(5Z,7E)-(1S,3R,22S)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0482	Sachiko Yamada	23-yne-26,27-dimethyl-1a,22S,25-(OH)₃D₃	C₂₉H₄₄O₄	456.657
480		(22R)-1a,22,25-trihydroxy-23,24-tetradehydro-24a,24b-dihomo-20-epivitamin D₃ / (22R)-1a,22,25-trihydroxy-23,24-tetradehydro-24a,24b-dihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22R)-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0483	Sachiko Yamada	23,24-tetradehydro-24a,24b-dihomo-20-epi-1a,22R,25-(OH)₃D₃	C₂₉H₄₄O₄	456.657		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 0.02 ; Inhibition of proliferation, < 0.05 ; VDR (rachitic chicken intestinal receptor) binding affinity, < 0.005. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving minor (1:19) 22R-hydroxy product. (Ref. 0321)				[0321]
481		(22S)-1a,22,25-trihydroxy-23,24-tetradehydro-24a,24b-dihomo-20-epivitamin D₃ / (22S)-1a,22,25-trihydroxy-23,24-tetradehydro-24a,24b-dihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0484	Sachiko Yamada	23,24-tetradehydro-24a,24b-dihomo-20-epi-1a,22S,25-(OH)₃D₃	C₂₉H₄₄O₄	456.657		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 10 ; Inhibition of proliferation, 12 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.005 ; Calciuric effect in normal rats, 0.3. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
482		(22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-20-epivitamin D₃ / (22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22R)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0485	Sachiko Yamada	26,27-dimethyl-23,24-tetradehydro-20-epi-1a,22R,25-(OH)₃D₃	C₂₉H₄₄O₄	456.657		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 1; Inhibition of proliferation, 1.1 ; VDR (rachitic chicken intestinal receptor) binding affinity, < 0.003. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving minor (1:19) 22R-hydroxy product. (Ref. 0321)				[0321]
483		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-20-epivitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0486	Sachiko Yamada	26,27-dimethyl-23,24-tetradehydro-20-epi-1a,22S,25-(OH)₃D₃	C₂₉H₄₄O₄	456.657		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 100 ; Inhibition of proliferation, 190 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.19 ; Calciuric effect in normal rats, 8.2. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
484		24,24-difluoro-1a,25-dihydroxy-26,27-dimethylvitamin D₃ / 24,24-difluoro-1a,25-dihydroxy-26,27-dimethylcholecalciferol	(5Z,7E)-(1S,3R)-24,24-difluoro-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatrien-1,3,25-triol	VVD0487	Sachiko Yamada	24,24-difluoro-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₆F₂O₃	480.671		Binding affinity for chick intestinal receptor : 53% of that of 1,25-(OH)₂D₃. Binding affinity for vitamin D binding protein in rat serum : 4% of that of 1,25-(OH)₂D₃. Potency of the title compound in ⁴⁵Ca release from neonatal mouse parietal bones in culture: higher than that of 1,25-(OH)₂D₃. Potency in the formation of osteoclast-like cells : 100 times of that of 1,25-(OH)₂D₃. Potency in bone calcium mobilization in vitamin D deficient rats : slightly lower than that of 1,25-(OH)₂D₃. Potency in intestinal Ca transport response in situ : similar to 1,25-(OH)₂D₃. (Ref. 0246)																		[0246]
485		vitamin D₆	(5Z,7E,22E)-(3S,24R)-24-ethyl-9,10-seco-5,7,10(19),22-cholestatetraen-3-ol	VVD0488	Sachiko Yamada	D₆	C₂₉H₄₆O	410.675		Antirachitic activity: <1% of the effect of vitamin D₃. (Ref. 0370)																		[0370]
486		provitamin D₆	(22E)-(3S,24R)-24-ethyl-5,7,22-cholestatrien-3-ol	VVD0489	Sachiko Yamada	pro-D₆	C₂₉H₄₆O	410.675
487		1a-hydroxy-24-methylvitamin D₂ / 1a-hydroxy-24-methylergocalciferol	(5Z,7E)-(1S,3R)-24-methyl-9,10-seco-5,7,10(19),22-ergostatetraene-1,3-diol	VVD0490	Sachiko Yamada	22-methyl-1a-OHD₂	C₂₉H₄₆O₂	426.674		Increases in Serum Calcium and Inorganic Phosphorus Concentration and Decrease in Alkaline Phosphatase Activity in Response to 1a-OH-24,24-Me₂-D²²-D₃, 1a,25-(OH)₂-24,24-Me₂-D²²-D₃ and 1a-OH-D₃. (Ref. 0160)							lmax (nm) 265 lmin (nm) 228 (Ref. 0160)		¹H-NMR (d, CDCl₃, 400MHz) 0.56 (3H, s, 18-H₃), 0.81 (6H, d, J = 6.8 Hz, 26-, 27-H₃), 0.89 (6H, s, 24-CH₃), 1.01 (3H, d, J = 6.6 Hz, 21-H₃), 4.23 (1H, m, W₁_/₂ = 18.4 Hz, 3a-H), 4.43 (1H, m, W₁_/₂ = 16.9 Hz, 1b-H), 5.00 (1H, br s, W₁_/₂ = 3.2 Hz, 19-H), 5.10 (1H, dd, J = 15.9, 8.6 Hz, 22-H), 5.27 (1H, d, J = 15.9 Hz, 23-H), 5.32 (1H, br s, W₁_/₂ = 3.2 Hz, 19-H), 6.02 (1H, d, J = 11.5 Hz, 7-H), 6.38 (1H, d, J = 11.5 Hz, 6-H) (Ref. 0160)	m/z 426 (M⁺), 408 (M⁺-18), 390 (M⁺-2 18), 383 (M⁺-43, C₂₄-C₂₅ cleavage), 365 (383-18), 347 (383-2 18), 287 (M⁺-139, C₁₇-C₂₀ cleavage), 269 (287-18), 251 (287-2 18), 152 (C₇-C₈ cleavage), 134 (152-18, base peak), 116 (152-2 18) (Ref. 0160)								[0160]
488		18-acetoxy-vitamin D₃ / 18-acetoxy-cholecalciferol	(5Z,7E)-(3S)-18-acetoxy-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0491	Sachiko Yamada	18-acetoxy-D₃	C₂₉H₄₆O₃	442.674		Intestinal calcium absorption (ICA) and bone calcium mobilization (BCM) evaluated in vivo in comparison to 1,25-(OH)₂D₃ (100%) in the vitamin D deficient chick system (ref. 17) : ICA, < 0.03% ; BCM, < 0.2%. Affinity to the chick intestinal receptor relative to 1,25-(OH)₂D₃ (100%) : < 0.001%. (Ref. 0236)														Convergent synthesis from upper part (CD ring ketone with side chain) and lower part (A-ring plus seco-B-ring part) phosphine oxide by Horner-Wittig coupling. Upper part with 18-acetoxy modification was derived from Grundmann				[0236]
489		1a,25-dihydroxy-11a-vinylvitamin D₃ / 1a,25-dihydroxy-11a-vinylcholecalciferol	(5Z,7E)-(1S,3R,11S)-11-vinyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0492	Sachiko Yamada	11a-vinyl-1a,25-(OH)₂D₃	C₂₉H₄₆O₃	442.674		Biological activity of C-ring analogs of 1a,25-(OH)₂D3 (Ref. 0224)														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of organocopper reagent to 9(11)-en-8-one of the CD-ring fragment. (Ref. 0224)				[0224]
490		(22E)-1a,25-dihydroxy-26,27-dimethyl-22,23-didehydrovitamin D₃ / (22E)-1a,25-dihydroxy-26,27-dimethyl-22,23-didehydrocholecalciferol	(5Z,7E,22E)-(1S,3R)-26,27-dimethyl-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0493	Sachiko Yamada	(22E)-22-ene-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₆O₃	442.674
491		1a,25-dihydroxy-24-methylvitamin D₂ / 1a,25-dihydroxy-24-methylergocalciferol	(5Z,7E,22E)-(1S,3R)-24-methyl-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,25-triol	VVD0494	Sachiko Yamada	24-methyl-1a,25-(OH)₂D₂	C₂₉H₄₆O₃	442.674		Increases in Serum Calcium and Inorganic Phosphorus Concentration and Decrease in Alkaline Phosphatase Activity in Response to 1a-OH-24,24-Me₂-D²²-D₃, 1a,25-(OH)₂-24,24-Me₂-D²²-D₃ and 1a-OH-D₃. (Ref. 0160)							lmax (nm) 265 lmin (nm) 228 (Ref. 0160)		¹H-NMR (d, CDCl₃, 400MHz) 0.56 (3H, s, 18-H₃), 1.02 (3H, s, 24-CH₃), 1.03 (3H, s, 24-CH₃), 1.16 (6H, s, 26-, 27-H₃), 4.23 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.00 (1H, br s, 19-H), 5.28 (1H, dd, J = 15.9, 8.6 Hz, 22-H), 5.32 (1H, br s, 19-H), 5.69 (1H, d, J = 15.9 Hz, 23-H), 6.02 (1H, d, J = 11.5 Hz, 7-H), 6.38 (1H, d, J = 11.5 Hz, 6-H) (Ref. 0160)	m/z 424 (M⁺-18), 406 (M⁺-2 18), 383 (M⁺-59, C₂₄-C₂₅ cleavage), 365 (383-18), 347 (383-2 18), 287 (M⁺-155, C₁₇-C₂₀ cleavage), 269 (287-18), 251 (287-2 18), 155 (side chain), 152 (C₇-C₈ cleavage), 134 (152-18, base peak), 116 (152-2 18), 96 (155-59), 59 (C₂₄-C₂₅ cleavage) (Ref. 0160)								[0160]
492		1a,25-dihydroxy-22,23-didehydro-24a,24b-dihomovitamin D₃ /1a,25-dihydroxy-22,23-didehydro-24a,24b-dihomocholecalciferol	(5Z,7E,22E)-(1S,3R)-24a,24b-dihomo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0495	Sachiko Yamada	22-dehydro-24-dihomo-1a,25-(OH)₂D₃	C₂₉H₄₆O₃	442.674		The title compound is approximately 10 times more active than 1,25-(OH)₂D₃ in differentiating HL-60 cells, whereas it is approximately 1000 times less active in mobilizing skeletal calcium than is 1,25-(OH)₂D₃. (Ref. 0158)							(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0158)		¹H-NMR (d, CDCl₃) 0.55 (3H, s, 18-CH₃), 1.0 (3H, d, J = 6.6 Hz, 21-CH₃), 1.23 (6H, s, 26, 27-CH₃), 4.23 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.00 (1H, br s, 1.9Z-H), 5.32 (1H, br s, 19E-H), 5.29 (2H, m, 22- and 23-H), 6.01 (1H, d, J = 11.3 Hz, 7-H), 6.36 (1H, d, J = 11.2 Hz) (Ref. 0158)	m/z 442 (M⁺, 15), 424 (23), 406 (33), 391 (7), 287 (11), 285 (10), 269 (27), 251 (23), 152 (33), 134 (100), 116 (6), 59 (20) (Ref. 0158)				From 1a-hydroxylated pentanorvitamin D 22-calboxaldehyde and C(7) side chain fragment with terminal phenylsulfonyl group. (Ref. 0158)				[0158]
493		1a,25-dihydroxy-26,27-ethanovitamin D₃ / 1a,25-dihydroxy-26,27-ethanocholecalciferol	(5Z,7E)-(1S,3R)-26,27-ethano-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0496	Sachiko Yamada	26,27-ethano-1a,25-(OH)₂D₃	C₂₉H₄₆O₃	442.674									(10% 2-propanol in hexane) lmax (nm) 264, lmin (nm) 228, A264/A228 = 1.71 (Ref. 0192)	(Film) 3360, 2930, 1605, 1442, 1378, 1291, 1145, 1105, 1080, 1062 cm^-¹ (Ref. 0192)	¹H-NMR (d, CD₃OD, 270 or 400MHz) 0.48 (3H, s, 18-CH₃), 0.87 (3H, d, J = 6.4 Hz, 21-CH₃), 4.03 (1H, m, 3-H), 4.25 (1H, m, 1-H), 4.80 (1H, br s, 19Z-H), 5.19 (1H, br s, 19E-H), 5.98 (1H, d, J = 11.2 Hz, 7-H), 6.23 (1H, d, J = 11.1 Hz, 6-H) (Ref. 0192)	m/z 442 (M⁺, 5), 424 (43), 406 (38), 388 (7), 373 (7), 298 (6), 285 (12), 269 (20), 251 (24), 134 (100), 85 (28) (Ref. 0192)								[0192]
494		18-acetoxy-1a-hydroxyvitamin D₃ / 18-acetoxy-1a-hydroxycholecalciferol	(5Z,7E)-(1S,3R)-18-acetoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0497	Sachiko Yamada	18-acetoxy-1a-OHD₃	C₂₉H₄₆O₄	458.673		Intestinal calcium absorption (ICA) and bone calcium mobilization (BCM) evaluated in vivo in comparison to 1,25-(OH)₂D₃ (100%) in the vitamin D deficient chick system (ref. 17) : ICA, < 0.05% ; BCM, < 0.3%. Affinity to the chick intestinal receptor relative to 1,25-(OH)₂D₃ (100%) : 0.017 0.010%. (Ref. 0236)														Convergent synthesis from upper part (CD ring ketone with side chain) and lower part (A-ring plus seco-B-ring part) phosphine oxide by Horner-Wittig coupling. Upper part with 18-acetoxy modification was derived from Grundmann				[0236]
495		18-acetoxy-25-hydroxyvitamin D₃ / 18-acetoxy-25-hydroxycholecalciferol	(5Z,7E)-(3S)-18-acetoxy-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0498	Sachiko Yamada	18-acetoxy-25-OHD₃	C₂₉H₄₆O₄	458.673		Intestinal calcium absorption (ICA) and bone calcium mobilization (BCM) evaluated in vivo in comparison to 1,25-(OH)₂D₃ (100%) in the vitamin D deficient chick system (ref. 17) : ICA, < 0.05% ; BCM, < 0.3%. Affinity to the chick intestinal receptor relative to 1,25-(OH)₂D₃ (100%) : < 0.01%. (Ref. 0236)														Convergent synthesis from upper part (CD ring ketone with side chain) and lower part (A-ring plus seco-B-ring part) phosphine oxide by Horner-Wittig coupling. Upper part with 18-acetoxy and 25-hydroxy modifications was derived from Grundmann				[0236]
496		1a,25-dihydroxy-11a-[(1R)-oxiranyl]vitamin D₃ / 1a,25-dihydroxy-11a-[(1R)-oxiranyl]cholecalciferol	(5Z,7E)-(1S,3R,11S)-11-[(1R)-oxiranyl]-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0499	Sachiko Yamada		C₂₉H₄₆O₄	458.673		(% of 1,25-(OH)₂D₃ effect) Affinity for rat intestinal receptor and human vitamin D binding protein: 2 and 80, respectively; Differentiation of HL-60 cells: <1. (Ref. 0359)																		[0359]
497		1a,25-dihydroxy-11a-[(1S)-oxiranyl]vitamin D₃ / 1a,25-dihydroxy-11a-[(1S)-oxiranyl]cholecalciferol	(5Z,7E)-(1S,3R,11S)-11-[(1S)-oxiranyl]-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0500	Sachiko Yamada		C₂₉H₄₆O₄	458.673		(% of 1,25-(OH)₂D₃ effect) Affinity for rat intestinal receptor and human vitamin D binding protein: 1 and 62, respectively; Differentiation of HL-60 cells: <1. (Ref. 0359)																		[0359]
498		1a,25-dihydroxy-26,27-dimethyl-20,21-methano-23-oxavitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-20,21-methano-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-20,21-methano-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0501	Sachiko Yamada	20,21-methano-23-oxa-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₆O₄	458.673		Biological activity : Affinity for pig intestinal nuclear receptor, 50% of 1,25-(OH)₂D₃ effect ; Affinity for human vitamin D binding protein, < 0.02% of 25-OHD₃ effect ; Differentiation of HL-60 cells, 20% of 1,25-(OH)₂D₃ effect ; Calciuric effect, 100% of 1,25-(OH)₂D₃ effect. (Ref. 0299)																		[0299]
499		18-acetoxy-1a,25-dihydroxyvitamin D₃ / 18-acetoxy-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-18-acetoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0502	Sachiko Yamada	18-acetoxy-1a,25-(OH)₂D₃	C₂₉H₄₆O₅	474.673		Intestinal calcium absorption (ICA) and bone calcium mobilization (BCM) evaluated in vivo in comparison to 1,25-(OH)₂D₃ (100%) in the vitamin D deficient chick system (ref. 17) : ICA, < 0.15% ; BCM, < 1.0%. Affinity to the chick intestinal receptor relative to 1,25-(OH)₂D₃ (100%) : 0.036 0.021%. (Ref. 0236)														Convergent synthesis from upper part (CD ring ketone with side chain) and lower part (A-ring plus seco-B-ring part) phosphine oxide by Horner-Wittig coupling. Upper part with 18-acetoxy and 25-hydroxy modifications was derived from Grundmann's alcohol via light-induced lead tetraacetate oxidation and ruthenium tetraoxide oxidation as key steps. (Ref. 0236)				[0236]
500		vitamin D₅	(5Z,7E)-(3S,24S)-24-ethyl-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0503	Sachiko Yamada	D₅	C₂₉H₄₈O	412.691		Antirachitic activity: <2% of the effect of vitamin D3. (Ref. 0371)																		[0371]
501		provitamin D₅	(3S,24S)-24-ethyl-5,7-cholestadien-3-ol	VVD0504	Sachiko Yamada	pro-D₅	C₂₉H₄₈O	412.691
502		1a-hydroxy-26,27-dimethylvitamin D₃ / 1a-hydroxy-26,27-dimethylcholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0505	Sachiko Yamada	26,27-dimethyl-1a-OHD₃	C₂₉H₄₈O₂	428.690		Binding affinity of the title compound for serum vitamin D binding protein (DBP) relative to 25-OHD₃ was < 0.01%. Binding affinity for the receptor of HL-60 cells was 0.1% of that of 1,25-(OH)₂D₃. (Ref. 0275)							lmax (nm) 265, lmin (nm) 228 (Ref. 0277)		¹H-NMR (d, CDCl₃) 0.54 (3H, s, 18-H₃), 0.83 (6H, t, J = 7.0 Hz, 26- and 27-CH₃), 0.92 (3H, d, J = 6.1 Hz, 21-H₃), 4.24 (1H, m, 3-H), 4.36 (1H, m, 1-H), 5.01 (1H, br s, 19Z-H), 5.33 (1H, br s, 19E-H), 6.03 (1H, d, J = 11.0 Hz, 7-H), 6.39 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0277)	m/z 428 (M⁺), 410, 392, 287, 269, 251, 152, 134 (Ref. 0277)				From 3b-hydroxycholenic acid via steps of 1a-hydroxylation, side chain construction, introduction of 5,7-diene structure and conventional photochemical conversion. (Ref. 0277)				[0275] / [0277]
503		25-hydroxy-26,27-dimethylvitamin D₃ / 25-hydroxy-26,27-dimethylcholecalciferol	(5Z,7E)-(3S)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0506	Sachiko Yamada	26,27-dimethyl-25-OHD₃	C₂₉H₄₈O₂	428.690		Binding affinity of the title compound for serum vitamin D binding protein (DBP) relative to 25-OHD₃ was 66.7%. Binding affinity for the receptor of HL-60 cells was 0.9% of that of 1,25-(OH)₂D₃. (Ref. 0275)							lmax (nm) 265, lmin (nm) 228 (Ref. 0277) (EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0312)		¹H-NMR (d, CDCl₃) 0.54 (3H, s, 18-H₃), 0.858 and 0.860 (6H, each t, J = 7.6 Hz, 26- and 27-CH₃), 0.97 (3H, d, J = 6.6 Hz, 21-H₃), 1.47 (q, J = 7.6 Hz, 26- and 27--H₂), 3.95 (1H, m, 3-H), 4.82 (1H, br s, 19E-H), 5.05 (1H, br s, 19Z-H), 6.03 (1H, d, J = 11.0 Hz, 7-H), 6.24 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0277) ¹H-NMR (d, CDCl₃) 0.54 (3H, s, 18-CH₃), 3.94 (1H, m, 3a-H), 4.82 (1H, m, 19-H), 5.04 (1H, m, 19-H), 6.00 (1H, d, J = 11.22 Hz, 7-H), 6.25 (1H, d, J = 11.22 Hz, 6-H) (Ref. 0312)	m/z 428 (M⁺),410, 395, 271, 253, 136, 118, 87 (Ref. 0277) m/z 428 (M⁺, 4.24), 410 (M⁺-H₂O, 27.12), 392 (M⁺-2H₂O, 22.03), 377 (392-CH₃, 3.39), 271 (M⁺-side chain, 5.93), 253 (M⁺-side chain-H₂O, 32.20), 136 (ring A plus C₆ and C₇, 91.53), 118 (136-H₂O, 79.66), 87 (C₅H₁₁O, 12.71) (Ref. 0312)				From 3b-hydroxycholenic acid via steps of side chain construction, introduction of 5,7-diene structure and conventional photochemical conversion. (Ref. 0277) From 4-cholenoic acid by a conventional method including transformation to the corresponding provitamin D followed by photochemical conversion. (Ref. 0312)				[0275] / [0277] / [0312]
504		(6S)-6,19-ethano-25-hydroxy-6,19-dihydrovitamin D₃ / (6S)-6,19-ethano-25-hydroxy-6,19-dihydrocholecalciferol	(7E)-(3S,6S)-6,19-ethano-9,10-seco-5(10),7-cholestadiene-3,25-diol	VVD0507	Sachiko Yamada		C₂₉H₄₈O₂	428.690		Binding affinity for the vitamin D receptor in HL-60 cells : < 1/10000 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : < 1/1000 as active as 1,25-(OH)₂D₃. (Ref. 0339)									¹H-NMR (d, CDCl₃) 0.54 (3H, s, 18-H), 0.97 (3H, d, J = 5 Hz, 21-H), 1.22 (6H, s, 26- and 27-H), 3.92 (1H, m, 3-H), 4.80 (1H, d, J = 10 Hz, 7-H) (Ref. 0339)	m/z 428 (M⁺-H₂O), 410, 164, 146 (Ref. 0339)	CD : 205 nm (e +33.1) (in Hexane) (Ref. 0339)			From (5E)-25-hydroxyvitamin D₃ via reaction with vinyl phenyl sulfone followed by desulfonylation. (Ref. 0339)				[0339]
505		(6R)-6,19-ethano-25-hydroxy-6,19-dihydrovitamin D₃ / (6R)-6,19-ethano-25-hydroxy-6,19-dihydrocholecalciferol	(7E)-(3S,6R)-6,19-ethano-9,10-seco-5(10),7-cholestadiene-3,25-diol	VVD0508	Sachiko Yamada		C₂₉H₄₈O₂	428.690		Binding affinity for the vitamin D receptor in HL-60 cells : < 1/10000 as active as 1,25-(OH)₂D₃. Differentiation of HL-60 cells : < 1/1000 as active as 1,25-(OH)₂D₃. (Ref. 0339)									¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-H), 0.97 (3H, d, J = 5 Hz, 21-H), 1.22 (6H, s, 26- and 27-H), 3.96(1H, m, 3-H), 4.82 (1H, d, J = 10 Hz, 7-H) (Ref. 0339)	m/z 428 (M⁺-H₂O), 410, 164, 146 (Ref. 0339)	CD : 209 nm (e -123.8) (in Hexane) (Ref. 0339)			From (5E)-25-hydroxyvitamin D₃ via reaction with vinyl phenyl sulfone followed by desulfonylation. (Ref. 0339)				[0339]
506		11a-ethyl-1a,25-dihydroxyvitamin D₃ / 11a-ethyl-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,11S)-11-ethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0509	Sachiko Yamada	11a-ethyl-1a,25-(OH)₂D₃	C₂₉H₄₈O₃	444.690		Biological activity of C-ring analogs of 1a,25-(OH)₂D₃ :(Ref. 0224)														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of organocopper reagent to 9(11)-en-8-one of the CD-ring fragment. (Ref. 0224)				[0224]
507		1a,25-dihydroxy-26,27-dimethylvitamin D₃ / 1a,25-dihydroxy-26,27-dimethylcholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0510	Sachiko Yamada	26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₈O₃	444.690		Binding affinity of the title compound for serum vitamin D binding protein (DBP) relative to 25-OHD₃ and 1,25-(OH)₂D₃ was 0.1% and 10%, respectively. Binding affinity for receptor of HL-60 cells relative to 1,25-(OH)₂D₃ was 116.7%. The ability of the title compound to induce HL-60 cell differentiation (assayed by NBT reduction) was approximately four times of that of 1,25-(OH)₂D₃ under serum-supplemented culture conditions, whereas the same compound was as equally active as 1,25-(OH)₂D₃ under serum-free culture conditions. (Ref. 0275) Bone Ca mobilization response to the title compound compared with 1,25-(OH)₂D₃. (Ref. 0276) Dose response of various 26,27-dialkyl-1,25-(OH)₂D₃ in bone Ca mobilization. (Ref. 0276) The title comopund was slighly less active than 1,25-(OH)₂D₃ in increasing serum calcium in vitamin D-deficient rats. (Ref. 0272)							(EtOH) lmax (nm) 265, lmin (nm) 228 (Ref. 0198) lmax (nm) 265, lmin (nm) 228 (Ref. 0277) (EtOH) lmax (nm) 264, lmin (nm) 227 (Ref. 0312)		¹H-NMR (d, CDCl₃) 0.55 (3H, s, 18-H₃), 0.86 (6H, t, J = 7.0 Hz, 26- and 27-CH₃), 0.93 (3H, d, J = 6.0 Hz, 21-H₃), 1.45 (4H, q, J = 7.0 Hz, 26- and 27-CH₂), 4.22 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.01 (1H, br s, 19Z-H), 5.33 (1H, br s, 19E-H), 6.03 (1H, d, J = 11.0 Hz, 7-H), 6.38 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0277) ¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-CH₃), 4.23 (1H, m, 3-H), 4.42 (1H, m, 1-H), 4.98 (1H, m, 19-H), 5.32 (1H, m, 19-H), 5.98 (1H, d, J = 11.22 Hz, 7-H), 6.37 (1H, d, J = 11.22 Hz, 6-H) (Ref. 0312)	FD-MS m/z 444 (M⁺), EI-MS m/z 426 (M⁺-18), 408 (M⁺-36, base peak), 390 (M⁺-54), 269 [287 (side chain cleavage)-18], 251 (287-36), 152 (C₇-C₈ cleavage), 134 (152-18), 116 (152-36) (Ref. 0198) m/z 444 (M⁺), 408, 390, 375, 269, 251, 157, 152, 134, 116, 87 (Ref. 0277) m/z 444 (M⁺, 3.45), 426 (M⁺-H₂O, 32.76), 408 (M⁺-2H₂O, 79.31), 390 (M⁺-3H₂O, 89.66), 379 (17.24), 287 (M⁺-side chain, 5.17), 269 (M⁺-side chain-H₂O, 8.28), 251 (M⁺-side chain-2H₂O, 48.28), 152 (ring A plus C-6 and C-7, 25.86), 134 (152-H₂O, 70.69), 116 (134-H₂O, 13.79), 105 (100), 87 (C₅H₁₁O, 40.52) (Ref. 0312)				From 3b-hydroxycholenic acid via steps of 1a-hydroxylation, side chain construction, introduction of 5,7-diene structure and conventional photochemical conversion. (Ref. 0277) From 25-hydroxy-26,27-dimethylvitamin D₃ by 1a-hydroxylation via 3,5-cyclovitamin D. (Ref. 0312)				[0198] / [0272] / [0275] / [0276] / [0277] / [0312]
508		1a,25-dihydroxy-24a,24b-dihomovitamin D₃ / 1a,25-dihydroxy-24a,24b-dihomocholecalciferol	(5Z,7E)-(1S,3R)-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0511	Sachiko Yamada		C₂₉H₄₈O₃	444.690		The title compound was approximately 10 times more active than 1,25-(OH)₂D₃ in differentiating HL-60 cells but it was approximately 1000 times less active than the natural hormone in mobilizing skeletal calcium. (Ref. 0158)							(10% 2-propanol in hexane) lmax (nm) 264, lmin (nm) 228, A264/A228 = 1.91 (Ref. 0192)	(Film) 3360, 2927, 1602, 1447, 1376, 1297, 1146, 1106, 1086, 1064 cm^-¹ (Ref. 0192)	¹H-NMR (d, CDCl₃, 270 or 400 MHz) 0.52 (3H, s, 18-CH₃), 0.90 (3H, d, J = 6.4 Hz, 21-CH₃), 1.19 (6H, s, 26- and 27-CH₃), 4.22 (1H, ms, 3-H), 4.42 (1H, m, 1-H), 4.99 (1H, br s, 19Z-H), 5.31 (1H, br s, 19E-H), 6.00 (1H, d, J = 11.1 Hz, 7-H), 6.36 (1H, d, J = 11.2 Hz, 6-H) (Ref. 0192)	m/z 444 (M⁺, 1.4), 426 (41), 393 (10), 251 (26), 209 (17), 197 (20), 157 (29), 155 (37), 134 (58), 105 (54), 59 (100) (Ref. 0192)				From hydroxy protected (5E)-23,24,25,26,27-pentanorvitamin D₃ 22-bis(methylseleno)acetal via displacement of one methylseleno group by side chain fragment, reduction of the other methylseleno group via 6,19-SO₂ adduct, desulfonylation, dye-sensitized photoisomerization and deprotection. From hydroxy protected (5E)-22-tosyloxy-23,24,25,26,27-pentanorvitamin D₃ via cuprate catalyzed Grignard reaction, photoisomerization and deprotection. (Ref. 0285)				[0158] / [0192] / [0285]
509		1a,25-dihydroxy-24a,24b-dihomo-20-epivitamin D₃ / 1a,25-dihydroxy-24a,24b-dihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20S)-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0512	Sachiko Yamada	24a,24b-dihomo-20-epi-1a,25-(OH)₂D₃	C₂₉H₄₈O₃	444.690		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U 937 cells, 5000% ; Induction of differentiation of U 937 cells, 10000% ; Calciuric effects on normal rats, 40%. (Ref. 0284)														From protected (5E)-1a-hydroxy-22-p-toluenesulfonyloxy-23,24,25,26,27-pentanorvitamin D₃ via introduction of the side chain by the reaction with Grignard reagent in the presence of copper catalyst, dye-sensitized photoisomerization and deprotection. (Ref. 0284)				[0284]
510		1a,25-dihydroxy-24a-homo-26,27-dimethyl-22-thiavitamin D₃ / 1a,25-dihydroxy-24a-homo-26,27-dimethyl-22-thiacholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-24a-homo-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0513	Sachiko Yamada	22-thia-24a-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₈O₃S	476.756																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
511		1a,25-dihydroxy-26,27-dimethyl-24a-homo-22-thia-20-epivitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-24a-homo-22-thia-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-dimethyl-24a-homo-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0514	Sachiko Yamada	20-epi-22-thia-24a-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₂₉H₄₈O₃S	476.756																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
512		1a,25-dihydroxy-24a,24b,24c-trihomo-22-thiavitamin D₃ / 1a,25-dihydroxy-24a,24b,24c-trihomo-22-thiacholecalciferol	(5Z,7E)-(1S,3R)-24a,24b,24c-trihomo-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0515	Sachiko Yamada	22-thia-24a,24b,24c-trihomo-1a,25-(OH)₂D₃	C₂₉H₄₈O₃S	476.756																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
513		1a,25-dihydroxy-24a,24b,24c-trihomo-22-thia-20-epivitamin D₃ / 1a,25-dihydroxy-24a,24b,24c-trihomo-22-thia-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-24a,24b,24c-trihomo-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0516	Sachiko Yamada	20-epi-22-thia-24a,24b,24c-trihomo-1a,25-(OH)₂D₃	C₂₉H₄₈O₃S	476.756																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
514		1a-hydroxy-2b-(2-hydroxyethoxy)vitamin D₃ / 1a-hydroxy-2b-(2-hydroxyethoxy)cholecalciferol	(5Z,7E)-(1R,2R,3R)-2-(2-hydroxyethoxy)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0517	Sachiko Yamada	2b-(2-hydroxyethoxy)-1a-OHD₃	C₂₉H₄₈O₄	460.689		Plasma calcium levels in rats fed with a low calcium/vitamin D deficient diet after administration (6.25mg/kg 5). (Ref. 0216)							(EtOH) lmax (nm) 262.5 (Ref. 0216)		¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.86 (6H, d, J = 6.6 Hz), 0.92 (3H, d, J = 5.8 Hz), 3.62-3.92 (5H, br), 4.18-4.39 (2H, m), 5.09 (1H, s), 5.49 (1H, s), 6.04 (1H, d, J = 10.5 Hz), 6.37 (1H, d, J = 10.5 Hz) (Ref. 0216)	m/z 460 (M⁺), 442, 398, 380, 150 (100%) (Ref. 0216)	HRMS Calcd 460.3553, Found 460.3560 (Ref. 0216)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0216)				[0216]
515		(20S)-1a,25-dihydroxy-20-methoxy-24a-homovitamin D₃ / (20S)-1a,25-dihydroxy-20-methoxy-24a-homocholecalciferol	(5Z,7E)-(1S,3R,20S)-20-methoxy-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0518	Sachiko Yamada	20S-methoxy-24a-homo-1a,25-(OH)₂D₃	C₂₉H₄₈O₄	460.689		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 10000% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : < 0.5% ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 3%. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by methylation, photochemical isomerization and deprotection. (Ref. 0279)				[0279]
516		1a,25-dihydroxy-24a,24b,24c-trihomo-22-oxavitamin D₃ /	(5Z,7E)-(1S,3R)-24a,24b,24c-trihomo-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0519	Sachiko Yamada	22-oxa-24a,24b,24c-trihomo-1a,25-(OH)₂D₃	C₂₉H₄₈O₄	460.689		The activity inducing differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : [ED50 of 1,25-(OH)₂D₃ : 1.70 10^-⁸M, ED50 of OCT : 1.78 10^-⁸ M]. (Ref. 0203)							(EtOH) lmax (nm) 262, lmin (nm) 227 (Ref. 0203)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 1.15 (3H, d, J = 6.2 Hz), 1.21 (6H, s), 3.12-3.28 (2H, m), 3.47-3.60 (1H, m), 4.16-4.28 (1H, br), 4.36-4.46 (1H, br), 5.00 (1H, s), 5.33 (1H, s), 6.02 (1H, d, J = 11.4 Hz), 6.38 (1H, d, J = 11.4Hz) (Ref. 0203)	m/z 460 (M⁺), 68 (100%) (Ref. 0203)	Colorless foam. (Ref. 0203)	1)Flash column chromatography with CH₂Cl₂/EtOH (10 : 1), 2)Preparative TLC developed three times with CH₂Cl₂/EtOH (8 : 1). (Ref. 0203)		Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-(6-hydroxy-6-methylheptyloxy)pregna-5,7-diene by photochemical method. (Ref. 0203)				[0203]
517		1a,25-dihydroxy-26,27-dimethyl-24a-homo-22-oxavitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-24a-homo-22-oxacholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-24a-homo-22-oxa-9,10-seco-5,7,10(19)-cholestatrien-1,3,25-triol	VVD0520	Sachiko Yamada	22-oxa-24,26,27-trihomo-1a,25-(OH)₂D₃	C₂₉H₄₈O₄	460.689		Biological activity (% of 1,25-(OH)₂D₃ effect) Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 10000 (IC50 : the title compound, 1.4 10^-¹⁰ M ; 1,25-(OH)₂D₃, 1.4 10^-⁸ M) ; Induction of U 937 cell differentiation : 2000 ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 32 ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 30. Inhibitory effects on murine thymocyte activation : 900 (IC50 : the title compound, 2.1 10^-¹¹ M ; 1,25-(OH)₂D₃, 1.9 10^-¹⁰ M). (Ref. 0278)																		[0278]
518		1a,25-dihydroxy-20,26,27-trimethyl-23-oxavitamin D₃ / 1a,25-dihydroxy-20,26,27-trimethyl-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-20,26,27-trimethyl-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0521	Sachiko Yamada	23-oxa-20,26,27-trimethyl-1a,25-(OH)₂D₃	C₂₉H₄₈O₄	460.689		Biological activity : Affinity for pig intestinal nuclear receptor, 50% of 1,25-(OH)₂D₃ effect ; Affinity for human vitamin D binding protein, < 0.02% of 25-OHD₃ effect ; Differentiation of HL-60 cells, 50% of 1,25-(OH)₂D₃ effect ; Calciuric effect, 20% of 1,25-(OH)₂D₃ effect. (Ref. 0299)																		[0299]
519		1a,25-dihydroxy-26,27-dimethyl-24a-homo-22-oxa-20-epivitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-24a-homo-22-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-dimethyl-24a-homo-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0522	Sachiko Yamada		C₂₉H₄₈O₄	460.689		Biological activity (% of 1,25-(OH)₂D₃ effect)Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation :1400000 (IC50 : the title compound, 1.0 10^-¹² M ; 1,25-(OH)₂D₃, 1.4 10^-⁸ M) ; Induction of U 937 cell differentiation : 20000000 ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 120 ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 130. Inhibitory effects on murine thymocyte activation : 63333300 (IC50 : the title compound, 3.0 10^-¹⁶ M ; 1,25-(OH)₂D₃, 1.9 10^-¹⁰ M). (Ref. 0278)																		[0278]
520		1a,25-dihydroxy-11a-(2-hydroxyethyl)vitamin D₃ / 1a,25-dihydroxy-11a-(2-hydroxyethyl)cholecalciferol	(5Z,7E)-(1S,3R,11S)-11-(2-hydroxyethyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0523	Sachiko Yamada		C₂₉H₄₈O₄	460.689		(% of 1a,25-(OH)₂D₃ effect) Affinity for rat duodenum receptor and human vitamin D binding protein: <0.1 and 115, respectively; Differentiation of HL-60 cells: 7; Inhibition of the proliferation of peripheral blood mononuclear cells (PBMC): <1; Bone resorption: <1 (3 day), <1 (6 day); Biological activity in rachitic chick: serum calcium, <1; bone calcium, <1; serum osteocalcin, <1; calbindin D-28K, <1. <0224>>														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of organocopper reagent to 9(11)-en-8-one of the CD-ring fragment. (Ref. 0224)				[0224]
521		1a,25-dihydroxy-11b-(2-hydroxyethyl)vitamin D₃ / 1a,25-dihydroxy-11b-(2-hydroxyethyl)cholecalciferol	(5Z,7E)-(1S,3R,11R)-11-(2-hydroxyethyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0524	Sachiko Yamada		C₂₉H₄₈O₄	460.689		(% of 1a,25-(OH)₂D₃ effect) Affinity for rat duodenum receptor and human vitamin D binding protein: 0.2 and 40, respectively; Differentiation of HL-60 cells: 5; Inhibition of the proliferation of peripheral blood mononuclear cells (PBMC): <1; Biological activity in rachitic chick: serum calcium, <1; bone calcium, <1; serum osteocalcin, <1; calbindin D-28K, <1. <0224>>														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of vinylcopper reagent to 9(11)-en-8-one of the CD-ring fragment, appropriate modification of the vinyl group, and inversion of the configuration at C(11) by introducing 9(11)-double bond followed by catalytic hydrogenation. (Ref. 0224)				[0224]
522		(22R)-1a,22,25-trihydroxy-24a,24b-dihomo-20-epivitamin D₃ / (22R)-1a,22,25-trihydroxy-24a,24b-dihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22R)-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatriene-1,3,22,25-tetrol	VVD0525	Sachiko Yamada	24a,24b-dihomo-20-epi-1a,22R,25-(OH)₃D₃	C₂₉H₄₈O₄	460.689		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 20 ; Inhibition of proliferation, 21 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.001 ; Calciuric effect in normal rats, 0.1. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with Grignard reagent of side chain fragment giving major (19:1) 22R-hydroxy product as a key step. (Ref. 0321)				[0321]
523		(20S)-1a,20,25-trihydroxy-24a,24b-dihomovitamin D₃ / (20S)-1a,20,25-trihydroxy-24a,24b-dihomocholecalciferol	(5Z,7E)-(1S,3R,20S)-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatriene-1,3,20,25-tetrol	VVD0526	Sachiko Yamada	24a,24b-dihomo-1a,20S,25-(OH)₃D₃	C₂₉H₄₈O₄	460.689		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : < 10%. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by photochemical isomerization and deprotection. (Ref. 0279)				[0279]
524		(20S)-14a,20,25-trihydroxy-26,27-dimethylvitamin D₃ / (20S)-1a,20,25-trihydroxy-26,27-dimethylcholecalciferol	(5Z,7E)-(1S,3R,20S)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,20,25-tetrol	VVD0527	Sachiko Yamada	26,27-dimethyl-1a,20S,25-(OH)₃D₃	C₂₉H₄₈O₄	460.689		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 10000% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 20% ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 6%. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by photochemical isomerization and deprotection. (Ref. 0279)				[0279]
525		(22R)-1a,22,25-trihydroxy-26,27-dimethyl-20-epivitamin D₃ /	(5Z,7E)-(1S,3R,20R,22R)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,22,25-tetrol	VVD0528	Sachiko Yamada	26,27-dimethyl-20-epi-1a,22R,25-(OH)₃D₃	C₂₉H₄₈O₄	460.689		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 100 ; Inhibition of proliferation, 240 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.06 ; Calciuric effect in normal rats, 7.1. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with a Grignard reagent of side chain fragment giving major (19:1) 22R-hydroxy product as a key step. (Ref. 0321)				[0321]
526		(22S)-1a,22,25-trihydroxy-26,27-dimethylvitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethylcholecalciferol	(5Z,7E)-(1S,3R,22S)-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,22,25-tetrol	VVD0529	Sachiko Yamada	26,27-dimethyl-1a,22S,25-(OH)₃D₃	C₂₉H₄₈O₄	460.689
527		1a,25-dihydroxy-2b-(2-hydroxyethoxy)vitamin D₃ / 1a,25-dihydroxy-2b-(2-hydroxyethoxy)cholecalciferol	(5Z,7E)-(1R,2R,3R)-2-(2-hydroxyethoxy)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0530	Sachiko Yamada	2b-(2-hydroxyethoxy)-1a,25-(OH)₂D₃	C₂₉H₄₈O₅	476.688		Spinal bone mineral density in pre-osteoporosis model rats and binding affinity to calf thymus vitamin D receptor . (Ref. 0217)							(EtOH) lmax (nm) 264, lmin (nm) 226 (Ref. 0217)	(neat) 3400 (br), 2940, 2880, 1380, 1090, 760 cm^-¹ (Ref. 0217)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.94 (3H, d, J = 6.3 Hz), 1.22 (6H, s), 3.48-4.22 (7H, m), 5.09 (1H, s), 5.46 (1H, s), 6.03 (1H, d, J = 11.2 Hz), 6.37 (1H, d, J = 10.5 Hz) (Ref. 0217)	m/z 476 (M⁺), 59 (100%) (Ref. 0217)	HRMS Calcd 433.3318 (M-C₂H₃O⁺), Found 433.3318 (Ref. 0217)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0217]
528		toxisterol₃ B1/ (5E)-(10R)-10-ethoxy-10,19-dihydrovitamin D₃ / (5E)-(10R)-10-ethoxy-10,19-dihydrocholecalciferol	(5E,7E)-(3S,10R)-10-ethoxy-9,10-seco-5,7-cholestadien-3-ol	VVD0531	Sachiko Yamada	(5E)-10R-ethoxy-10,19-dihydro-D₃	C₂₉H₅₀O₂	430.706							Acetate: [a] +27 (in CHCl₃) (Ref. 0011/0012)		(EtOH) lmax (nm) (emax) 251 (33000), 245 (shoulder), 260 (shoulder) (Ref. 0011/0012)	(Neat) 3370, 2960, 2940, 2880, 1660, 1610, 1470, 1380, 1370, 1160, 1070, 1050, 950 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.70 (1H, m), 6.23 (2H, s), 0.56 (3H, s), 1.47 (3H, s), 0.94 (3H, d, J = 6 Hz), 0.87 (6H, d, J = 6 Hz) (Ref. 0011/0012)	Acetate : m/z 472 (M⁺), 412, 366, 253 (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzene/acetone] 0.42 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 1.19/1.80/2.34 (Ref. 0011)		Obtained as one of overirradiation products of 7-dehydrocholesterol in ethanol. (Ref. 0011)				[0011] / [0012]
529		toxisterol₃ B2 / (5E)-(10S)-10-ethoxy-10,19-dihydrovitamin D₃ / (5E)-(10S)-10-ethoxy-10,19-dihydrocholecalciferol	(5E,7E)-(3S,10S)-10-ethoxy-9,10-seco-5,7-cholestadien-3-ol	VVD0532	Sachiko Yamada	(5E)-10S-ethoxy-10,19-dihydro-D₃	C₂₉H₅₀O₂	430.706							Acetate : [a] -24 (in CHCl₃) (Ref. 0011/0012)		(EtOH) lmax (nm) (emax) 251 (29000), 244, 260 (Ref. 0011/0012)	(Neat) 3370, 2960, 2940, 2880, 1660, 1620, 1470, 1380, 1370, 1160, 1125, 1070, 1040, 1000, 950, 850, 740 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.50 (1H, m), 6.27 (1H, d, J = 11 Hz), 5.86 (1H, d, J = 11 Hz), 0.57 (3H, s), 1.30 (3H, s), 0.93 (3H, d, J = 6 Hz), 0.87 (6H, d, J = 6 Hz) (Ref. 0011/0012)	Acetate : m/z 472 (M⁺), 412, 366, 253 (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzene/acetone] 0.46 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 2.37 (Ref. 0011)		Obtained as one of over irradiation products of 7-dehydrocholesterol in ethanol. (Ref. 0011)				[0011] / [0012]
530		toxisterol₃ B3 / (10R)-10-ethoxy-10,19-dihydrovitamin D₃ / (10R)-10-ethoxy-10,19-dihydrocholecalciferol	(5Z,7E)-(3S,10R)-10-ethoxy-9,10-seco-5,7-cholestadien-3-ol	VVD0533	Sachiko Yamada	10R-ethoxy-10,19-dihydro-D₃	C₂₉H₅₀O₂	430.706							Acetate : [a] +19 (in CHCl₃) (Ref. 0011)		(EtOH) lmax (nm) (emax) 250 (17000), 246 (shoulder), 259 (shoulder) (Ref. 0011)	Acetate : (Neat) 2940, 2920, 2860, 1740, 1650, 1610, 1470, 1380, 1370, 1240, 1030, 760 cm^-¹ (Ref. 0011)	¹H-NMR (d, CDCl₃, 100MHz) 3.96 (1H, m), 6.24 (2H, s), 0.57 (3H, s), 1.50 (3H, s), 0.93 (3H, d, J = 6 Hz), 0.87 (6H, d, J = 6 Hz) (Ref. 0011)	Acetate : m/z 472 (M⁺), 412, 366, 253 (Ref. 0011)		RF(TLC) [0.2 nm silicagel plate (Kieselgel G Merk), benzene/acetone] 0.52 (Ref. 0011) Rrel(GC) [1% SE-30 on GasChrom Q (80-100 mesh), retention time relative to cholestane] 1.39/1.96/2.26 (Ref. 0011)		Obtained as one of overirradiation products of 7-dehydrocholesterol in ethanol. (Ref. 0011)				[0011]
531		(17E)-1a,25-dihydroxy-26,27-dimethyl-17,20,22,22,23,23-hexadehydro-24a-homovitamin D₃ / (17E)-1a,25-dihydroxy-26,27-dimethyl-17,20,22,22,23,23-hexadehydro-24a-homocholecalciferol	(5Z,7E,17E)-(1S,3R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19),17(20)-cholestatetraen-22-yne-1,3,25-triol	VVD0534	Sachiko Yamada	17(20)E-ene-22-yne-24-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₀H₄₄O₃	452.669		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 250% ; Affinity for chicken intestinal vitamin D receptor, 0.1%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ via reaction with appropriate lithium acetylide, treatment with acid, separation of regio- and stereoisomers, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
532		(17Z)-1a,25-dihydroxy-26,27-dimethyl-17,20,22,22,23,23-hexadehydro-24a-homovitamin D₃ / (17Z)-1a,25-dihydroxy-26,27-dimethyl-17,20,22,22,23,23-hexadehydro-24a-homocholecalciferol	(5Z,7E,17Z)-(1S,3R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19),17(20)-cholestatetraen-22-yne-1,3,25-triol	VVD0535	Sachiko Yamada	17(20)Z-ene-22-yne-24-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₀H₄₄O₃	452.669		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 71000% ; Affinity for chicken intestinal vitamin D receptor, 17% ; Calciuric activity, 71%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ via reaction with appropriate lithium acetylide, treatment with acid, separation of regio- and stereoisomers, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
533		1a,25-dihydroxy-26,27-dimethyl-20,21,22,22,23,23-hexadehydro-24a-homovitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-20,21,22,22,23,23-hexadehydro-24a-homocholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19),20-cholestatetraen-22-yne-1,3,25-triol	VVD0536	Sachiko Yamada	20-ene-22-yne-24-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₀H₄₄O₃	452.669		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 120% ; Affinity for chicken intestinal vitamin D receptor, 3%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ via reaction with appropriate lithium acetylide, treatment with acid, separation of regio- and stereoisomers, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
534		(22E,24E,24bE)-1a,25-dihydroxy-22,23,24,24a,24b,24c-hexadehydro-24a,24b,24c-trihomovitamin D₃ / (22E,24E,24bE)-1a,25-dihydroxy-22,23,24,24a,24b,24c-hexadehydro-24a,24b,24c-trihomocholecalciferol	(5Z,7E,22E,24E,24bE)-(1S,3R)-24a,24b,24c-trihomo-9,10-seco-5,7,10(19),22,24,24b-cholestahexaene-1,3,25-triol	VVD0537	Sachiko Yamada	(22E,24E,24bE)-22,23,24,24a,24b,24c-hexadehydro-24a,24b,24c-trihomo-1a,25-(OH)₂D₃	C₃₀H₄₄O₃	452.669		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, < 80% ; Induction of differentiation of U 937 cells, < 5%. (Ref. 0285)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction, photoisomerization and deprotection. (Ref. 0285)				[0285]
535		1a,25-dihydroxy-11-(3-hydroxy-1-propynyl)-9,11-didehydrovitamin D₃ / 1a,25-dihydroxy-11-(3-hydroxy-1-propynyl)-9,11-didehydrocholecalciferol	(5Z,7E)-(1S,3R)-11-(3-hydroxy-1-propynyl)-9,10-seco-5,7,9(11),10(19)-cholestatetraene-1,3,25-triol	VVD0538	Sachiko Yamada		C₃₀H₄₄O₄	468.668
536		(22E,24E)-1a,25-dihydroxy-26,27-dimethyl-22,23,24,24a-tetradehydro-24a-homovitamin D₃ / (22E,24E)-1a,25-dihydroxy-26,27-dimethyl-22,23,24,24a-tetradehydro-24a-homocholecalciferol	(5Z,7E,22E,24E)-(1S,3R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19),22,24-cholestapentaene-1,3,25-triol	VVD0539	Sachiko Yamada		C₃₀H₄₆O₃	454.684		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 6800% ; Induction of differentiation of U 937 cells, 6700% ; Calciuric activity, 40%. (Ref. 0288) Inhibition of proliferation of breast cancer cell MCF-7:10 times more potent than 1,25-(OH)₂D₃ ; This compound inhibited the growth of NMU (N-methylnitrosourea) induced rat mammary tumors in vivo in a dose-dependent manner. (Ref. 0302)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by Wittig reaction followed by Grignard reaction, photoisomerization and deprotection. (Ref. 0288)	In vitro metabolism of the title compound (Leo laboratory code EB1089) was studied in a human keratinocyte cell model HPK1A-ras. Four metabolites were formed, all of which possessed the same UV chromophore as the substrate, indicating the retention of the side-chain conjugated double bond system. Two metabolites which are present in sufficient quantities were identified as 26-hydroxy EB1089 (major product) and 26a-hydroxy EB1089 (minor product). (Ref. 0326)			[0288] / [0302] / [0326]
537		1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a-homovitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a-homocholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-22-yne-1,3,25-triol	VVD0540	Sachiko Yamada	22-yne-24-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₀H₄₆O₃	454.684		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 180%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-22,22,23,23-tetradehydro-24,25,26,27-tetranorvitamin D₃, which was derived from corresponding 22-aldehyde, via side chain introduction, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
538		1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a-homo-20-epivitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a-homo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-22-yne-1,3,25-triol	VVD0541	Sachiko Yamada	20-epi-22-yne-24-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₀H₄₆O₃	454.684		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 28000% ; Affinity for chicken intestinal vitamin D receptor, 44%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-22,22,23,23-tetradehydro-24,25,26,27-tetranor-20-epivitamin D₃, which was derived from corresponding 22-aldehyde, via side chain introduction, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
539		(22R)-1a,25-dihydroxy-22-methoxy-26,27-dimethyl-23,23,24,24-tetradehydrovitamin D₃ / (22R)-1a,25-dihydroxy-22-methoxy-26,27-dimethyl-23,23,24,24-tetradehydrocholecalciferol	(5Z,7E)-(1S,3R,22R)-22-methoxy-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,25-triol	VVD0542	Sachiko Yamada		C₃₀H₄₆O₄	470.684
540		(22S)-1a,25-dihydroxy-22-methoxy-26,27-dimethyl-23,24-tetradehydro-20-epivitamin D₃ / (22S)-1a,25-dihydroxy-22-methoxy-26,27-dimethyl-23,24-tetradehydro-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-26,27-dimethyl-22-methoxy-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,25-triol	VVD0543	Sachiko Yamada	22S-methoxy-26,27-dimethyl-23,24-tetradehydro-20-epi-1a,25-(OH)₂D₃	C₃₀H₄₆O₄	470.684		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 1000 ; Inhibition of proliferation, 1250 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.38 ; Calciuric effect in normal rats, 12. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
541		(22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epivitamin D₃ / (22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0544	Sachiko Yamada	26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epi-1a,22R,25-(OH)₃D₃	C₃₀H₄₆O₄	470.684		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 0.1 ; Inhibition of proliferation, 0.2 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.005. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving minor (1:19) 22R-hydroxy product. (Ref. 0321)				[0321]
542		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a-homovitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a-homocholecalciferol	(5Z,7E)-(1S,3R,22S)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0545	Sachiko Yamada	23-yne-24-homo-26,27-dimethyl-1a,22S,25-(OH)₃D₃	C₃₀H₄₆O₄	470.684
543		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epivitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0546	Sachiko Yamada	26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epi-1a,22S,25-(OH)₃D₃	C₃₀H₄₆O₄	470.684		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 200 ; Inhibition of proliferation, 280 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.06 ; Calciuric effect in normal rats, 1.9. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
544		24,24-difluoro-1a,25-dihydroxy-26,27-dimethyl-24a-homovitamin D₃ / 24,24-difluoro-1a,25-dihydroxy-26,27-dimethyl-24a-homocholecalciferol	(5Z,7E)-(1S,3R)-24,24-difluoro-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0547	Sachiko Yamada	24,24-difluoro-24-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₀H₄₈F₂O₃	494.697
545		1a,25-dihydroxy-22,23-didehydro-24a,24b,24c-trihomovitamin D₃ /1a,25-dihydroxy-22,23-didehydro-24a,24b,24c-trihomocholecalciferol	(5Z,7E,22E)-(1S,3R)-24a,24b,24c-trihomo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0548	Sachiko Yamada	22-dehydro-24-trihomo-1a,25-(OH)₂D₃	C₃₀H₄₈O₃	456.700		The title compound is half as active as 1,25-(OH)₂D₃ in differentiating HL-60 cells but it has no activity in mobilizing bone calcium. (Ref. 0158)							(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0158)		¹H-NMR (d, CDCl₃) 0.56 (3H, s, 18-CH₃), 1.00 (3H, d, J = 6.6 Hz, 21-CH₃), 1.23 (6H, s, 26, 27-CH₃), 4.23 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.00 (1H, br s, 19Z-H), 5.32 (1H, br s, 19E-H), 5.29 (2H, m, 22-and 23-H), 6.01 (1H, d, J = 11.3 Hz, 7-H) (Ref. 0158)	m/z 456 (M⁺, 11), 438 (50), 420 (30), 402 (8), 287 (10), 269 (23), 251 (23), 152 (35), 134 (100) (Ref. 0158)				From 1a-hydroxylated pentanorvitamin D 22-calboxaldehyde and C(8) side chain fragment with terminal phenylsulfonyl group. (Ref. 0158)				[0158]
546		(22E)-1a,25-dihydroxy-26,27-dimethyl-22,23-didehydro-24a-homovitamin D₃ / (22E)-1a,25-dihydroxy-26,27-dimethyl-22,23-didehydro-24a-homocholecalciferol	(5Z,7E,22E)-(1S,3R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0549	Sachiko Yamada		C₃₀H₄₈O₃	456.700
547		(22E)-1a,25-dihydroxy-26,27-dimethyl-22,23-didehydro-24a-homo-20-epivitamin D₃ / (22E)-1a,25-dihydroxy-26,27-dimethyl-22,23-didehydro-24a-homo-20-epicholecalciferol	(5Z,7E,22E)-(1S,3R,20S)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0550	Sachiko Yamada	(22E)-20-epi-22-ene-24-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₀H₄₈O₃	456.700		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U 937 cells, 15000% ; Induction of differentiation of U 937 cells, 100000% ; Calciuric effects on normal rats, 120%. (Ref. 0284)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by reaction with side chain fragment with terminal phenylsulfonyl group, reductive desulfonylation, separation of 22E/Z-isomers, dye-sensitized photoisomerization and deprotection. (Ref. 0284)				[0284]
548		(22Z)-1a,25-dihydroxy-26,27-dimethyl-22,23-didehydro-24a-homo-20-epivitamin D₃ / (22Z)-1a,25-dihydroxy-26,27-dimethyl-22,23-didehydro-24a-homo-20-epicholecalciferol	(5Z,7E,22Z)-(1S,3R,20S)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19),22-cholestatetraene-1,3,25-triol	VVD0551	Sachiko Yamada	(22Z)-26,27-dimethyl-22,23-didehydro-24a-homo-20-epi-1a,25-(OH)₂D₃	C₃₀H₄₈O₃	456.700		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U 937 cells, 340000% ; Induction of differentiation of U 937 cells, 1000000% ; calciuric effects on normal rats, 330%. (Ref. 0284)														From protected (5E)-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by reaction with side chain fragment with terminal phenylsulfonyl group, reductive desulfonylation, separation of 22E/Z-isomers, dye-sensitized photoisomerization and deprotection. (Ref. 0284)				[0284]
549		26,27-diethyl-1a,25-dihydroxy-20,21-didehydro-23-oxavitamin D₃ / 26,27-diethyl-1a,25-dihydroxy-20,21-didehydro-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-26,27-diethyl-23-oxa-9,10-seco-5,7,10(19),20-cholestatetraene-1,3,25-triol	VVD0552	Sachiko Yamada	20-ene-23-oxa-26,27-diethyl-1a,25-(OH)₂D₃	C₃₀H₄₈O₄	472.700		Biological activity : Affinity for pig intestinal nuclear receptor, 25% of 1,25-(OH)₂D₃ effect ; Affinity for human vitamin D binding protein, < 0.02% of 25-OHD₃ effect ; Differentiation of HL-60 cells, 25% of 1,25-(OH)₂D₃ effect ; Calciuric effect, 1% of 1,25-(OH)₂D₃ effect. (Ref. 0299)																		[0299]
550		1a,25-dihydroxy-24a,24b,24c-trihomovitamin D₃ / 1a,25-dihydroxy-24a,24b,24c-trihomocholecalciferol	(5Z,7E)-(1S,3R)-24a,24b,24c-trihomo-9,10-seco-5,7,10(19)-cholestatrien-1,3,25-triol	VVD0553	Sachiko Yamada	24a,24b,24c-trihomo-1a,25-(OH)₂D₃	C₃₀H₅₀O₃	458.716		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 20% ; Induction of differentiation of U 937 cells, 40% ; Calciuric activity, 2%. (Ref. 0285)														From hydroxy protected (5E)-23,24,25,26,27-pentanorvitamin D₃ 22-bis(methylseleno)acetal via displacement of one methylseleno group by side chain fragment, reduction of the other methylseleno group via 6,19-SO₂ adduct, desulfonylation, dye-sensitized photoisomerization and deprotection. (Ref. 0285)				[0285]
551		1a,25-dihydroxy-26,27-dimethyl-24a-homovitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-24a-homocholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-1,3,25-triol	VVD0554	Sachiko Yamada	1a,25-(OH)₂-24,26,27-trihomo-D₃	C₃₀H₅₀O₃	458.716		Biological activity (% of 1,25-(OH)₂D₃ effect) Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 800 (IC50 : the title compound, 1.7 10^-⁹ M ; 1,25-(OH)₂D₃, 1.4 10^-⁸ M) ; Induction of U 937 cell differentiation : 500 ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 18 ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 20. Inhibitory effects on murine thymocyte activation : 1900 (IC50 : the title compound, 1.0 10^-¹¹ M ; 1,25-(OH)₂D₃, 1.9 10^-¹⁰ M). (Ref. 0278)														From hydroxy protected (5E)-23,24,25,26,27-pentanorvitamin D₃ 22-bis(methylseleno)acetal via displacement of one methylseleno group by side chain fragment, reduction of the other methylseleno group via 6,19-SO₂ adduct, desulfonylation, dye-sensitized photoisomerization and deprotection. From hydroxy protected (5E)-22-tosyloxy-23,24,25,26,27-pentanorvitamin D₃ via cuprate catalyzed Grignard reaction, photoisomerization and deprotection. (Ref. 0285)				[0278] / [0285]
552		1a,25-dihydroxy-26,27-dimethyl-24a-homo-20-epivitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-24a-homo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20S)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0555	Sachiko Yamada		C₃₀H₅₀O₃	458.716		Biological activity (% of 1,25-(OH)₂D₃ effect) Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation :17000 (IC50 : the title compound, 8.2 10^-¹¹ M ; 1,25-(OH)₂D₃, 1.4 10^-⁸ M) ; Induction of U 937 cell differentiation : 20000 ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 100 ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 120. Inhibitory effects on murine thymocyte activation : 2835800 (IC50 : the title compound,6.7 10^-¹⁵ M ; 1,25-(OH)₂D₃, 1.9 10^-¹⁰ M). (Ref. 0278)														From protected (5E)-1a-hydroxy-22-p-toluenesulfonyloxy-23,24,25,26,27-pentanorvitamin D₃ via introduction of the side chain by the reaction with Grignard reagent in the presence of copper catalyst., photoisomerization and deprotection. (Ref. 0284)				[0278] / [0284]
553		26,27-diethyl-1a,25-dihydroxy-22-thiavitamin D₃ / 26,27-diethyl-1a,25-dihydroxy-22-thiacholecalciferol	(5Z,7E)-(1S,3R)-26,27-diethyl-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0556	Sachiko Yamada	1a,25-(OH)₂-26,27-diethyl-22-thia-D₃	C₃₀H₅₀O₃S	490.782																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
554		26,27-diethyl-1a,25-dihydroxy-22-thia-20-epivitamin D₃ / 26,27-diethyl-1a,25-dihydroxy-22-thia-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-diethyl-9,10-seco-22-thia-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0557	Sachiko Yamada	1a,25-(OH)₂-20-epi-26,27-diethyl-22-thia-D₃	C₃₀H₅₀O₃S	490.782																Synthesis from dehydroepiandrostertone via the 5,7-diene by photochemical method. (Ref. 0215)				[0215]
555		1a-hydroxy-2b-(3-hydroxypropoxy)vitamin D₃ / 1a-hydroxy-2b-(3-hydroxypropoxy)cholecalciferol	(5Z,7E)-(1R,2R,3R)-2-(3-hydroxypropoxy)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0558	Sachiko Yamada	2b-(3-hydroxypropoxy)-1a-OHD₃	C₃₀H₅₀O₄	474.716		Plasma calcium levels in rats fed with a low calcium/vitamin D deficient diet after administration (6.25mg/kg 5). (Ref. 0216)							(EtOH) lmax (nm) 263 (Ref. 0216)		¹H-NMR (d, CDCl₃) 0.54 (3H, s), 0.86 (6H, d, J = 6.6 Hz), 0.91 (3H, d, J = 6.1 Hz), 3.58-4.00 (5H, br), 4.10-4.36 (2H, m), 5.08 (1H, s), 5.49 (1H, s), 6.04 (1H, d, J = 10.5 Hz), 6.36 (1H, d, J = 10.5 Hz) (Ref. 0216)	m/z 474 (M⁺), 456, 398, 380, 150 (100%) (Ref. 0216)	HRMS Calcd 474.3709, Found 474.3693 (Ref. 0216)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0216)				[0216]
556		1a,25-dihydroxy-2b-(3-hydroxypropyl)vitamin D₃ / 1a,25-dihydroxy-2b-(3-hydroxypropyl)cholecalciferol	(5Z,7E)-(1S,2R,3R)-2-(3-hydroxypropyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0559	Sachiko Yamada	2b-(3-hydroxypropyl)-1a,25-(OH)₂D₃	C₃₀H₅₀O₄	474.716		Spinal bone mineral density in pre-osteoporosis model rats and binding affinity to calf thymus vitamin D receptor. (Ref. 0217)							(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0217)	(neat) 3367 (br), 2942, 2871, 1376, 1214, 1056, 755 cm^-¹ (Ref. 0217)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.94 (3H, d, J = 6.1 Hz), 1.22 (6H, s), 3.70 (2H, t, J = 6.3 Hz), 4.02-4.10 (1H, m), 4.17 (1H, br s), 5.03 (1H, s), 5.38 (1H, s), 6.03 (1H, d, J = 11.7 Hz), 6.35 (1H, d, J = 11.7 Hz) (Ref. 0217)	m/z 474 (M⁺), 59 (100%) (Ref. 0217)	HRMS Calcd 474.3709, Found 474.3702 (Ref. 0217)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0217]
557		26,27-diethyl-1a,25-dihydroxy-22-oxavitamin D₃ / 26,27-diethyl-1a,25-dihydroxy-22-oxacholecalciferol	(5Z,7E)-(1S,3R)-26,27-diethyl-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0560	Sachiko Yamada	22-oxa-26,27-diethyl-1a,25-(OH)₂D₃	C₃₀H₅₀O₄	474.716		The activity inducing differentiation of human myeloid leukemia cells (HL-60) into macrophases in vitro estimated by superoxide anion generation : ED50 = 1.78 10^-⁸ M [ED50 of 1,25-(OH)₂D₃ : 1.70 10^-⁸ M, ED50 of OCT : 1.78 10^-⁸ M]. (Ref. 0203)							(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0203)		¹H-NMR (d, CDCl₃) 0.53 (3H, s), 0.88 (6H, t, J = 6.8 Hz), 1.18 (3H, d, J = 6.1 Hz), 3.17-3.28 (1H, m), 3.37-3.48 (1H, m), 4.23 (1H, m), 4.44 (1H, m), 4.99 (1H, br t), 6.02 (1H, d, J = 10.9 Hz), 6.37 (1H, d, J = 10.9 Hz). (Ref. 0203)	m/z 456 (M⁺-H₂O), 54 (100%) (Ref. 0203)	colorless foam (Ref. 0203)	1)Preparative TLC developed with CH₂Cl₂/EtOH (12 : 1), 2)Preparative TLC developed with CH₂Cl₂/EtOH (20 : 1), 3)Preparative TLC developed with AcOEt/n-hexane (3 : 1). (Ref. 0203)		Synthesis from dehydroepiandrostertone via 1a,3b-dihydroxy-20(S)-(3-hydroxy-3-propylhexyloxy)pregna-5,7-diene by photochemical method. (Ref. 0203)				[0203]
558		26,27-diethyl-1a,25-dihydroxy-23-oxavitamin D₃ / 26,27-diethyl-1a,25-dihydroxy-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-26,27-diethyl-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0561	Sachiko Yamada	23-oxa-26,27-diethyl-1a,25-(OH)₂D₃	C₃₀H₅₀O₄	474.716		Biological activity : Affinity for pig intestinal nuclear receptor, 13% of 1,25-(OH)₂D₃ effect ; Affinity for human vitamin D binding protein, < 0.02% of 25-OHD₃ effect ; Differentiation of HL-60 cells, 25% of 1,25-(OH)₂D₃ effect ; Calciuric effect, 1% of 1,25-(OH)₂D₃ effect. (Ref. 0299)														From protected (5E)-1a,22-dihydroxy-23,24,25,26,27-pentanorvitamin D₃ via alkylation under phase-transfer conditions, Grignard reaction, photoisomerization, and deprotection. (Ref. 0299/0300/0153)				[0153] / [0299] / [0300]
559		(20S)-1a,25-dihydroxy-20-methoxy-26,27-dimethylvitamin D₃ / (20S)-1a,25-dihydroxy-20-methoxy-26,27-dimethylcholecalciferol	(5Z,7E)-(1S,3R,20S)-20-methoxy-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0562	Sachiko Yamada	20S-methoxy-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₀H₅₀O₄	474.716		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 800000% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 50% ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 32%. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by methylation, photochemical isomerization and deprotection. (Ref. 0279)				[0279]
560		1a,25-dihydroxy-26,27-dimethyl-24a,24b-dihomo-22-oxa-20-epivitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-24a,24b-dihomo-22-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-dimethyl-24a,24b-dihomo-22-oxa-9,10-seco-5,7,10(19)-cholestatrien-1,3,25-triol	VVD0563	Sachiko Yamada		C₃₀H₅₀O₄	474.716		Biological activity (% of 1,25-(OH)₂D₃ effect) Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 28000 (IC50 : the title compound, 5.0 10^-¹¹ M ; 1,25-(OH)₂D₃, 1.4 10^-⁸ M) ; Induction of U 937 cell differentiation : 40000 ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 61; Calcemic activity determined by the increase in urinary calcium excretion in rats : 80. (Ref. 0278)																		[0278]
561		(22R)-1a,22,25-trihydroxy-26,27-dimethyl-24a-homo-20-epivitamin D₃ / (22R)-1a,22,25-trihydroxy-26,27-dimethyl-24a-homo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22R)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,22,25-tetrol	VVD0564	Sachiko Yamada	26,27-dimethyl-24a-homo-20-epi-1a,22R,25-(OH)₃D₃	C₃₀H₅₀O₄	474.716		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 20 ; Inhibition of proliferation, 28 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.02 ; Calciuric effect in normal rats, 0.8. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with a Grignard reagent of side chain fragment giving major (19:1) 22R-hydroxy product as a key step. (Ref. 0321)				[0321]
562		(20S)-1a,20,25-trihydroxy-26,27-dimethyl-24a-homovitamin D₃ / (20S)-1a,20,25-trihydroxy-26,27-dimethyl-24a-homocholecalciferol	(5Z,7E)-(1S,3R,20S)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,20,25-tetrol	VVD0565	Sachiko Yamada	26,27-dimethyl-24a-homo-1a,20S,25-(OH)₃D₃	C₃₀H₅₀O₄	474.716		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 900% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 0.6% ; Calcemic activity determined by the increase in urinary calcium excretion in rats : < 0.5%. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by photochemical isomerization and deprotection. (Ref. 0279)				[0279]
563		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-24a-homovitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-24a-homocholecalciferol	(5Z,7E)-(1S,3R,22S)-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,22,25-tetrol	VVD0566	Sachiko Yamada	24-homo-26,27-dimethyl-1a,22S,25-(OH)₃D₃	C₃₀H₅₀O₄	474.716
564		1a,25-dihydroxy-2b-(3-hydroxypropoxy)vitamin D₃ / 1a,25-dihydroxy-2b-(3-hydroxypropoxy)cholecalciferol	(5Z,7E)-(1R,2R,3R)-2-(3-hydroxypropoxy)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0567	Sachiko Yamada	1a,25-(OH)₂-2b-(3-hydroxypropoxy)D₃	C₃₀H₅₀O₅	490.715		Binding potency to vitamin D binding protein of ED-71 was 2.7 times compared to 1a,25-(OH)₂D₃. Binding potency to vitamin D receptor was 1/8 compared to 1a,25-(OH)₂D₃. ED-71 improved bone mineral density and mechanical bone strength in the pre-osteoporosis model rats made by ovariectomy more effectively than 1a,25-(OH)₂D₃. (Ref. 0227)							(EtOH) lmax (nm) 263 (Ref. 0216)	(nujol) 3360, 1100, 1060, 910 cm^-¹ (Ref. 0216)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.91 (3H, d, J = 6.1 Hz), 1.21 (6H, s), 3.60-4.02 (5H, br), 4.12-4.36 (2H, m), 5.08 (1H, s), 5.49 (1H, s), 6.04 (1H, d, J = 10.5 Hz), 6.36 (1H, d, J = 10.5 Hz) (Ref. 0216)	m/z 490 (M⁺), 472, 454, 396, 59 (100%) (Ref. 0216)	Colorless foam. (Ref. 0216) HRMS Calcd 490.3658, Found 490.3678 (Ref. 0216)	Preparative TLC developed twice with CH₂Cl₂-EtOH (20 : 3) (Ref. 0216)		Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0216] / [0217] / [0227]
565		1b,25-dihydroxy-2b-(3-hydroxypropoxy)vitamin D₃ / 1b,25-dihydroxy-2b-(3-hydroxypropoxy)cholecalciferol	(5Z,7E)-(1S,2R,3R)-2-(3-hydroxypropoxy)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0568	Sachiko Yamada	2b-(3-hydroxypropoxy)-1b,25-(OH)₂D₃	C₃₀H₅₀O₅	490.715		The binding affinity for vitamin D receptor and vitamin D binding protein was 0.003 and 6.7 [1a,25-(OH)₂D₃ : 1]. (Ref. 0214)							(EtOH) lmax (nm) 264, lmin (nm) 227 (Ref. 0214)		¹H-NMR (d, CDCl₃) 0.54 (3H, s), 0.94 (3H, d, J = 6.5 Hz), 1.22 (6H, s), 3.58-3.64 (1H, m), 3.84 (2H, t, J = 5.4 Hz), 3.91 (2H, t, J = 5.4 Hz), 4.01-4.10 (1H, m), 4.28-4.33 (1H, br s), 5.08 (1H, s), 5.38 (1H, s), 6.03 (1H, d, J = 12.0 Hz), 6.43 (1H, d, J = 12.0 Hz) (Ref. 0214)	m/z 490 (M⁺), 60 (100%) (Ref. 0214)	HRMS Calcd 490.3658, Found 490.3706 (Ref. 0214)			Synthesis from pro-ED-71 by inversion of 1a-hydroxy group and photochemical method. (Ref. 0214)				[0214]
566		1a-hydroxy-22-[3-(1-hydroxy-1-methylethyl)phenyl]-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-22-[3-(1-hydroxy-1-methylethyl)phenyl]-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-22-[3-(1-hydroxy-1-methylethyl)phenyl]-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0569	Sachiko Yamada		C₃₁H₄₄O₃	464.679		(% of 1,25-(OH)₂D₃ effect) Intestinal calcium absorption: 13; bone calcium mobilization: 7.7; affinity for chick intestinal receptor, HL-60 cell receptor and serum vitamin D binding protein: 62, 32and 25, respectively; Inhibition of 1a-hydroxylase activity: 99; differentiation of HL-60 cells: 80. (Ref. 0364)														By coupling of enol trifltes of modified CD steroid fragment with the vitamin D A-ring enyne. (Ref. 0364)				[0364]
567		(17Z)-1a,25-dihydroxy-26,27-dimethyl-17,20,22,22,23,23-hexadehydro-24a,24b-dihomovitamin D₃ / (17Z)-1a,25-dihydroxy-26,27-dimethyl-17,20,22,22,23,23-hexadehydro-24a,24b-dihomocholecalciferol	(5Z,7E,17Z)-(1S,3R)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19),17(20)-cholestatetraen-22-yne-1,3,25-triol	VVD0570	Sachiko Yamada	17(20)Z-ene-22-yne-24-dihomo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₁H₄₆O₃	466.695		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 29000% ; Affinity for chicken intestinal vitamin D receptor, 2% ; Calciuric activity, 25%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-20-oxo-22,23,24,25,26,27-hexanorvitamin D₃ via reaction with appropriate lithium acetylide, treatment with acid, separation of regio- and stereoisomers, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
568		1a,25-dihydroxy-(26,26)-(27,27)-diethanovitamin D₃ / 1a,25-dihydroxy-(26,26)-(27,27)-diethanocholecalciferol	(5Z,7E)-(1S,3R)-(26,26)-(27,27)-diethano-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0571	Sachiko Yamada		C₃₁H₄₈O₃	468.711											¹H-NMR (d, CD₂Cl₂) 6.44 and 5.99 (2H, AB pattern, d, J = 11 Hz, 6- and 7-H), 5.27 (1H, br d, J = 3.5 Hz, 19E-H), 4.95 (1H, br d,J = 3.5 Hz, 19Z-H), 4.35 (1H, m, 1-H), 4.15 (1H, m, 3-H), 0.92 (3H, d, J = 6.2 Hz, 21C-CH₃), 0.81 (2H, m, 26- and 27-H), 0.53 (3H, s, 18C-CH₃), 0.34 (8H, m, 4-cyclopropylic CH₂) (Ref. 0195) ¹³C-NMR (d, CD₂Cl₂) 148.6 (C), 143.5 (C), 133.9 (C), 125.1 (CH), 117.6 (CH), 111.8 (C-19), 71.2 (CH), 71.0 (CH), 67.2, 57.2, 56.8, 45.8 (C-25), 43.5 (CH₂), 43.4 (CH₂), 41.0 (CH₂), 37.1 (CH₂), 36.6, 29.4 (CH₂), 28.0 (CH₂), 24.0 (CH₂), 22.6 (CH₂), 20.8 (CH₂), 19.0 (CH), 12.1, 0.8 (CH₂), -0.5 (CH₂) (Ref. 0195)									[0195]
569		(22E,24E)-1a,25-dihydroxy-26,27-dimethyl-22,23,24,24a-tetradehydro-24a,24b-dihomovitamin D₃ / (22E,24E)-1a,25-dihydroxy-26,27-dimethyl-22,23,24,24a-tetradehydro-24a,24b-dihomocholecalciferol	(5Z,7E,22E,24E)-(1S,3R)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19),22,24-cholestapentaene-1,3,25-triol	VVD0572	Sachiko Yamada	(22E,24E)-26,27-dimethyl-22,23,24,24a-tetradehydro-24a,24b-dihomo-1a,25-(OH)₂D₃	C₃₁H₄₈O₃	468.711		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 700% ; Induction of differentiation of U 937 cells, 200% ; Calciuric activity, 20%. (Ref. 0285)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction, photoisomerization and deprotection. (Ref. 0285)				[0285]
570		1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a,24b-dihomovitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a,24b-dihomocholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatrien-22-yne-1,3,25-triol	VVD0573	Sachiko Yamada	22-yne-24-dihomo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₁H₄₈O₃	468.711		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 10% ; Affinity for chicken intestinal vitamin D receptor, 2%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-22,22,23,23-tetradehydro-24,25,26,27-tetranorvitamin D₃, which was derived from corresponding 22-aldehyde, via side chain introduction, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
571		1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a,24b-dihomo-20-epivitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a,24b-dihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatrien-22-yne-1,3,25-triol	VVD0574	Sachiko Yamada	20-epi-22-yne-24-dihomo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₁H₄₈O₃	468.711		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 49000% ; Affinity for chicken intestinal vitamin D receptor, 7% ; Calciuric activity, 63%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-22,22,23,23-tetradehydro-24,25,26,27-tetranor-20-epivitamin D₃, which was derived from corresponding 22-aldehyde, via side chain introduction, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
572		(22R)-1a,25-dihydroxy-22-methoxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a-homovitamin D₃ / (22R)-1a,25-dihydroxy-22-methoxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a-homocholecalciferol	(5Z,7E)-(1S,3R,22R)-22-methoxy-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,25-triol	VVD0575	Sachiko Yamada	22R-methoxy-23-yne-24-homo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₁H₄₈O₄	484.710
573		(22S)-1a,25-dihydroxy-22-methoxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epivitamin D₃ / (22S)-1a,25-dihydroxy-22-methoxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-26,27-dimethyl-22-methoxy-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,25-triol	VVD0576	Sachiko Yamada	22S-methoxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epi-1a,25-(OH)₂D₃	C₃₁H₄₈O₄	484.710		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 200 ; Inhibition of proliferation, 620 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.14 ; Calciuric effect in normal rats, 1.1. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
574		(22S)-1a,25-dihydroxy-22-ethoxy-26,27-dimethyl-23,24-tetradehydro-20-epivitamin D₃ / (22S)-1a,25-dihydroxy-22-ethoxy-26,27-dimethyl-23,24-tetradehydro-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-26,27-dimethyl-22-ethoxy-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,25-triol	VVD0577	Sachiko Yamada	22S-ethoxy-26,27-dimethyl-23,24-tetradehydro-20-epi-1a,25-(OH)₂D₃	C₃₁H₄₈O₄	484.710		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 1000 ; Inhibition of proliferation, 790 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.19 ; Calciuric effect in normal rats, 1. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
575		(22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a,24b-dihomovitamin D₃ / (22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a,24b-dihomocholecalciferol	(5Z,7E)-(1S,3R,22R)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0578	Sachiko Yamada	23-yne-24-dihomo-26,27-dimethyl-1a,22R,25-(OH)₃D₃	C₃₁H₄₈O₄	484.710
576		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a,24b-dihomovitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a,24b-dihomocholecalciferol	(5Z,7E)-(1S,3R,22S)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0579	Sachiko Yamada	23-yne-24-dihomo-26,27-dimethyl-1a,22S,25-(OH)₃D₃	C₃₁H₄₈O₄	484.710
577		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a,24b-dihomo-20-epivitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a,24b-dihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0580	Sachiko Yamada	23,24-tetradehydro-24a,24b-dihomo-20-epi-1a,22R,25-(OH)₃D₃	C₃₁H₄₈O₄	484.710		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 100 ; Inhibition of proliferation, 12 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.005. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
578		(22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a,24b-dihomo-20-epivitamin D₃ / (22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a,24b-dihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22R)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0581	Sachiko Yamada	26,27-dimethyl-23,24-tetradehydro-24a,24b-dihomo-20-epi-1a,22R,25-(OH)₃D₃	C₃₁H₄₈O₄	484.710		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 0.5 ; Inhibition of proliferation, < 0.1 ; VDR (rachitic chicken intestinal receptor) binding affinity, <0.005. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving minor (1:19) 22R-hydroxy product. (Ref. 0321)				[0321]
579		1a,25-dihydroxy-22-oxavitamin D₃ 3-hemiglutarate/ 1a,25-dihydroxy-22-oxacholecalciferol 3-hemiglutarate	(5Z,7E)-(1S,3R)-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol 3-hemiglutarate	VVD0582	Sachiko Yamada	22-oxa-1a,25-(OH)₂D₃-3-hemiglutarate	C₃₁H₄₈O₇	532.709		Haptenic derivative of OCT to produce a specific anti-OCT antibody. (Ref. 0204)							(EtOH) lmax (nm) 263, lmin (nm) 227 (Ref. 0204)		¹H-NMR (d, CDCl₃, 200MHz) 0.53 (3H, s, 18-H), 1.19 (3H, d, J = 6.1Hz, 21-H), 1.23 (6H, s, 26- and 27-H), 2.33-2.42 (4H, m, 2 CH₂CO), 3.18-3.31, 3.42-3.53 (each 1H, m, 23-H), 3.84 (1H, m, 20-H), 4.39 (1H, m, 1-H), 4.98 (1H, br s, 19-H), 5.17 (1H, m, 3-H), 5.33 (1H, br s, 19-H), 5.98 (1H, d, J = 11.0 Hz, 7-H), 6.29 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0204)	m/z 532 (M⁺) (Ref. 0204)		Flash column chromatography with CH₂Cl₂/EtOH (12 : 1). (Ref. 0204)		Synthesis from (5Z,7E)-(1S,3R)-1,25-dihydroxy-22-oxa-9,10-secocholesta-5,7,10(19)-trien-3-yl (2,2'2'-trichloroethylglutarate) by deprotection. (Ref. 0204)				[0204]
580		(10E)-19-(3-carboxylpropyl)vitamin D₃ / (10E)-19-(3-carboxylpropyl)cholecalciferol	(5Z,7E,10E)-(3S)-19-(3-carboxylpropyl)-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0583	Sachiko Yamada	(10E)-19-(3-carboxylpropyl)-D₃	C₃₁H₅₀O₃	470.727									(95% EtOH) lmax (nm) 264 (Ref. 0331)	(CHCl₃) 1705 cm^-¹ (Ref. 0331)	¹H-NMR (d, CDCl₃) 0.55 (s, 18-H), 5.35 (t, J = 7.0 Hz, 19-H), 6.23 (d, J = 12.0 Hz, 6-H), 5.95 (d, J = 12.0 Hz, 7-H), 3.96 (m, 3-H) (Ref. 0331) ¹³C-NMR (d, CDCl₃) 45.85 (t, C-4), 141.65 (s, C-5), 121.99 (d, C-6), 117.60 (d, C-7), 141.70 (s, C-8), 128.15 (s, C-10), 121.90 (d, C-19) (Ref. 0331)	m/z 470 (M⁺), 152, 222 (Ref. 0331)				From vitamin D₃ via electrophilic substitution of its sulfur dioxide adduct. (Ref. 0331)				[0331]
581		(5E,10E)-19-(3-carboxylpropyl)vitamin D₃ / (5E,10E)-19-(3-carboxylpropyl)cholecalciferol	(5E,7E,10E)-(3S)-19-(3-carboxylpropyl)-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0584	Sachiko Yamada	(5E,10E)-19-(3-carboxylpropyl)-D₃	C₃₁H₅₀O₃	470.727									(95% EtOH) lmax (nm) 264 (Ref. 0331)	(CHCl₃) 1705 cm^-¹ (Ref. 0331)	¹H-NMR (d, CDCl₃) 0.57 (s, 18-H), 5.20 (t, J = 7.0 Hz, 19-H), 6.23 (d, J = 12.0 Hz, 6-H), 5.89 (d, J = 12.0 Hz, 7-H), 3.88 (m, 3-H) (Ref. 0331) ¹³C-NMR (d, CDCl₃) 37.95 (t, C-4), 143.25 (s, C-5), 123.20 (d, C-6), 114.90 (d, C-7), 140.59 (s, C-8), 131.40 (s, C-10), 122.98 (d, C-19) (Ref. 0331)	m/z 470 (M⁺), 452 (M⁺-H₂O), 222 [A ring + C(6) + C(7) + C(19)] (Ref. 0331)				From vitamin D₃ via electrophilic substitution of its sulfur dioxide adduct. (Ref. 0331)				[0331]
582		26,27-diethyl-1a,25-dihydroxy-20,21-methano-23-oxavitamin D₃ / 26,27-diethyl-1a,25-dihydroxy-20,21-methano-23-oxacholecalciferol	(5Z,7E)-(1S,3R)-26,27-diethyl-20,21-methano-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0585	Sachiko Yamada	20,21-methano-23-oxa-26,27-diethyl-1a,25-(OH)₂D₃	C₃₁H₅₀O₄	486.726		Biological activity : Affinity for pig intestinal nuclear receptor, 50% of 1,25-(OH)₂D₃ effect ; Affinity for human vitamin D binding protein, < 0.02% of 25-OHD₃ effect ; Differentiation of HL-60 cells, 12.5% of 1,25-(OH)₂D₃ effect ; Calciuric effect, 0.3% of 1,25-(OH)₂D₃ effect. (Ref. 0299)																		[0299]
583		1b-butyl-1a,25-dihydroxyvitamin D₃ / 1b-butyl-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-1-butyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0586	Sachiko Yamada	1b-butyl-1a,25-(OH)₂D₃	C₃₁H₅₂O₃	472.743		Binding affinity for calf thymus vitamin D receptor : < 1/1000 relative to 1,25-(OH)₂D₃. (Ref. 0181)							(95% EtOH) lmax (nm) 262, 252 (sh) (Ref. 0181)	(Neat) 3386, 2950, 2871, 1467, 1377, 1215, 1147, 1028, 911 cm^-¹ (Ref. 0181)	¹H-NMR (d, CDCl₃) 0.54 (3H, s), 0.90 (3H, t, J = 7.3 Hz), 0.93 (3H, d, J = 6.2 Hz), 1.21 (6H, s), 4.17 (1H, m), 4.99 and 5.30 (each 1H, d, J = 1.2 Hz), 5.96 and 6.36 (each 1H, d, J = 11.6 Hz) (Ref. 0181)	m/z 472 (M⁺, 2), 454 (18), 436 (10), 415 (12), 397 (9), 379 (8), 361 (5), 307 (5), 197 (18), 155 (60), 151 (100) (Ref. 0181)				From 1a,25-dihydroxyvitamin D₃: Oxidation of the 1-hydroxyl group, treatment with BuLi and thermal isomerization gave 1a,25-dihydroxy-1b-butylvitamin D₃ and its 1-epimer (1b,25-dihydroxy-1a-butylvitamin D₃) in 92:58 ratio. (Ref. 0181)				[0181]
584		1a-butyl-1b,25-dihydroxyvitamin D₃ / 1a-butyl-1b,25-dihydroxycholecalciferol	(5Z,7E)-(1R,3R)-1-butyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0587	Sachiko Yamada	1a-butyl-1b,25-(OH)₂D₃	C₃₁H₅₂O₃	472.743		Binding affinity for calf thymus vitamin D receptor : < 1/1000 relative to 1,25-(OH)₂D₃. (Ref. 0181)							(95% EtOH) lmax (nm) 263 (Ref. 0181)	(Neat) 3380, 2948, 2869, 1595, 1464, 1377, 1128, 1049, 911 cm^-¹ (Ref. 0181)	¹H-NMR (d, CDCl₃) 0.51 (3H, s), 0.88 (3H, t, J = 7.3 Hz), 0.93 (3H, d, J = 6.8 Hz), 1.22 (6H, s), 3.93 (1H, tt, J = 9.1 and 4.3 Hz), 4.99 and 5.32 (each 1H, d, J = 1.5 Hz), 5.97 and 6.34 (each 1H, d, J = 11.0 Hz) (Ref. 0181)	m/z 472 (M⁺, 1), 454 (13), 436 (5), 415 (9), 397 (5), 379 (4), 361 (2), 307 (4), 155 (22), 151 (100) (Ref. 0181)				From 1a,25-dihydroxyvitamin D₃: Oxidation of the 1-hydroxyl group, treatment with BuLi and thermal isomerization gave 1b,25-dihydroxy-1a-butylvitamin D₃ and its 1-epimer (1a,25-dihydroxy-1b-butylvitamin D₃) in 58:92 ratio. (Ref. 0181)				[0181]
585		26,27-diethyl-1a,25-dihydroxyvitamin D₃ / 26,27-diethyl-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R)-26,27-diethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0588	Sachiko Yamada	26,27-diethyl-1a,25-(OH)₂D₃	C₃₁H₅₂O₃	472.743		The title compound was at least 10 fold as active as 1,25-(OH)₂D₃ in inhibiting proliferation of HL-60 cells : IC50 value was 2 nM for the title compound and 25 nM for 1,25-(OH)₂D₃. (Ref. 0245) Binding affinity of the title compound for serum vitamin D binding protein (DBP) and for the receptor of HL-60 cells was < 1% and 21%, respectively, of those of 1,25-(OH)₂D₃. The ability of the title compound to induce HL-60 cell differentiation (assayed by NBT reduction) was approximately equal to that of 1,25-(OH)₂D₃ under serum-supplemented culture conditions, whereas the same compound was less active than 1,25-(OH)₂D₃ under serum-free culture conditions. (Ref. 0275) Dose response of various 26,27-dialkyl-1,25-(OH)₂D₃ in bone Ca mobilization. (Ref. 0276)							lmax (nm) 265, lmin (nm) 228 (Ref. 0245) lmax (nm) 264.5, lmin (nm) 228 (Ref. 0277)		¹H-NMR (d, CDCl₃) 0.54 (3H, s, 18-H₃), 0.88 (6H, t, J = 6.7 Hz, 26- and 27-CH₂CH₃), 0.93 (3H, d, J = 5.7 Hz, 21-H₃), 4.23 (1H, m, 3-H), 4.43 (1H, m, 1-H), 5.01 (1H, br s, 19Z-H), 5.33 (1H, br s, 19E-H), 6.02 (1H, d, J = 11.0 Hz, 7-H), 6.38 (1H, d, J = 11.0 Hz, 6-H) (Ref. 0277)	m/z 472 (M⁺), 454, 436, 410, 393, 269, 251, 152, 134 (Ref. 0245) m/z 472 (M⁺), 454, 436, 410, 393, 269, 251, 152, 134, 115 (Ref. 0277)				The desired provitamin D was synthesized from cholenic acid by introducing 1a-hydroxyl group, the desired side chain and a double bond to the 7-position. The provitamin D was converted to the title compound by photochemical method. (Ref. 0245)				[0245] / [0275] / [0276] / [0277]
586		1a,25-dihydroxy-26,27-dimethyl-24a,24b-dihomovitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-24a,24b-dihomocholecalciferol	(5Z,7E)-(1S,3R)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatrien-1,3,25-triol	VVD0589	Sachiko Yamada	26,27-dimethyl-24a,24b-dihomo-1a,25-(OH)₂2D₃	C₃₁H₅₂O₃	472.743		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 40% ; Induction of differentiation of U 937 cells, 10% ; Calciuric activity, 2%. (Ref. 0285)														From hydroxy protected (5E)-23,24,25,26,27-pentanorvitamin D₃ 22-bis(methylseleno)acetal via displacement of one methylseleno group by side chain fragment, reduction of the other methylseleno group via 6,19-SO₂ adduct, desulfonylation, dye-sensitized photoisomerization and deprotection. (Ref. 0285)				[0285]
587		1a-hydroxy-2b-(4-hydroxybutoxy)vitamin D₃ / 1a-hydroxy-2b-(4-hydroxybutoxy)cholecalciferol	(5Z,7E)-(1R,2R,3R)-2-(4-hydroxybutoxy)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0590	Sachiko Yamada	2b-(4-hydroxybutoxy)-1a-OHD₃	C₃₁H₅₂O₄	488.742		Plasma calcium levels in rats fed with a low calcium/vitamin D deficient diet after administration (6.25mg/kg 5). (Ref. 0216)							(EtOH) lmax (nm) 263.5 (Ref. 0216)		¹H-NMR (d, CDCl₃) 0.54 (3H, s), 0.86 (6H, d, J = 6.6 Hz), 0.91 (3H, d, J = 6.1 Hz), 3.36-3.88 (5H, br), 4.12-4.36 (2H, m), 5.08 (1H, s), 5.50 (1H, s), 6.04 (1H, d, J = 11.4 Hz), 6.36 (1H, d, J = 11.4 Hz) (Ref. 0216)	m/z 488 (M⁺), 470, 452, 398, 380, 150 (100%) (Ref. 0216)	HRMS Calcd 488.3866, Found 488.3866 (Ref. 0216)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0216)				[0216]
588		1a,25-dihydroxy-2b-(4-hydroxybutyl)vitamin D₃ / 1a,25-dihydroxy-2b-(4-hydroxybutyl)cholecalciferol	(5Z,7E)-(1S,2R,3R)-2-(4-hydroxybutyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0591	Sachiko Yamada	2b-(4-hydroxybutyl)-1a,25-(OH)₂D₃	C₃₁H₅₂O₄	488.742		Spinal bone mineral density in pre-osteoporosis model rats and binding affinity to calf thymus vitamin D receptor. (Ref. 0217)							(EtOH) lmax (nm) 264, lmin (nm) 229 (Ref. 0217)	(neat) 3850 (br), 2945, 2875 cm^-¹ (Ref. 0217)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.94 (3H, d, J = 5.9 Hz), 1.22 (6H, s), 3.68 (2H, t, J = 6.1 Hz), 4.01-4.12 (1H, m), 4.16 (1H, br s), 5.02 (1H, s), 5.37 (1H, s), 6.03 (1H, d, J = 11.3 Hz), 6.34 (1H, d, J = 11.3 Hz) (Ref. 0217)	m/z 488 (M⁺), 133 (100%) (Ref. 0217)	HRMS Calcd 488.3865, Found 488.3896 (Ref. 0217)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0217]
589		(20S)-1a,25-dihydroxy-20-methoxy-26,27-dimethyl-24a-homovitamin D₃ / (20S)-1a,25-dihydroxy-20-methoxy-26,27-dimethyl-24a-homocholecalciferol	(5Z,7E)-(1S,3R,20S)-20-methoxy-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0592	Sachiko Yamada	20S-methoxy-26,27-dimethyl-24a-homo-1a,25(OH)₂D₃	C₃₁H₅₂O₄	488.742		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 30000% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 1% ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 6%. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by methylation, photochemical isomerization and deprotection. (Ref. 0279)				[0279]
590		26,27-diethyl-1a,25-dihydroxy-24a-homo-22-oxa-20-epivitamin D₃ / 26,27-diethyl-1a,25-dihydroxy-24a-homo-22-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-diethyl-24a-homo-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0593	Sachiko Yamada	20-epi-22-oxa-24-homo-26,27-diethyl-1a,25-(OH)₂D₃	C₃₁H₅₂O₄	488.742
591		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-24a,24b-dihomovitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-24a,24b-dihomocholecalciferol	(5Z,7E)-(1S,3R,22S)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatriene-1,3,22,25-tetrol	VVD0594	Sachiko Yamada	24-dihomo-26,27-dimethyl-1a,22S,25-(OH)₃D₃	C₃₁H₅₂O₄	488.742
592		(20S)-1a,25-dihydroxy-20-ethoxy-26,27-dimethylvitamin D₃ / (20S)-1a,25-dihydroxy-20-ethoxy-26,27-dimethylcholecalciferol	(5Z,7E)-(1S,3R,20S)-20-ethoxy-26,27-dimethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0595	Sachiko Yamada	20S-ethoxy-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₁H₅₂O₄	488.742		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 500000% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 7% ; Calcemic activity determined by the increase in urinary calcium excretion in rats : 14%. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by ethylation, photochemical isomerization and deprotection. (Ref. 0279)				[0279]
593		(20S)-1a,20,25-trihydroxy-26,27-diethylvitamin D₃ / (20S)-1a,20,25-trihydroxy-26,27-diethylcholecalciferol	(5Z,7E)-(1S,3R,20S)-26,27-diethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,20,25-tetrol	VVD0596	Sachiko Yamada	26,27-diethyl-1a,20S,25-(OH)₃D₃	C₃₁H₅₂O₄	488.742		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : < 10% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 0.5% ; Calcemic activity : not determined. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by photochemical isomerization and deprotection. (Ref. 0279)				[0279]
594		(22R)-1a,22,25-trihydroxy-26,27-dimethyl-24a,24b-dihomo-20-epivitamin D₃ / (22R)-1a,22,25-trihydroxy-26,27-dimethyl-24a,24b-dihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22R)-26,27-dimethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatriene-1,3,22,25-tetrol	VVD0597	Sachiko Yamada	26,27-dimethyl-24a,24b-dihomo-20-epi-1a,22R,25-(OH)₃D₃	C₃₁H₅₂O₄	488.742		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 100 ; Inhibition of proliferation, 210 ; VDR (rachitic chicken intestinal receptor) binding affinity, < 0.005. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with Grignard reagent of side chain fragment giving major (19:1) 22R-hydroxy product as a key step. (Ref. 0321)				[0321]
595		1a,25-dihydroxy-2b-(4-hydroxybutoxy)vitamin D₃ / 1a,25-dihydroxy-2b-(4-hydroxybutoxy)cholecalciferol	(5Z,7E)-(1R,2R,3R)-2-(4-hydroxybutoxy)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0598	Sachiko Yamada	2b-(4-hydroxybutoxy)-1a,25-(OH)₂D₃	C₃₁H₅₂O₅	504.742		Spinal bone mineral density in pre-osteoporosis model rats and binding affinity to calf thymus vitamin D receptor. (Ref. 0217)							(EtOH) lmax (nm) 264, lmin (nm) 226 (Ref. 0217)		¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.94 (3H, d, J = 5.9 Hz), 1.21 (6H, s), 3.15-3.20 (1H, m), 3.45-4.38 (6H, m), 5.08 (1H, s), 5.48 (1H, s), 6.05 (1H, d, J = 11.6 Hz), 6.36 (1H, d, J = 11.6 Hz) (Ref. 0217)	m/z 504 (M⁺), 59 (100%) (Ref. 0217)	HRMS Calcd 504.3815, Found 504.3780 (Ref. 0217)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0217]
596		1a,25-dihydroxy-2b-butoxyvitamin D₃ / 1a,25-dihydroxy-2b-butoxycholecalciferol	(5Z,7E)-(1R,2R,3R)-2-butoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0599	Sachiko Yamada	2b-butoxy-1a,25-(OH)₂D₃	C₃₁H₅₄O₄	490.758		Spinal bone mineral density in pre-osteoporosis model rats and binding affinity to calf thymus vitamin D receptor. (Ref. 0217)							(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0217)	(neat) 3390 (br), 2962, 2929, 2871, 1683, 1376, 1261, 1097, 1031, 802 cm^-¹ (Ref. 0217)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.91-0.99 (6H, m), 1.22 (6H, s), 3.22 (1H, dd, J = 9.1 and3.7 Hz), 3.47-3.58 (1H, m), 3.65-3.77 (1H, m), 4.23 (1H, br s), 4.29 (1H, d, J = 6.6 Hz), 5.08 (1H, s), 5.90 (1H, s), 6.08 (1H, d, J = 12.2 Hz), 6.34 (1H, d, J = 12.2 Hz) (Ref. 0217)	m/z 488 (M⁺), 59 (100%) (Ref. 0217)	HRMS Calcd 488.3866, Found 488.3869 (Ref. 0217)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0217]
597		1a-hydroxy-23-[3-(1-hydroxy-1-methylethyl)phenyl]-22,22,23,23-tetradehydro-24,25,26,27-tetranorvitamin D₃ / 1a-hydroxy-23-[3-(1-hydroxy-1-methylethyl)phenyl]-22,22,23,23-tetradehydro-24,25,26,27-tetranorcholecalciferol	(5Z,7E)-(1S,3R)-23-[3-(1-hydroxy-1-methylethyl)phenyl]-24-nor-9,10-seco-5,7,10(19)-cholatrien-22-yne-1,3-diol	VVD0600	Sachiko Yamada		C₃₂H₄₂O₃	474.674
598		11-(3-acetoxy-1-propynyl)-1a,25-dihydroxy-9,11-didehydrovitamin D₃ / 11-(3-acetoxy-1-propynyl)-1a,25-dihydroxy-9,11-didehydrocholecalciferol	(5Z,7E)-(1S,3R)-11-(3-acetoxy-1-propynyl)-9,10-seco-5,7,9(11),10(19)-cholestatetraene-1,3,25-triol	VVD0601	Sachiko Yamada		C₃₂H₄₆O₅	510.705
599		(22E,24E,24bE)-1a,25-dihydroxy-26,27-dimethyl-22,23,24,24a,24b,24c-hexadehydro-24a,24b,24c-trihomovitamin D₃ / (22E,24E,24bE)-1a,25-dihydroxy-26,27-dimethyl-22,23,24,24a,24b,24c-hexadehydro-24a,24b,24c-trihomocholecalciferol	(5Z,7E,22E,24E,24bE)-(1S,3R)-26,27-dimethyl-24a,24b,24c-trihomo-9,10-seco-5,7,10(19),22,24,24b-cholestahexaene-1,3,25-triol	VVD0602	Sachiko Yamada	(22E,24E,24bE)-26,27-dimethyl-22,23,24,24a,24b,24c-hexadehydro-24a,24b,24c-trihomo-1a,25-(OH)₂D₃	C₃₂H₄₈O₃	480.722		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, < 80% ; Induction of differentiation of U 937 cells, < 5%. (Ref. 0285)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction, photoisomerization and deprotection. (Ref. 0285)				[0285]
600		(22E,24E)-1a,25-dihydroxy-26,27-diethyl-22,23,24,24a-tetradehydro-24a-homovitamin D₃ / (22E,24E)-1a,25-dihydroxy-26,27-diethyl-22,23,24,24a-tetradehydro-24a-homocholecalciferol	(5Z,7E,22E,24E)-(1S,3R)-26,27-diethyl-24a-homo-9,10-seco-5,7,10(19),22,24-cholestapentaene-1,3,25-triol	VVD0603	Sachiko Yamada	(22E,24E)-26,27-diethyl-22,23,24,24a-tetradehydro24a-homo-1a,25-(OH)₂D₃	C₃₂H₅₀O₃	482.738		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, < 70% ; Induction of differentiation of U 937 cells, < 10%. (Ref. 0285)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanorvitamin D₃ via side chain introduction by Wittig reaction followed by Grignard reaction, photoisomerization and deprotection. (Ref. 0285)				[0285]
601		1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a,24b,24c-trihomo-20-epivitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22,22,23,23-tetradehydro-24a,24b,24c-trihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-dimethyl-24a,24b,24c-trihomo-9,10-seco-5,7,10(19)-cholestatrien-22-yne-1,3,25-triol	VVD0604	Sachiko Yamada	20-epi-22-yne-24-trihomo-26,27-dimethyl-1a,25-(OH)₂D₃	C₃₂H₅₀O₃	482.738		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 2500% ; Affinity for chicken intestinal vitamin D receptor, 76%. (Ref. 0293)														From hydroxy protected (5E)-1a-hydroxy-22,22,23,23-tetradehydro-24,25,26,27-tetranor-20-epivitamin D₃, which was derived from corresponding 22-aldehyde, via side chain introduction, dye-sensitized photoisomerization and deprotection. (Ref. 0293)				[0293]
602		(22S)-1a,25-dihydroxy-22-ethoxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epivitamin D₃ / (22S)-1a,25-dihydroxy-22-ethoxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-26,27-dimethyl-22-ethoxy-24a-homo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,25-triol	VVD0605	Sachiko Yamada	22S-ethoxy-26,27-dimethyl-23,24-tetradehydro-24a-homo-20-epi-1a,25-(OH)₂D₃	C₃₂H₅₀O₄	498.737		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, > 500 ; Inhibition of proliferation, 840 ; VDR (rachitic chicken intestinal receptor) binding affinity, 0.002 ; Calciuric effect in normal rats, 0.2. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
603		(22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a,24b,24c-trihomo-20-epivitamin D₃ / (22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a,24b,24c-trihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22R)-26,27-dimethyl-24a,24b,24c-trihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0606	Sachiko Yamada	23,24-tetradehydro-24a,24b,24c-trihomo-20-epi-1a,22R,25-(OH)₃D₃	C₃₂H₅₀O₄	498.737		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, < 0.01; Inhibition of proliferation, 0.07; VDR (rachitic chicken intestinal receptor) binding affinity, < 0.003. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving minor (1:19) 22R-hydroxy product. (Ref. 0321)				[0321]
604		(22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a,24b,24c-trihomovitamin D₃ / (22R)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a,24b,24c-trihomocholecalciferol	(5Z,7E)-(1S,3R,22R)-26,27-dimethyl-24a,24b,24c-trihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0607	Sachiko Yamada	23-yne-24-trihomo-26,27-dimethyl-1a,22R,25-(OH)₃D₃	C₃₂H₅₀O₄	498.737
605		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a,24b,24c-trihomo-20-epivitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,24-tetradehydro-24a,24b,24c-trihomo-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R,22S)-26,27-dimethyl-24a,24b,24c-trihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0608	Sachiko Yamada	23,24-tetradehydro-24a,24b,24c-trihomo-20-epi-1a,22S,25-(OH)₃D₃	C₃₂H₅₀O₄	498.737		Relative potency (1,25-(OH)₂D₃ = 1) : Induction of differentiation of U 937 cells, 1 ; Inhibition of proliferation, 0.2 ; VDR (rachitic chicken intestinal receptor) binding affinity, < 0.003. (Ref. 0321)														From protected (5E)-1a-hydroxy-22-oxo-23,24,25,26,27-pentanor-20-epivitamin D₃ via the reaction with lithiated acetylene side chain fragment giving major (19:1) 22S-hydroxy product as a key step. (Ref. 0321)				[0321]
606		(22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a,24b,24c-trihomovitamin D₃ / (22S)-1a,22,25-trihydroxy-26,27-dimethyl-23,23,24,24-tetradehydro-24a,24b,24c-trihomocholecalciferol	(5Z,7E)-(1S,3R,22S)-26,27-dimethyl-24a,24b,24c-trihomo-9,10-seco-5,7,10(19)-cholestatrien-23-yne-1,3,22,25-tetrol	VVD0609	Sachiko Yamada	23-yne-24-trihomo-26,27-dimethyl-1a,22S,25-(OH)₃D₃	C₃₂H₅₀O₄	498.737
607		1a,25-dihydroxy-2b-pentylvitamin D₃ / 1a,25-dihydroxy-2b-pentylcholecalciferol	(5Z,7E)-(1S,2R,3R)-2-pentyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0610	Sachiko Yamada	2b-pentyl-1a,25-(OH)₂D₃	C₃₂H₅₄O₃	486.769		Spinal bone mineral density in pre-osteoporosis model rats and binding affinity to calf thymus vitamin D receptor. (Ref. 0217)							(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0217)	(neat) 3400 (br), 2945, 2871, 1468, 1377, 1068, 910, 758 cm^-¹ (Ref. 0217)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.89 (3H, t, J = 6.8 Hz), 0.94 (3H, d, J = 6.3 Hz), 1.22 (6H, s), 5.02 (1H, s), 5.38 (1H, s), 6.04 (1H, d, J = 11.2 Hz), 6.34 (1H, d, J = 11.2 Hz) (Ref. 0217)	m/z 486 (M⁺), 133 (100%) (Ref. 0217)	HRMS Calcd 486.4071, Found 486.4071 (Ref. 0217)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0217]
608		1a,25-dihydroxy-26,27-diethyl-24a-homovitamin D₃ / 1a,25-dihydroxy-26,27-diethyl-24a-homocholecalciferol	(5Z,7E)-(1S,3R)-26,27-diethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0611	Sachiko Yamada	26,27-diethyl-24a-homo-1a,25-(OH)₂D₃	C₃₂H₅₄O₃	486.769		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, 90% ; Induction of differentiation of U 937 cells, 50%. (Ref. 0285)														From hydroxy protected (5E)-22-tosyloxy-23,24,25,26,27-pentanorvitamin D₃ via cuprate catalyzed Grignard reaction, photoisomerization and deprotection. (Ref. 0285)				[0285]
609		1a-hydroxy-2b-(5-hydroxypentoxy)vitamin D₃ / 1a-hydroxy-2b-(5-hydroxypentoxy)cholecalciferol	(5Z,7E)-(1R,2R,3R)-2-(5-hydroxypentoxy)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol	VVD0612	Sachiko Yamada	2b-(5-hydroxypentoxy)-1a-OHD₃	C₃₂H₅₄O₄	502.769		Plasma calcium levels in rats fed with a low calcium/vitamin D deficient diet after administration (6.25mg/kg 5). (Ref. 0216)							(EtOH) lmax (nm) 263.5 (Ref. 0216)		¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.86 (6H, d, J = 6.6 Hz), 0.91 (3H, d, J = 5.8 Hz), 3.34-3.82 (5H, br), 4.10-4.36 (2H, m), 5.08 (1H, s), 5.50 (1H, s), 6.04 (1H, d, J = 10.8 Hz), 6.36 (1H, d, J = 10.8 Hz) (Ref. 0216)	m/z 502 (M⁺), 484, 466, 380 (100%) (Ref. 0216)	HRMS Calcd 502.4022, Found 502.4010 (Ref. 0216)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0216)				[0216]
610		1a,25-dihydroxy-2b-(5-hydroxypentyl)vitamin D₃ / 1a,25-dihydroxy-2b-(5-hydroxypentyl)cholecalciferol	(5Z,7E)-(1S,2R,3R)-2-(5-hydroxypentyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0613	Sachiko Yamada	2b-(5-hydroxypentyl)-1a,25-(OH)₂D₃	C₃₂H₅₄O₄	502.769		Spinal bone mineral density in pre-osteoporosis model rats and binding affinity to calf thymus vitamin D receptor. (Ref. 0217)							(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0217)	(neat) 3349 (br), 2962, 2929, 2873, 1261, 1079, 1052, 802 cm^-¹ (Ref. 0217)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.94 (3H, d, J = 5.9 Hz), 1.22 (6H, s), 3.63 (2H, t, J = 6.4 Hz), 4.00-4.09 (1H, m), 4.10-4.18 (1H, m), 5.02 (1H, s), 5.37 (1H, s), 6.03 (1H, d, J = 11.6 Hz), 6.35 (1H, d, J = 11.6 Hz) (Ref. 0217)	m/z 502 (M⁺), 59 (100%) (Ref. 0217)	HRMS Calcd 502.4022, Found 502.4070 (Ref. 0217)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0217]
611		(20S)-1a,25-dihydroxy-20-methoxy-26,27-diethylvitamin D₃ / (20S)-1a,25-dihydroxy-20-methoxy-26,27-diethylcholecalciferol	(5Z,7E)-(1S,3R,20S)-20-methoxy-26,27-diethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0614	Sachiko Yamada	20S-methoxy-26,27-diethyl-1a,25-(OH)₂D₃	C₃₂H₅₄O₄	502.769		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 10% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 0.9% ; Calcemic activity : not determined. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by methylation, photochemical isomerization and deprotection. (Ref. 0279)				[0279]
612		(20S)-1a,25-dihydroxy-20-ethoxy-26,27-dimethyl-24a-homovitamin D₃ / (20S)-1a,25-dihydroxy-20-ethoxy-26,27-dimethyl-24a-homocholecalciferol	(5Z,7E)-(1S,3R,20S)-20-ethoxy-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0615	Sachiko Yamada	20S-ethoxy-26,27-dimethyl-24a-homo-1a,25-(OH)₂D₃	C₃₂H₅₄O₄	502.769		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of U 937 cell (human histiocytic lymphoma cell line) proliferation : 30000% ; Binding to the 1,25-(OH)₂D₃ receptor from rachitic chicken intestine : 1% ; Calcemic activity : not determined. (Ref. 0279)														From (5E)-1a-hydroxy-20-keto-22,23,24,25,26,27-hexanorvitamin D₃ derivative by addition of a Grignard reagent followed by ethylation, photochemical isomerization and deprotection. (Ref. 0279)				[0279]
613		26,27-diethyl-1a,25-dihydroxy-24a,24b-dihomo-23-oxa-20-epivitamin D₃ / 26,27-diethyl-1a,25-dihydroxy-24a,24b-dihomo-23-oxa-20-epicholecalciferol	(5Z,7E)-(1S,3R,20R)-26,27-diethyl-24a,24b-dihomo-23-oxa-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0616	Sachiko Yamada	20-epi-20-oxa-24-dihomo-26,27-diethyl-1a,25-(OH)₂D₃	C₃₂H₅₄O₄	502.769
614		1a,25-dihydroxy-2b-(5-hydroxypentoxy)vitamin D₃ / 1a,25-dihydroxy-2b-(5-hydroxypentoxy)cholecalciferol	(5Z,7E)-(1R,2R,3R)-2-(5-hydroxypentoxy)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0617	Sachiko Yamada	2b-(5-hydroxypentoxy)-1a,25-(OH)₂D₃	C₃₂H₅₄O₅	518.768		Spinal bone mineral density in pre-osteoporosis model rats and binding affinity to calf thymus vitamin D receptor. (Ref. 0217)							(EtOH) lmax (nm) 264, lmin (nm) 228 (Ref. 0217)	(neat) 3400 (br), 2930, 2886, 1090, 910, 740 cm^-¹ (Ref. 0217)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.94 (3H, d, J = 6.6 Hz), 1.22 (6H, s), 3.45-4.40 (7H, m), 5.08 (1H, s), 5.50 (1H, s), 6.04 (1H, d, J = 10.5 Hz), 6.36 (1H, d, J = 10.5 Hz) (Ref. 0217)	m/z 518 (M⁺), 69 (100%) (Ref. 0217)	Colorless foam (Ref. 0217) HRMS Calcd 518.3917, Found 518.4014 (Ref. 0217)	Preparative TLC developed with CH₂Cl₂-EtOH (10:1). (Ref. 0217)		Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0217]
615		1a,25-dihydroxy-11a-phenylvitamin D₃ / 1a,25-dihydroxy-11a-phenylcholecalciferol	(5Z,7E)-(1S,3R,11S)-11-phenyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0618	Sachiko Yamada	11a-phenyl-1a,25-(OH)₂D₃	C₃₃H₄₈O₃	492.732		Biological activity of C-ring analogs of 1a,25-(OH)₂D₃ : Table(Ref. 0224)														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of organocopper reagent to 9(11)-en-8-one of the CD-ring fragment. (Ref. 0224)				[0224]
616		1a,25-dihydroxy-11b-phenylvitamin D₃ / 1a,25-dihydroxy-11b-phenylcholecalciferol	(5Z,7E)-(1S,3R,11R)-11-phenyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0619	Sachiko Yamada	11b-phenyl-1a,25-(OH)₂D₃	C₃₃H₄₈O₃	492.732		Biological activity of C-ring analogs of 1a,25-(OH)₂D₃ : Table (Ref. 0224)														Convergent synthesis by Horner coupling of 25-hydroxylated CD-ring ketone, which was constructed from Inhoffen-Lythgoe diol (vitamin D₂ ozonolysis product), with A-ring phosphine oxide. The substituent at C(11) was introduced by conjugate addition of organocopper reagent to 9(11)-en-8-one of the CD-ring fragment and inversion of the configuration at C(11) by introducing 9(11)-double bond followed by catalytic hydrogenation. (Ref. 0224)				[0224]
617				VVD0620	Sachiko Yamada	3-(2',2',2'-trichloroethyl)-glutarate (OCT	C₃₃H₄₉O₇Cl₃	664.096		Intermediate for OCT-3-hemiglutarate. (Ref. 0204)							(EtOH) lmax (nm) 260, lmin (nm) 228 (Ref. 0204)		¹H-NMR (d, CDCl₃, 200MHz) 0.53 (3H, s, 18-H), 1.19 (3H, d, J = 6.1 Hz, 21-H), 1.23 (6H, s, 26 and 27-H), 2.35-2.43, 2.48-2.56 (each 2H, m, CH₂CO), 3.18-3.32, 3.42-3.53 (each 1H, m, 23-H), 4.75 (2H, s CH₂CCl₃), 5.00 (1H, br s, 19-H), 5.20 (1H, m, 3-H), 5.36 (1H, br s, 19-H), 6.02 (1H, d, J = 12.0 Hz, 7-H), 6.30 (1H, d, J = 12.0 Hz, 6-H) (Ref. 0204)		Yellow oily substance. (Ref. 0204)	Flash column chromatography with n-hexane/AcOEt (11 : 9). (Ref. 0204)		Synthesis from dehydroepiandrostertone via 1,25-dihydroxy-22-oxacholesta-5,7-dien-3b-yl (2,2'2'-trichloroethylglutarate) by photochemical method. (Ref. 0204)				[0204]
618		(23S)-23,25-dihydroxy-24-oxovitamin D₃ 23-(b-glucuronide) / (23S)-23,25-dihydroxy-24-oxocholecalciferol 23-(b-glucuronide)	(5Z,7E)-(3S,23S)-9,10-seco-5,7,10(19)-cholestatriene-3,23,25-triol 23-(b-glucuronide)	VVD0621	Sachiko Yamada	23S,25-(OH)₂-24-oxo-D₃ 23-(b-glucuronide)	C₃₃H₅₀O₁₀	606.744									lmax (nm) 265 (Ref. 0106)			Me-ester : m/z 621 (M⁺), 431, 413, 253, 191, 173, 136; spectrum (Ref. 0106) Me-ester pentakis(trimethylsilyl) ether : m/z 980 (M⁺), 573, 407, 317, 131 (Ref. 0106)			Isolation and identification from bile of dogs given 24R,25-(OH)₂D₃. (Ref. 0106)					[0106]
619		1a,25-dihydroxy-26,27-dipropylvitamin D₃ / 1a,25-dihydroxy-26,27-dipropylcholecalciferol	(5Z,7E)-(1S,3R)-26,27-dipropyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0622	Sachiko Yamada	26,27-dipropyl-1a,25-(OH)₂D₃	C₃₃H₅₆O₃	500.796		Binding affinity of the title compound for serum vitamin D binding protein (DBP) and for the receptor of HL-60 cells was < 1% and 3.4%, respectively, of those of 1,25-(OH)₂D₃. The title compound did not induce HL-60 cell differentiation under either serum-supplemented or serum-free conditions at a concentration of 48 nM. (Ref. 0275)																		[0275]
620		1a,25-dihydroxy-26,26, 26,27,27,27-hexamethylvitamin D₃ / 1a,25-dihydroxy-26,26,26,27,27,27-hexamethylcholecalciferol	(5Z,7E)-(1S,3R)-26,26, 26,27,27,27-hexamethyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0623	Sachiko Yamada	26,27-hexamethyl-1a,25-(OH)₂D₃	C₃₃H₅₆O₃	500.796											¹H-NMR (d, CD₂Cl₂) 6.38 and 6.01 (2H, AB pattern, d, J = 11 Hz, 6- and 7-H), 5.33 (1H, m, 19E-H), 5.00 (1H, m, 19Z-H), 4.43 (1H, m, 1-H), 4.23 (1H, m, 3-H), 1.00 (18H, s, two t-Bu), 0.93 (3H, d, J = 6.2 Hz, 21C-CH₃), 0.54 (3H, s, 18C-CH₃) (Ref. 0195) ¹³C-NMR (d, CD₂Cl₂) 148.7 (C), 143.4 (C), 134.0 (C), 125.0 (CH), 117.6 (CH), 111.8 (C-19), 80.0 (C-25), 71.1 (CH), 67.1(CH), 60.6, 56.9, 56.8, 46.3 (CH₂),45.8, 43.4 (CH₂), 42.8, 40.9 (CH₂), 37.0 (CH₂), 36.5, 34.2 (CH₂), 29.4 (CH₂), 28.8, 28.0 (CH₂), 24.0 (CH₂), 23.3 (CH₂), 22.7 (CH₂), 19.2, 12.1 (Ref. 0195)									[0195]
621		26,27-diethyl-1a,25-dihydroxy-24a,24b-dihomovitamin D₃ / 26,27-diethyl-1a,25-dihydroxy-24a,24b-dihomocholecalciferol	(5Z,7E)-(1S,3R)-26,27-diethyl-24a,24b-dihomo-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0624	Sachiko Yamada	24-dihomo-26,27-diethyl-1a,25-(OH)₂D₃	C₃₃H₅₆O₃	500.796		Biological activity (% of 1,25-(OH)₂D₃ effect) : Inhibition of proliferation of U937 cells, < 10% ; Induction of differentiation of U 937 cells, 1%. (Ref. 0285)														From hydroxy protected (5E)-23,24,25,26,27-pentanorvitamin D₃ 22-bis(methylseleno)acetal via displacement of one methylseleno group by side chain fragment, reduction of the other methylseleno group via 6,19-SO₂ adduct, desulfonylation, dye-sensitized photoisomerization and deprotection. (Ref. 0285)				[0285]
622		1a,25-dihydroxy-2b-(6-hydroxyhexyl)vitamin D₃ / 1a,25-dihydroxy-2b-(6-hydroxyhexyl)cholecalciferol	(5Z,7E)-(1S,2R,3R)-2-(6-hydroxyhexyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0625	Sachiko Yamada	2b-(6-hydroxyhexyl)-1a,25-(OH)₂D₃	C₃₃H₅₆O₄	516.795		Spinal bone mineral density in pre-osteoporosis model rats and binding affinity to calf thymus vitamin D receptor. (Ref. 0217)							(EtOH) lmax (nm) 262, lmin (nm) 228 (Ref. 0217)	(neat) 3410 (br), 2970, 2865 cm^-¹ (Ref. 0217)	¹H-NMR (d, CDCl₃) 0.55 (3H, s), 0.94 (3H, d, J = 6.1 Hz), 1.22 (6H, s), 3.64 (2H, t, J = 6.6 Hz), 3.99-4.09 (1H, m), 4.15 (1H, br s), 5.02 (1H, s), 5.37 (1H, s), 6.03 (1H, d, J = 10.7 Hz), 6.34 (1H, d, J = 10.7 Hz) (Ref. 0217)	m/z 516 (M⁺), 59 (100%) (Ref. 0217)	HRMS Calcd 516.4178, Found 516.4152 (Ref. 0217)			Synthesis by photochemical method of the 5,7-diene. (Ref. 0217)				[0217]
623		1a,25-dihydroxy-11-(4-hydroxymethylphenyl)-9,11-didehydrovitamin D₃ / 1a,25-dihydroxy-11-(4-hydroxymethylphenyl)-9,11-didehydrocholecalciferol	(5Z,7E)-(1S,3R)-11-(4-hydroxymethylphenyl)-9,10-seco-5,7,9(11),10(19)-cholestatetraene-1,3,25-triol	VVD0626	Sachiko Yamada		C₃₄H₄₈O₄	520.743
624		25-hydroxyvitamin D₂ 25-(b-glucuronide) / 25 hydroxyergocalciferol 25-(b-glucuronide)	(5Z,7E,22E)-(3S)-9,10-seco-5,7,10(19),22-ergostatetraene-3,25-diol 25-(b-glucuronide)	VVD0627	Sachiko Yamada	25-OHD₂ 25-(b-glucuronide)	C₃₄H₅₂O₈	588.772												TMS-Me-ester : m/z 890 (M⁺), 466, 407, 317, 275, 217, 204; spectrum (Ref. 0154) Acetyl-Me-ester : m/z 770 (M⁺), 710, 650; spectrum (Ref. 0154)								[0154]
625		(6R)-vitamin D₃ 6,19-(4-phenyl-1,2,4-triazoline-3,5-dione) adduct / (6R)-cholecalciferol 6,19-(4-phenyl-1,2,4-triazoline-3,5-dione) adduct	(7E)-(3S,6R)-9,10-seco-5,7,10(19)-cholestatrien-3-ol 6,19-(4-phenyl-1,2,4-triazoline-3,5-dione) adduct	VVD0628	Sachiko Yamada		C₃₅H₄₉N₃O₃	559.782							[a] -173 (c = 0.81 in CHCl₃) (Ref. 0341) [a] -187 (c = 1.0 in CHCl₃) (Ref. 0340/0342)			(CHCl₃) 3620, 3480 (br), 1760, 1705, 1420, 1134, 1040 cm^-¹ (Ref. 0340/0342)	¹H-NMR (d, CDCl₃, 100MHz) 0.54 (3H, s, C-18), 0.87 (6H, d, J = 6.4 Hz, C-26, -27), 0.90 (3H, d, C-21), 2.82 (1H, d, J = 14 Hz, C-14), 3.82 und 4.16 (2H, AB-System, J = 16 Hz, C-19), 3.94 (1H, breites m, C-3), 4.76 (1H, C-6) und 5.01 (1H, C-7) zusammen AB-System (J = 10 Hz), 7.48 (5H, s, Aromat) (Ref. 0341) ¹³C-NMR (d, CDCl₃) 152.92, 151.58, 146.91, 131.41, 128.98, 127.85, 125.44, 125.30, 122.32, 114.57, 66.07, 56.56, 55.64, 54.09, 53.96, 46.45, 45.51, 40.17, 39.49, 36.11, 35.18, 31.69, 30.49, 29.55, 29.26, 27.97, 27.52, 25.35, 23.90, 23.86, 22.80, 22.55, 22.15, 18.85, 12.08 (Ref. 0341)	m/z (70eV, 100C) 559 (M⁺, 18), 298 (100) (Ref. 0341)				From vitamin D₃, as a minor product, by reaction with 4-phenyl-1,2,4-triazoline-3,5-dione. (Ref. 0340/0341/0342)				[0340] / [0341] / [0342]
626		(6S)-vitamin D₃ 6,19-(4-phenyl-1,2,4-triazoline-3,5-dione) adduct / (6S)-cholecalciferol 6,19-(4-phenyl-1,2,4-triazoline-3,5-dione) adduct	(7E)-(3S,6S)-9,10-seco-5,7,10(19)-cholestatrien-3-ol 6,19-(4-phenyl-1,2,4-triazoline-3,5-dionne) adduct	VVD0629	Sachiko Yamada		C₃₅H₄₉N₃O₃	559.782							[a] +191 (c = 1.105 in CHCl₃) (Ref. 0341) [a] +196 (c = 1.4 in CHCl₃) (Ref. 0340/0342)			(CHCl₃) 3600, 3450 (br), 1760, 1705, 1420, 853, 690, 649 cm^-¹ (Ref. 0340/0342)	¹H-NMR (d, CDCl₃, 100MHz) 0.52 (3H, s, C-18), 0.88 (6H, d, J = 6.5 Hz, C-26, -27), 0.92 (3H, d, J = 5.2 Hz, C-21), 2.85 (1H, d, J = 6.5 Hz, C-14), 3.86 und 4.18 (2H, AB-System, J = 16 Hz, C-14), 4.04 (1H, breites m, C-3), 4.77 (1H, C-6) und 4.98 (1H, C-7) zusammen AB-System (J = 10 Hz), 7.46 (5H, s, Aromat) (Ref. 0341) ¹³C-NMR (d, CDCl₃) 152.58, 151.69, 146.84, 131.30, 128.91, 127.831, 125.40, 125.32, 122.02, 114.37, 65.72, 55.82, 54.61, 46.32, 45.49, 40.32, 39.47, 36.07, 35.32, 29.91, 29.81, 27.97, 27.50, 24.25, 23.85, 23.76, 22.76, 22.52, 22.22, 18.80, 11.55 (Ref. 0341)	m/z (70eV, 100C) 559 (M⁺, 20), 298 (100) (Ref. 0341)				From vitamin D₃, as a major product, by reaction with 4-phenyl-1,2,4-triazoline-3,5-dione. (Ref. 0340/0341/0342)				[0340] / [0341] / [0342]
627		11a-(4-dimethylaminophenyl)-1a,25-dihydroxyvitamin D₃ / 11a-(4-dimethylaminophenyl)-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,3R,11S)-11-(4-dimethylaminophenyl)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0630	Sachiko Yamada		C₃₅H₅₃NO₃	535.800
628		11-(4-acetoxymethylphenyl)-1a,25-dihydroxy-9,11-didehydrovitamin D₃ / 11-(4-acetoxymethylphenyl)-1a,25-dihydroxy-9,11-didehydrocholecalciferol	(5Z,7E)-(1S,3R)-11-(4-acetoxymethylphenyl)-9,10-seco-5,7,9(11),10(19)-cholestatetraene-1,3,25-triol	VVD0631	Sachiko Yamada		C₃₆H₅₀O₅	562.779
629		2a-methyl-1a,25-dihydroxyvitamin D₃ / 2a-methyl-1a,25-dihydroxycholecalciferol	(5Z,7E)-(1S,2S,3R)-2-methyl-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0632	Sachiko Yamada	2a-methyl-1a,25-(OH)₂D₃	C₂₈H₄₆O₃	430.663		Bovine thymus VDR binding : 400. Bone calcium mobilization : 400. HL-60 cell differentiation : 200. DBP binding : 68. (The results for 1a,25-dihydroxyvitamin D₃ are normalized to 100.) (Ref. 0260)							(EtOH) lmax (nm) 265 (Ref. 0260)		¹H-NMR (d, CDCl₃/TMS, 400MHz) 0.54 (3H, s), 0.94 (3 H, d, J = 6.4 Hz), 1.08 (3H, d, J = 7.2 Hz), 1.21 (6H, s), 1.92 (1H, dd q, J = 3.3, 7.7, 7.2 Hz), 2.23 (1H, dd, J = 7.7, 13.4 Hz), 2.67 (1H, dd, J = 4.0, 13.2 Hz), 2.82 (1H, dd, J = 4,0, 12.5 Hz), 3.80-3.88 (1H, m), 4.28-4.32 (1H, m), 5.01 (1H, d, J = 1.8 Hz), 5.28 (1H, dd, J = 1.1, 1.8 Hz), 6.01 (1H, d, J = 11.4 Hz), 6.39 (1H, d, J = 11.4 Hz) (Ref. 0260)	m/z 430 (M⁺), 412 (M⁺-H₂O), 394 (M⁺-2H₂O), 376 (M⁺-3H₂O), 361 (M⁺-3H₂O-Me) (Ref. 0260)				The analogue was synthesized by employing the convergent method of Trost et al. using Pd catalyst. (Ref. 0260)				[0260]
630		(6R)-vitamin D₃ 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct / (6R)-cholecalciferol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	(7E)-(3S,6R)-9,10-seco-5,7,10(19)-cholestatrien-3-ol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	VVD0633	Sachiko Yamada		C₄₀H₅₃N₅O₄	667.880											¹H-NMR (d, CDCl₃) 0.51 (18-Me), 2.37 (d, J = 16.1 Hz, 4a-H), 4.67 (d, J = 9.9 Hz, 6-H), 3.22 (t, J = 6.8 Hz, -CH₂-C=N) (Ref. 0343)		CD : 207 nm (e -140), 247 nm (e +10) (in MeOH) (Ref. 0343)			From vitamin D₃ by reaction with 4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione (DMEQ-TAD) in CH₂Cl₂ at room temperature to yield the DMEQ-TAD adduct as a 2:1 mixture of 6S- and 6R-epimers. (Ref. 0343)				[0343]
631		(6S)-vitamin D₃ 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct / (6S)-cholecalciferol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	(7E)-(3S,6S)-9,10-seco-5,7,10(19)-cholestatrien-3-ol	VVD0634	Sachiko Yamada		C₄₀H₅₃N₅O₄	667.880											¹H-NMR (d, CDCl₃) 0.52 (18-Me), 4.69 (d, J = 9.2 Hz, 6-H), 3.20 (m, -CH₂-C=N) (Ref. 0343)		CD : 206 nm (e +46), 223 nm (e -11) (in MeOH) (Ref. 0343)			From vitamin D₃ by reaction with 4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione (DMEQ-TAD) in CH₂Cl₂ at room temperature to yield the DMEQ-TAD adduct as a 2:1 mixture of 6S- and 6R-epimers. (Ref. 0343)				[0343]
632		(6RS)-1a-hydroxyvitamin D₃ 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct / (6RS)-1a-hydroxycholecalciferol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	(7E)-(1S,3R,6RS)-9,10-seco-5,7,10(19)-cholestatriene-1,3-diol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	VVD0635	Sachiko Yamada		C₄₀H₅₃N₅O₅	683.880											6S-epimer : ¹H-NMR (d, CDCl₃) 0.50 (18-Me), 2.22 (d, J = 14.5 Hz, 4a-H), 4.66 (d, J = 9.6 Hz, 6-H), 3.20 (m, -CH₂-C=N). 6R-epimer : ¹H-NMR (d, CDCl₃) 0.49 (18-Me), 2.46 (d, J = 12.9 Hz, 4a-H), 4.70 (d, J = 9.6 Hz, 6-H), 3.25 (t, J = 6.6 Hz, -CH₂-C=N) (Ref. 0343)		CD : 6S-epimer : 206 nm (e +38), 227 nm (e -9) (in MeOH). 6R-epimer : 207 nm (e -74), 243 nm (e +4) (in MeOH) (Ref. 0343)			From 1a-hydroxyvitamin D₃ by reaction with 4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione (DMEQ-TAD) in CH₂Cl₂ at room temperature to yield the DMEQ-TAD adduct as a 1:1 mixture of 6S- and 6R-epimers. (Ref. 0343)				[0343]
633		(6RS)-25-hydroxyvitamin D₃ 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct / (6RS)-25-hydroxycholecalciferol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	(7E)-(3S,6RS)-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	VVD0636	Sachiko Yamada		C₄₀H₅₃N₅O₅	683.880											6S-epimer : ¹H-NMR (d, CDCl₃) 0.53 (18-Me), 4.70 (d, J = 9.9 Hz, 6-H), 3.20 (m, -CH₂-C=N). 6R-epimer : ¹H-NMR (d, CDCl₃) 0.51 (18-Me), 2.37 (d, J = 16.5 Hz, 4a-H), 4.67 (d, J = 10.2 Hz, 6-H), 3.22 (t, J = 6.68 Hz, -CH₂-C=N) (Ref. 0343) a mixture of C(6)-epimers : ¹H-NMR (d, CDCl₃) 0.52 and 0.51 [3H (2:1), s], 1.20 and 1.21 [6H (2:1), s], 3.69 (3H, s), 3.94 (3H, s), 4.01 (3H, s), 4.69 (1H, d, J = 9.6 Hz), 6.68 (1H, s), 7.23 (1H, s) (Ref. 0344) Fluorescence spectrum: a mixture of C(6)-epimers : (EtOH) l_e_x 370 nm, l_e_m 440 nm (Ref. 0344)		CD : 6S-epimer : 206 nm (e +46), 224 nm (e -10) (in MeOH). 6R-epimer : 206 nm (e -82), 245 nm (e +6) (in MeOH) (Ref. 0343)			From 25-hydroxyvitamin D₃ by reaction with 4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione (DMEQ-TAD) in CH₂Cl₂ at room temperature to yield the DMEQ-TAD adduct as a 2:1 mixture of 6S- and 6R-epimers. (Ref. 0343/0344)				[0343] / [0344]
634		(6RS)-1a,25-dihydroxyvitamin D₃ 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct / (6RS)-1a,25-dihydroxycholecalciferol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	(7E)-(1S,3R,6RS)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	VVD0637	Sachiko Yamada		C₄₀H₅₃N₅O₆	699.879											6S-epimer : ¹H-NMR (d, CDCl₃) 0.52 (18-Me), 2.25 (d, J = 16.4 Hz, 4a-H), 4.67 (d, J = 9.6 Hz, 6-H), 3.20 (m, -CH₂-C=N). 6R-epimer : ¹H-NMR (d, CDCl₃) 0.51 (18-Me), 2.47 (d, J = 14.5 Hz, 4a-H), 4.71 (d, J = 9.6 Hz, 6-H), 3.22 (t, J = 6.6 Hz, -CH₂-C=N) (Ref. 0343) a mixture of C(6)-epimers : ¹H-NMR (d, CDCl₃) 0.50 and 0.51 [3H (5:4), s], 1.21 and 1.20 [6H (5:4), s], 3.69 (3H, s), 3.94 (3H, s), 4.01 (3H, s), 4.30 (1H, m), 4.70 (1H, d, J = 9.9 Hz), 4.93 (1H, d, J = 9.9 Hz), 6.68 (1H, s), 7.23 (1H, s) (Ref. 0344)		CD : 6S-epimer : 206 nm (e +44), 225 nm (e -10) (in MeOH). 6R-epimer : 205 nm (e -80), 243 nm (e +4) (in MeOH) (Ref. 0343)			From 1a,25-dihydroxyvitamin D₃ by reaction with 4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione (DMEQ-TAD) in CH₂Cl₂ at room temperature to yield the DMEQ-TAD adduct as a 1:1 mixture of 6S- and 6R-epimers. (Ref. 0343/0344)				[0343] / [0344]
635		(6RS,24R)-24,25-dihydroxyvitamin D₃ 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct / (6RS,24R)-24,25-dihydroxycholecalciferol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	(7E)-(3S,6RS,24R)-9,10-seco-5,7,10(19)-cholestatriene-3,24,25-triol 6,19-[4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione] adduct	VVD0638	Sachiko Yamada		C₄₀H₅₃N₅O₆	699.879											6S-epimer : ¹H-NMR (d, CDCl₃) 0.54 (18-Me), 4.70 (d, J = 9.9 Hz, 6-H), 3.20 (m, -CH₂-C=N). 6R-epimer : ¹H-NMR (d, CDCl₃) 0.52 (18-Me), 2.38 (d, J = 16.5 Hz, 4a-H), 4.67 (d, J = 9.9 Hz, 6-H), 3.22 (t, J = 6.3 Hz, -CH₂-C=N) (Ref. 0343) a mixture of C(6)-epimers : ¹H-NMR (d, CDCl₃) 0.540 and 0.52 [3H (2:1), s], 1.16 (3H, s), 1.21 (3H, s), 3.70 (3H, s), 3.94 (3H, s), 4.01 (3H, s), 4.69 (1H, d, J = 9.6 Hz), 4.88 (1H, d, J = 9.6 Hz), 6.68 (1H, s), 7.23 (1H, s) (Ref. 0344)		CD : 6S-epimer : 206 nm (e +48), 223 nm (e -12) (in MeOH). 6R-epimer : 205 nm (e -58), 245 nm (e +4) (in MeOH) (Ref. 0343)			From 24R,25-dihydroxyvitamin D₃ by reaction with 4-{2-(6,7-dimethoxy-4-methyl-3-oxo-3,4-dihydroquinoxalinyl)ethyl}-1,2,4-triazoline-3,5-dione (DMEQ-TAD) in CH₂Cl₂ at room temperature to yield the DMEQ-TAD adduct as a 2:1 mixture of 6S- and 6R-epimers. (Ref. 0343/0344)				[0343] / [0344]
636		1a,25-dihydroxy-25,25-diphenyl-26,27-dinorvitamin D₃ / 1a,25-dihydroxy-25,25-diphenyl-26,27-dinorcholecalciferol	(5Z,7E)-(1S,3R)-25,25-diphenyl-26,27-dinor-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0639	Sachiko Yamada	25-Ph₂-26,27-dinor-1a,25-(OH)₂D₃	C₄₇H₄₈O₃	660.882											¹H-NMR (d, CD₂Cl₂) 7.40 (4H, d, J = 8 Hz, o-4H-Ph), 7.31 (4H, t, J = 7 Hz, m-4H-Ph), 7.18 (2H, t, J = 7 Hz, p-H-Ph), 6.34 and 5.99 (2H, AB pattern, J = 11.5 Hz, 6- and 7-H), 5.28 (1H, br s, 19E-H), 4.94 (1H, br s, 19Z-H), 4.35 (1H, m, 1-H), 4.15 (1H, m, 3-H), 0.83 (3H, d, J = 6.5 Hz, 21C-CH₃), 0.50 (3H, s, 18C-CH₃) (Ref. 0195) ¹³C-NMR (d, CD₂Cl₂) 148.6 (C), 148.0 (C), 143.4 (C), 133.9 (C), 128.5 (CH), 127.1 (CH),126.4 (CH), 125.0 (CH),117.6 (CH), 111.8 (C-19), 78.5 (C), 71.2 (CH), 67.2(CH), 57.1, 56.7, 46.2, 45.7 (CH₂), 43.4 (CH₂), 42.7 (CH₂), 40.9 (CH₂), 36.6 (CH₂), 36.4, 29.4 (CH₂), 28.0 (CH₂), 24.0 (CH₂), 22.6 (CH₂), 20.7 (CH₂), 18.9, 12.1 (Ref. 0195)									[0195]
637		1a,25-dihydroxy-26,27-dimethyl-22,23-didehydro-24a,24b-dihomo-19-norvitamin D₃ / 1a,25-dihydroxy-26,27-dimethyl-22,23-didehydro-24a,24b-dihomo-19-norcholecalciferol	(7E,22E)-(1R,3R)-26,27-dimethyl-24a,24b-dihomo-19-nor-9,10-seco-5,7,22-cholestatriene-1,3,25-triol	VVD0644	Sachiko Yamada		C₃₁H₅₄O₃	474.759									(EtOH)lmax (nm) 243, 251.5, 261 (Ref. 0348)		¹H-NMR(d,CDCl3,400 or 600MHz) 0.56(3H, s, 18-CH₃), 0.98(3H, d, J = 6.6 Hz, 21-CH₃), 4.03(1H, m, 3a-H), 4.09(1H, m, 1b-H), 5.29(2H, m, 22- and 23-H), 5.83(1H, d, J = 11.3 Hz, 7-H), 6.29(1H, d, J = 11.3 Hz, 6-H) (Ref. 0348)	m/z 458(M⁺,25), 440(16), 422(3), 275(44), 257(23), 239(33), 211(20), 147(35), 135(65), 133(78), 95(70), 81(100) (Ref. 0348)				CD-ring plus C(20)-C(22) part was combined with A-ring phosphine oxide by Wittig type reaction, and then the side chain synthon was attached to it. (Ref. 0348)				[0348]
638		1a,25-dihydroxy-26,26,26,27,27,27-hexafluoro-16,17,23,23,24,24-hexadehydro-19-norvitamin D₃ / 1a,25-dihydroxy-26,26,26,27,27,27-hexafluoro-16,17,23,23,24,24-hexadehydro-19-norcholecalciferol	(7E)-(1R,3R)-26,26,26,27,27,27-hexafluoro-19-nor-9,10-seco-5,7,16-cholestatrien-23-yne-1,3,25-triol	VVD0645	Sachiko Yamada		C₂₆H₃₂F₆O₃	506.521		The title compound caused a dose dependent growth inhibition of MCF-7 and MDAMB-468 human breast cancer cells at concentrations ranging between 1-100 nM. (Ref. 0352)																		[0352]
639		1a,25-dihydroxy-19-norvitamin D₂ / 1a,25-dihydroxy-19-norergocalciferol	(7E,22E)-(1R,3R)-19-nor-9,10-seco-5,7,22-ergostatriene-1,3,25-triol	VVD0646	Sachiko Yamada		C₂₇H₄₄O₃	416.636		Binding to porcine intestinal vitamin D receptor: 3.5-fold less potent than 1,25-(OH)₂D₃ (IC50, 4.8 nM); Intestinal calcium transport and mobilization of calcium from bone in vitamin D-deficient rats: less than 1/10 as potent as 1,25-(OH)₂D₃; Effect on rat model of renal osteodystrophy: significantly reduced PTH at doses of 8 to 25 ng without affecting serum ionized Ca. (Ref. 0349)																		[0349]
640		1a,25-dihydroxy-19-nor-22-oxavitamin D₃ / 1a,25-dihydroxy-19-nor-22-oxacholecalciferol	(7E)-(1R,3R)-19-nor-22-oxa-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0647	Sachiko Yamada		C₂₅H₄₂O₄	406.599		Affinity for VDR: 1/33 less potent than 1,25-(OH)₂D₃; Transactivation of a rat 25-hydroxyvitamin D₃ 24-hydroxylase (CYP24) gene: twice as active as 1,25-(OH)₂D₃. (Ref. 0350)														22-Oxa homologue of Grundmann ketone was combined with A-ring phosphine oxide, which was synthesized by a combination of regioselective propiolate-ene reaction, catalytic epoxidation and catalytic enantioselective carbonyl-ene cyclization. (Ref. 0350)				[0350]
641		1a,2a,25-trihydroxy-19-norvitamin D₃ / 1a,2a,25-trihydroxy-19-norcholecalciferolcholecalciferol	(7E)-(1R,2S,3R)-19-nor-9,10-seco-5,7-cholestadiene-1,2,3,25-tetrol	VVD0648	Sachiko Yamada		C₂₆H₄₄O₄	420.625		Had weak calcemic (intestinal calcium transport and bone calcium-mobilization) actvity but potent cell differentiating activities (HL-60 cell) similar to that of 1,25-(OH)₂D₃. (Ref. 0353)							(EtOH)lmax (nm) 243, 251.5, 261 (Ref. 0353)		¹H-NMR(d,CDCl3) 0.55(3H, s, 18-H₃), 0.94(3H, d, J = 6.5 Hz, 21-H₃), 1.22(6H, s, 26- and 27-H₃), 2.62(1H, dd, J = 13.0, 4.2 Hz), 2.79(1H, br d, J = 12.9 Hz), 2.90(1H, dd, J = 14.3, 4.2 Hz), 3.25(1H, br m), 3.53(1H, dd, J = 8.4, 2.6 Hz), 3.79(1H, br m), 4.10 (1H, m), 5.81 and 6.38(1H and 1H, each d, J = 11.0 Hz, 6- and 7-H) (Ref. 0353)	m/z 420 (M⁺,100), 402(56), 387(18), 291(58), 245(53), 95(78), 59(90) (Ref. 0353)				By combining A-ring synthon obtained from (-)-quinic acid with 25-hydroxylated Grundmann type ketone. (Ref. 0353)				[0353]
642		1a,2b,25-trihydroxy-19-norvitamin D₃ / 1a,2b,25-trihydroxy-19-norcholecalciferol	(7E)-(1R,2R,3R)-19-nor-9,10-seco-5,7-cholestadiene-1,2,3,25-tetrol	VVD0649	Sachiko Yamada		C₂₆H₄₄O₄	420.625		Has potent intestinal calcium transport activity equal to that of 1,25-(OH)₂D₃ but no ability to mobilize calcium from bone. Cell (HL-60) differentiating activity is about 1/10 of that of 1,25-(OH)₂D₃ (Ref. 0353)							(EtOH)lmax (nm) 243, 251.5, 261 (Ref. 0353)		¹H-NMR(d,CDCl3) 0.55(3H, s, 18-H₃), 0.94(3H, d, J = 6.8 Hz, 21-H₃), 1.22(6H, s, 26- and 27-H₃), 2.79(1H, br d, J = 13.0 Hz), 3.08(1H,dd, J = 13.2, 4.6 Hz), 3.36(2H, br m), 3.49(1H, m), 3.68(1H, br m), 4.08(1H, m), 5.84 and 6.29(1H and 1H, each d, J = 11.3 Hz, 6- and 7-H) (Ref. 0353)	m/z 420 (M⁺,99), 402(59), 387(50), 291(44), 245(49), 95(94), 59(100) (Ref. 0353)				By combining A-ring synthon obtained from (-)-quinic acid with 25-hydroxylated Grundmann type ketone. (Ref. 0353)				[0353]
643		1a,25-dihydroxy-2a-(3-hydroxypropoxy)-19-norvitamin D₃ / 1a,25-dihydroxy-2a-(3-hydroxypropoxy)-19-norcholecalciferol	(7E)-(1R,2S,3R)-2-(3-hydroxypropoxy)-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0650	Sachiko Yamada		C₂₉H₅₀O₅	478.704		Has low calcemic activity but high cell differentiating activity nearly as potent as 1,25-(OH)₂D₃. (Ref. 0353>							(EtOH)lmax (nm) 243, 251.5, 261 (Ref. 0353)		¹H-NMR(d,CDCl3) 0.55(3H, s, 18-H₃), 0.93(3H, d, J = 6.8 Hz, 21-H₃), 1.22(6H, s, 26- and 27-H₃), 3.3-4.2(at least 7H, complex m), 5.83 and 6.34(1H and 1H, each d, J = 11.2 Hz, 6- and 7-H) (Ref. 0353)	m/z 478 (M⁺,5), 460(6), 442(2), 402(4), 384(3), 245(15), 184(20), 142(100), 95(50), 59(38) (Ref. 0353)				By combining A-ring synthon obtained from (-)-quinic acid with 25-hydroxylated Grundmann type ketone. (Ref. 0353)				[0353]
644		1a,25-dihydroxy-2b-(3-hydroxypropoxy)-19-norvitamin D₃ / 1a,25-dihydroxy-2b-(3-hydroxypropoxy)-19-norcholecalciferol	(7E)-(1R,2R,3R)-2-(3-hydroxypropoxy)-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0651	Sachiko Yamada		C₂₉H₅₀O₅	478.704		Has low in vivo calcemic activity. (Ref. 0353)							(EtOH)lmax (nm) 243, 251.5, 261 (Ref. 0353)		¹H-NMR(d,CDCl3) 0.54(3H, s, 18-H₃), 0.94(3H, d, J = 6.5 Hz, 21-H₃), 1.22(6H, s, 26- and 27-H₃), 2.79(1H, br d, J = 12 Hz, 9b-H), 3.0-4.3(at least 7H, complex m), 5.84 and 6.29(1H and 1H, each d, J = 11.2 Hz, 6- and 7-H) (Ref. 0353)	m/z 478 (M⁺,6), 460(12), 442(7), 420(15), 402(11), 366(9), 348(8), 245(34), 181(9), 95(80), 69(100), 59(68) (Ref. 0353)				By combining A-ring synthon obtained from (-)-quinic acid with 25-hydroxylated Grundmann type ketone. (Ref. 0353)				[0353]
645		2a-(benzyloxy)-1a,25-dihydroxy-19-norvitamin D₃ / 2a-(benzyloxy)-1a,25-dihydroxy-19-norcholecalciferol	(7E)-(1R,2S,3R)-2-(benzyloxy)-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0652	Sachiko Yamada		C₃₃H₅₀O₄	510.748		Has potent intestinal calcium transport activity nearly equal to that of 1,25-(OH)₂D₃ but poor ability to mobilize calcium from bone. Cell (HL-60) differentiating activity is about 1/10 of that of 1,25-(OH)₂D₃ (Ref. 0353)							(EtOH)lmax (nm) 243, 251.5, 261 (Ref. 0353)		¹H-NMR(d,CDCl3) 0.55(3H, s, 18-H₃), 0.93(3H, d, J = 6.7 Hz, 21-H₃), 1.22(6H, s, 26- and 27-H₃), 2.79(2H, m), 3.45(1H, dd, J = 7.3, 3.0 Hz, 2b-H), 3.97(1H, m, 3a-H), 4.11(1H, m, 1b-H) 4.65 and 4.72(1H and 1H, each d, J = 11.8 Hz, O-CH₂), 5.83 and 6.33(1H and 1H, each d, J = 11.2 Hz, 6- and 7-H), 7.2-7.4(5H, br m, Ar-H) (Ref. 0353)	m/z 510 (M⁺,11), 492(8), 474(2), 401(8), 91(100) (Ref. 0353)				By combining A-ring synthon obtained from (-)-quinic acid with 25-hydroxylated Grundmann type ketone. (Ref. 0353)				[0353]
646		1a,25-dihydroxy-2-methylene-19-norvitamin D₃ / 1a,25-dihydroxy-2-methylene-19-norcholecalciferol	(7E)-(1R,3R)-2-methylene-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0653	Sachiko Yamada		C₂₇H₄₄O₃	416.636		Affinity for the porcine intestinal vitamin D receptor: ED50 1.2 10^-¹⁰ M (1/1.5 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 4.2 10^-⁹ M (equally active as 1,25-(OH)₂D₃); Intestinal calcium transport: no activity; Bone calcium mobilization: more than twice as active as 1,25-(OH)₂D₃. (Ref. 0355)							(EtOH)lmax (nm) 243.5, 252, 262.5 (Ref. 0355)		¹H-NMR(d,CDCl3) 0.552(3H, s, 18-H₃), 0.941(3H, d, J = 6.4 Hz, 21-H₃), 1.222(6H, s, 26- and 27-H₃), 2.01(2H, m), 2.29(1H, dd, J = 13.3, 8.4 Hz, 10a-H), 2.33(1H, dd, J = 13.4, 6.0 Hz, 4b-H), 2.58(1H, dd, J = 13.4, 3.9 Hz, 4a-H), 2.82(1H, br d, J = 12 Hz, 9b), 2.86(1H, dd, J = 13.3, 4.6 Hz, 10bH), 4.49(2H, m, 1b- and 3a-H), 5.10 and 5.11(1H and 1H, each s, =CH₂), 5.89 and 6.37(1H and 1H, each d, J = 11.3 Hz, 7- and 6-H) (Ref. 0355)	m/z 416 (M⁺,83), 398(25), 384(31), 380(14), 351(20), 313(100) (Ref. 0355)				A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0355]
647		1a,25-dihydroxy-2a-methyl-19-norvitamin D₃ / 1a,25-dihydroxy-2a-methyl-19-norcholecalciferol	(7E)-(1R,2S,3R)-2-methyl-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0654	Sachiko Yamada		C₂₇H₄₆O₃	418.652		Affinity for the porcine intestinal vitamin D receptor: ED50 4.2 10^-¹⁰ M (1/4.6 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 8.0 10^-¹¹ M (50 times as active as 1,25-(OH)₂D₃); Intestinal calcium transport: slightly less active than 1,25-(OH)₂D₃; Bone calcium mobilization: slightly less active than 1,25-(OH)₂D₃. (Ref. 0355)														A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0355]
648		1a,25-dihydroxy-2b-methyl-19-norvitamin D₃ / 1a,25-dihydroxy-2b-methyl-19-norcholecalciferol	(7E)-(1R,2R,3R)-2-methyl-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0655	Sachiko Yamada		C₂₇H₄₆O₃	418.652		Affinity for the porcine intestinal vitamin D receptor: ED50 3.5 10^-⁹ M (1/39 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 8.0 10^-⁹ M (1/2 less active than 1,25-(OH)₂D₃); Intestinal calcium transport: no activity; Bone calcium mobilization: no activity. (Ref. 0355)														A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0355]
649		1a,25-dihydroxy-2a-hydroxymethyl-19-norvitamin D₃ / 1a,25-dihydroxy-2a-hydroxymethyl-19-norcholecalciferolcholecalciferol	(7E)-(1R,2S,3R)-2-hydroxymethyl-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0656	Sachiko Yamada		C₂₇H₄₆O₄	434.652		Affinity for the porcine intestinal vitamin D receptor: ED50 8.0 10^-¹⁰ M (1/13 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 2.0 10^-⁸ M (1/5 as active as 1,25-(OH)₂D₃). (Ref. 0355)														A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0355]
650		1a,25-dihydroxy-2b-hydroxymethyl-19-norvitamin D₃ / 1a,25-dihydroxy-2b-hydroxymethyl-19-norcholecalciferol	(7E)-(1R,2R,3R)-2-hydroxymethyl-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0657	Sachiko Yamada		C₂₇H₄₆O₄	434.652		Affinity for the porcine intestinal vitamin D receptor: ED50 7.0 10^-⁹ M (1/117 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 1.0 10^-⁷ M (1/25 less active than 1,25-(OH)₂D₃). (Ref. 0355)														A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0355]
651		1a,25-dihydroxy-2-methylene-19-nor-20-epivitamin D₃ / 1a,25-dihydroxy-2-methylene-19-nor-20-epicholecalciferol	(7E)-(1R,3R,20S)-2-methylene-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0658	Sachiko Yamada		C₂₇H₄₄O₃	416.636		Affinity for the porcine intestinal vitamin D receptor: ED50 1.0 10^-¹⁰ M (1/1.3 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 1.5 10^-¹⁰ M (25 times as active as 1,25-(OH)₂D₃); Intestinal calcium transport: no activity; Bone calcium mobilization: more than twice as active as 1,25-(OH)₂D₃. (Ref. 0355)							(EtOH)lmax (nm) 243.5, 252, 262.5 (Ref. 0355)		¹H-NMR(d,CDCl3) 0.551(3H, s, 18-H₃), 0.858(3H, d, J = 6.6 Hz, 21-H₃), 1.215(6H, s, 26- and 27-H₃), 1.95-2.04(2H, m), 2.30(1H, dd, J = 13.3, 8.4 Hz, 10a-H), 2.33(1H, dd, 13.4, 6.3 Hz, 4b-H), 2.58(1H, dd, J = 13.4, 3.7 Hz, 4a-H), 2.83(1H, br d, J = 13.7 Hz, 9b), 2.85(1H, dd, J = 13.3, 4.5 Hz, 10bH), 4.49(2H, m, 1b- and 3a-H), 5.09 and 5.11(1H and 1H, each s, =CH₂), 5.89 and 6.36(1H and 1H, each d, J = 11.3 Hz, 7- and 6-H) (Ref. 0355)	m/z 416 (M⁺,100), 398(26), 380(13), 366(21), 313(31) (Ref. 0355)				A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0355]
652		1a,25-dihydroxy-2a-methyl-19-nor-20-epivitamin D₃ / 1a,25-dihydroxy-2a-methyl-19-nor-20-epicholecalciferol	(7E)-(1R,2S,3R,20S)-2-methyl-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0659	Sachiko Yamada		C₂₇H₄₆O₃	418.652		Affinity for the porcine intestinal vitamin D receptor: ED50 4.0 10^-¹⁰ M (1/4.4 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 7.0 10^-¹¹ M (50 times as active as 1,25-(OH)₂D₃); Intestinal calcium transport: more than twice as active as 1,25-(OH)₂D₃; Bone calcium mobilization: more than twice as active as 1,25-(OH)₂D₃. (Ref. 0355)														A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0355]
653		1a,25-dihydroxy-2b-methyl-19-nor-20-epivitamin D₃ / 1a,25-dihydroxy-2b-methyl-19-nor-20-epicholecalciferol	(7E)-(1R,2R,3R,20S)-2-methyl-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0660	Sachiko Yamada		C₂₇H₄₆O₃	418.652		Affinity for the porcine intestinal vitamin D receptor: ED50 5.0 10^-¹⁰ M (1/5.5 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 7.0 10^-¹⁰ M (6 times as active as 1,25-(OH)₂D₃); Intestinal calcium transport: no activity; Bone calcium mobilization: no activity. (Ref. 0355)														A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0355]
654		1a,25-dihydroxy-2a-hydroxymethyl-19-nor-20-epivitamin D₃ / 1a,25-dihydroxy-2a-hydroxymethyl-19-nor-20-epicholecalciferol	(7E)-(1R,2S,3R,20S)-2-hydroxymethyl-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0661	Sachiko Yamada		C₂₇H₄₆O₄	434.652		Affinity for the porcine intestinal vitamin D receptor: ED50 8.0 10^-¹¹ M (1/1.3 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 2.0 10^-⁹ M (twice as active as 1,25-(OH)₂D₃); Intestinal calcium transport: some activity; Bone calcium mobilization: no activity. (Ref. 0355)														A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0355]
655		1a,25-dihydroxy-2b-hydroxymethyl-19-nor-20-epivitamin D₃ / 1a,25-dihydroxy-2b-hydroxymethyl-19-nor-20-epicholecalciferol	(7E)-(1R,2R,3R,20S)-2-hydroxymethyl-19-nor-9,10-seco-5,7-cholestadiene-1,3,25-triol	VVD0662	Sachiko Yamada		C₂₇H₄₆O₄	434.652
656		1a,25-dihydroxy-3-deoxy-19-norvitamin D₃ / 1a,25-dihydroxy-3-deoxy-19-norcholecalciferol	(7E)-(1S)-19-nor-9,10-seco-5,7-cholestadiene-1,25-diol	VVD0663	Sachiko Yamada		C₂₆H₄₄O₂	388.626		Affinity for the porcine intestinal vitamin D receptor: ED50 5.0 10^-¹⁰ M (1/8.3 less active than 1,25-(OH)₂D₃); HL-60 cell differentiation: ED50 4.5 10^-⁹ M (nearly as active as 1,25-(OH)₂D₃); Intestinal calcium transport: no activity; Bone calcium mobilization: no activity. (Ref. 0355) (Relative potency to 1,25-(OH)₂D₃ when its potency is defined 1) Affinity for calf thymus vitamin D receptor: 0.0007; Affinity for vitamin D binding protein: 3.2; HL-60 cell anfiproliferation: 0.3; HL-60 cell differentiation: 0.3; Transcriptional activity (rat 25-OHD₃ 24-hydroxylase promoter): 0.32. (Ref. 0354)														A-ring synthon obtained from (-)-quinic acid was combined with Grundmann type 8-ketone by Wittig type reaction. (Ref. 0355)				[0354] / [0355]
657		1b,25-dihydroxy-3-deoxy-19-norvitamin D₃ / 1b,25-dihydroxy-3-deoxy-19-norcholecalciferol	(7E)-(1R)-19-nor-9,10-seco-5,7-cholestadiene-1,25-diol	VVD0664	Sachiko Yamada		C₂₆H₄₄O₂	388.626		(Relative potency to 1,25-(OH)₂D₃ when its potency is defined 1) Affinity for calf thymus vitamin D receptor: <0.0006; Affinity for vitamin D binding protein: 23.5; HL-60 cell anfiproliferation: 0.5; HL-60 cell differentiation: 0.1; Transcriptional activity (rat 25-OHD₃ 24-hydroxylase promoter): 0.1. (Ref. 0354)																		[0354]
658		25-dihydroxy-19-nor-3-epivitamin D₃ / 25-dihydroxy-19-nor-3-epicholecalciferol	(7E)-(3R)-19-nor-9,10-seco-5,7-cholestadiene-3,25-diol	VVD0665	Sachiko Yamada		C₂₆H₄₄O₂	388.626		(Relative potency to 1,25-(OH)₂D₃ when its potency is defined 1) Affinity for calf thymus vitamin D receptor: 0.0006; Affinity for vitamin D binding protein: 5.7; HL-60 cell anfiproliferation: 0.4; HL-60 cell differentiation: 0.3; Transcriptional activity (rat 25-OHD₃ 24-hydroxylase promoter): 0.18. (Ref. 0354)																		[0354]
659		25-dihydroxy-19-norvitamin D₃ / 25-dihydroxy-19-norcholecalciferol	(7E)-(3S)-19-nor-9,10-seco-5,7-cholestadiene-3,25-diol	VVD0666	Sachiko Yamada		C₂₆H₄₄O₂	388.626		(Relative potency to 1,25-(OH)₂D₃ when its potency is defined 1) Affinity for calf thymus vitamin D receptor: 0.003; Affinity for vitamin D binding protein: 0.1; HL-60 cell anfiproliferation: 0.8; HL-60 cell differentiation: 0.6; Transcriptional activity (rat 25-OHD₃ 24-hydroxylase promoter): 0.78. (Ref. 0354)																		[0354]
660		1a,25-dihydroxy-3-deoxy-19-nor-22-oxavitamin D₃ / 1a,25-dihydroxy-3-deoxy-19-nor-22-oxacholecalciferol	(7E)-(1S)-19-nor-22-oxa-9,10-seco-5,7-cholestadiene-1,25-diol	VVD0667	Sachiko Yamada		C₂₅H₄₂O₃	390.599		(Relative potency to 1,25-(OH)₂D₃ when its potency is defined 1) Affinity for calf thymus vitamin D receptor: 0.004; Affinity for vitamin D binding protein: NR (no response); HL-60 cell anfiproliferation: 0.8; HL-60 cell differentiation: 0.5; Transcriptional activity (rat 25-OHD₃ 24-hydroxylase promoter): 1.32. (Ref. 0354)																		[0354]
661		1b,25-dihydroxy-3-deoxy-19-nor-22-oxavitamin D₃ / 1b,25-dihydroxy-3-deoxy-19-nor-22-oxacholecalciferol	(7E)-(1R)-19-nor-22-oxa-9,10-seco-5,7-cholestadiene-1,25-diol	VVD0668	Sachiko Yamada		C₂₅H₄₂O₃	390.599		(Relative potency to 1,25-(OH)₂D₃ when its potency is defined 1) Affinity for calf thymus vitamin D receptor: NR (no response); Affinity for vitamin D binding protein: 0.5; HL-60 cell anfiproliferation: 0.2; HL-60 cell differentiation: 0.2; Transcriptional activity (rat 25-OHD₃ 24-hydroxylase promoter): 0.12. (Ref. 0354)																		[0354]
662		25-dihydroxy-19-nor-22-oxa-3-epivitamin D₃ / 25-dihydroxy-19-nor-22-oxa-3-epicholecalciferol	(7E)-(3R)-19-nor-22-oxa-9,10-seco-5,7-cholestadiene-3,25-diol	VVD0669	Sachiko Yamada		C₂₅H₄₂O₃	390.599		(Relative potency to 1,25-(OH)₂D₃ when its potency is defined 1) Affinity for calf thymus vitamin D receptor: 0.001; Affinity for vitamin D binding protein: NR (no response); HL-60 cell anfiproliferation: 0.2; HL-60 cell differentiation: 0.2; Transcriptional activity (rat 25-OHD₃ 24-hydroxylase promoter): 0.74. (Ref. 0354)																		[0354]
663		25-dihydroxy-19-nor-22-oxavitamin D₃ / 25-dihydroxy-19-nor-22-oxacholecalciferol	(7E)-(3S)-19-nor-22-oxa-9,10-seco-5,7-cholestadiene-3,25-diol	VVD0670	Sachiko Yamada		C₂₅H₄₂O₃	390.599		(Relative potency to 1,25-(OH)₂D₃ when its potency is defined 1) Affinity for calf thymus vitamin D receptor: NR (no response); Affinity for vitamin D binding protein: NR; HL-60 cell anfiproliferation: 0.5; HL-60 cell differentiation: 0; Transcriptional activity (rat 25-OHD₃ 24-hydroxylase promoter): 0.12. (Ref. 0354)																		[0354]
664		24a,25-dihydroxy-1a-hydroxymethyl-26,27-dimethyl-24a-homo-22-oxavitamin D₃ / 24a,25-dihydroxy-1a-hydroxymethyl-26,27-dimethyl-24a-homo-22-oxacholecalciferol	(5Z,7E)-(1S,3S,24aS)-1-hydroxymethyl-26,27-dimethyl-24a-homo-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-3,24a,25-triol	VVD0671	Sachiko Yamada		C₃₀H₅₀O₅	490.715
665		24a,25-dihydroxy-1b-hydroxymethyl-26,27-dimethyl-24a-homo-22-oxa-3-epivitamin D₃ / 24a,25-dihydroxy-1b-hydroxymethyl-26,27-dimethyl-24a-homo-22-oxa-3-epicholecalciferol	(5Z,7E)-(1R,3R,24aS)-1-hydroxymethyl-26,27-dimethyl-24a-homo-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-3,24a,25-triol	VVD0672	Sachiko Yamada		C₃₀H₅₀O₅	490.715
666		1a-(2-fluoroethyl)-25-hydroxy-26,27-dimethyl-24a-homo-22-oxavitamin D₃ / 1a-(2-fluoroethyl)-25-hydroxy-26,27-dimethyl-24a-homo-22-oxacholecalciferol	(5Z,7E)-(1R,3S)-1-(2-fluoroethyl)-26,27-dimethyl-24a-homo-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0673	Sachiko Yamada		C₃₁H₅₁FO₃	490.733
667		1b-(2-fluoroethyl)-25-hydroxy-26,27-dimethyl-24a-homo-22-oxa-3-epivitamin D₃ / 1b-(2-fluoroethyl)-25-hydroxy-26,27-dimethyl-24a-homo-22-oxa-3-epicholecalciferol	(5Z,7E)-(1S,3R)-1-(2-fluoroethyl)-26,27-dimethyl-24a-homo-22-oxa-9,10-seco-5,7,10(19)-cholestatriene-3,25-diol	VVD0674	Sachiko Yamada		C₃₁H₅₁FO₃	490.733
668		25-hydroxy-1a-hydroxymethyl-26,27-dimethyl-24a-homo-22,23,24,24a-tetradehydrovitamin D₃ / 25-hydroxy-1a-hydroxymethyl-26,27-dimethyl-24a-homo-22,23,24,24a-tetradehydrocholecalciferol	(5Z,7E,22E,24E)-(1S,3S)-1-hydroxymethyl-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19),22,24-cholestapentaene-3,25-diol	VVD0675	Sachiko Yamada		C₃₁H₄₈O₃	468.711
669		25-hydroxy-1b-hydroxymethyl-26,27-dimethyl-24a-homo-22,23,24,24a-tetradehydro-3-epivitamin D₃ / 25-hydroxy-1b-hydroxymethyl-26,27-dimethyl-24a-homo-22,23,24,24a-tetradehydro-3-epicholecalciferol	(5Z,7E,22E,24E)-(1R,3R)-1-hydroxymethyl-26,27-dimethyl-24a-homo-9,10-seco-5,7,10(19),22,24-cholestapentaene-3,25-diol	VVD0676	Sachiko Yamada		C₃₁H₄₈O₃	468.711
670		25-hydroxy-1a-hydroxymethyl-23,23,24,24-tetradehydrovitamin D₃ / 25-hydroxy-1a-hydroxymethyl-23,23,24,24-tetradehydrocholecalciferol	(5Z,7E)-(1S,3S)-1-hydroxymethyl-9,10-seco-5,7,10(19)-cholestatrien-23-yne-3,25-diol	VVD0677	Sachiko Yamada		C₂₈H₄₀O₃	424.615
671		25-hydroxy-1b-hydroxymethyl-23,23,24,24-tetradehydro-3-epivitamin D₃ / 25-hydroxy-1b-hydroxymethyl-23,23,24,24-tetradehydro-3-epicholecalciferol	(5Z,7E)-(1R,3R)-1-hydroxymethyl-9,10-seco-5,7,10(19)-cholestatrien-23-yne-3,25-diol	VVD0678	Sachiko Yamada		C₂₈H₄₀O₃	424.615
672		25-hydroxy-1a-hydroxymethyl-16,17-didehydrovitamin D₃ / 25-hydroxy-1a-hydroxymethyl-16,17-didehydrocholecalciferol	(5Z,7E)-(1S,3S)-1-hydroxymethyl-9,10-seco-5,7,10(19),16-cholestatetraene-3,25-diol	VVD0679	Sachiko Yamada		C₂₈H₄₄O₃	428.647
673		25-hydroxy-1b-hydroxymethyl-16,17-didehydro-3-epivitamin D₃ / 25-hydroxy-1b-hydroxymethyl-16,17-didehydro-3-epicholecalciferol	(5Z,7E)-(1R,3R)-1-hydroxymethyl-9,10-seco-5,7,10(19),16-cholestatetraene-3,25-diol	VVD0680	Sachiko Yamada		C₂₈H₄₄O₃	428.647
674		25-hydroxy-1a-hydroxymethyl-26,27-dimethyl-16,17-didehydrovitamin D₃ / 25-hydroxy-1a-hydroxymethyl-26,27-dimethyl-16,17-didehydrocholecalciferol	(5Z,7E)-(1S,3S)-1-hydroxymethyl-26,27-dimethyl-9,10-seco-5,7,10(19),16-cholestatetraene-3,25-diol	VVD0681	Sachiko Yamada		C₃₀H₄₈O₃	456.700
675		25-hydroxy-1b-hydroxymethyl-26,27-dimethyl-16,17-didehydro-3-epivitamin D₃ / 25-hydroxy-1b-hydroxymethyl-26,27-dimethyl-16,17-didehydro-3-epicholecalciferol	(5Z,7E)-(1R,3R)-1-hydroxymethyl-26,27-dimethyl-9,10-seco-5,7,10(19),16-cholestatetraene-3,25-diol	VVD0682	Sachiko Yamada		C₃₀H₄₈O₃	456.700
676		(20S)-1a,25-dihydroxy-20-phenyl-16,17-didehydro-21-norvitamin D₃ / (20S)-1a,25-dihydroxy-20-phenyl-16,17-didehydro-21-norcholecalciferol	(5Z,7E)-(1S,3R,20S)-20-phenyl-21-nor-9,10-seco-5,7,10(19),16-cholestatetraene-1,3,25-triol	VVD0683	Sachiko Yamada		C₃₂H₄₄O₃	476.690
677		(20S)-20-cyclopropyl-1a,25-dihydroxy-16,17-didehydro-21-norvitamin D₃ / (20S)-20-cyclopropyl-1a,25-dihydroxy-16,17-didehydro-21-norcholecalciferol	(5Z,7E,)-(1S,3R,20S)-20-cyclopropyl-21-nor-9,10-seco-5,7,10(19),16-cholestatetraene-1,3,25-triol	VVD0684	Sachiko Yamada		C₂₉H₄₄O₃	440.658
678		(20S)-20-butyl-1a,25-dihydroxy-16,17-didehydro-21-norvitamin D₃ / (20S)-20-butyl-1a,25-dihydroxy-16,17-didehydro-21-norcholecalciferol	(5Z,7E,)-(1S,3R,20S)-20-butyl-21-nor-9,10-seco-5,7,10(19),16-cholestatetraene-1,3,25-triol	VVD0685	Sachiko Yamada		C₃₀H₄₈O₃	456.700
679		(20R)-1a,25-dihydroxy-20-phenyl-16,17-didehydro-21-norvitamin D₃ / (20R)-1a,25-dihydroxy-20-phenyl-16,17-didehydro-21-norcholecalciferol	(5Z,7E)-(1S,3R,20R)-20-phenyl-21-nor-9,10-seco-5,7,10(19),16-cholestatetraene-1,3,25-triol	VVD0686	Sachiko Yamada		C₃₂H₄₄O₃	476.690
680		(24S)-1a,24-dihydroxyvitamin D₂ / (24S)-1a,24-dihydroxyergocalciferol	(5Z,7E,22E)-(1S,3R,24S)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,24-triol	VVD0687	Sachiko Yamada		C₂₈H₄₄O₃	428.647
681		1a-hydroxy-18-(4-hydroxy-4-methylpentyloxy)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-18-(4-hydroxy-4-methylpentyloxy)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-18-(4-hydroxy-4-methylpentyloxy)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0688	Sachiko Yamada		C₂₈H₄₆O₄	446.662
682		1a-hydroxy-18-(4-hydroxy-4-ethylhexyloxy)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-18-(4-hydroxy-4-ethylhexyloxy)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-18-(4-hydroxy-4-ethylhexyloxy)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0689	Sachiko Yamada		C₃₀H₅₀O₄	474.716
683		1a-hydroxy-18-(5-hydroxy-5-methylhexyloxy)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-18-(5-hydroxy-5-methylhexyloxy)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-18-(5-hydroxy-5-methylhexyloxy)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0690	Sachiko Yamada		C₂₉H₄₈O₄	460.689
684		1a-hydroxy-18-[m-(1-hydroxy-1-methylethyl)-benzyloxy]-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-18-[m-(1-hydroxy-1-methylethyl)-benzyloxy]-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-18-[m-(1-hydroxy-1-methylethyl)-benzyloxy]-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0691	Sachiko Yamada		C₃₂H₄₆O₄	494.705
685		1a-hydroxy-18-[m-(1-hydroxy-1-ethylpropyl)-benzyloxy]-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-18-[m-(1-hydroxy-1-ethylpropyl)-benzyloxy]-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-18-[m-(1-hydroxy-1-ethylpropyl)-benzyloxy]-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0692	Sachiko Yamada		C₃₄H₅₀O₄	522.758
686		1a-hydroxy-18-(4-hydroxy-4-methyl-2-pentynyloxy)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-18-(4-hydroxy-4-methyl-2-pentynyloxy)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-18-(4-hydroxy-4-methyl-2-pentynyloxy)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0693	Sachiko Yamada		C₂₈H₄₂O₄	442.631
687		1a-hydroxy-18-(4-hydroxy-4-ethyl-2-hexynyloxy)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-18-(4-hydroxy-4-ethyl-2-hexynyloxy)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-18-(4-hydroxy-4-ethyl-2-hexynyloxy)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0694	Sachiko Yamada		C₃₀H₄₆O₄	470.684
688		1a-hydroxy-18-(5-hydroxy-5-methyl-2-hexynyloxy)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-18-(5-hydroxy-5-methyl-2-hexynyloxy)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-18-(5-hydroxy-5-methyl-2-hexynyloxy)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0695	Sachiko Yamada		C₂₉H₄₄O₄	456.657
689		1a-hydroxy-18-(5-hydroxy-5-methyl-3-hexynyloxy)-23,24,25,26,27-pentanorvitamin D₃ / 1a-hydroxy-18-(5-hydroxy-5-methyl-3-hexynyloxy)-23,24,25,26,27-pentanorcholecalciferol	(5Z,7E)-(1S,3R)-18-(5-hydroxy-5-methyl-3-hexynyloxy)-23,24-dinor-9,10-seco-5,7,10(19)-cholatriene-1,3-diol	VVD0696	Sachiko Yamada		C₂₉H₄₄O₄	456.657
690		(24E)-1a,25-dihydroxy-24,24a-didehydro-24a,24b-dihomovitamin D₃ /(24E)-1a,25-dihydroxy-24,24a-didehydro-24a,24b-dihomocholecalciferol	(5Z,7E,24E)-(1S,3R)-24a,24b-dihomo-9,10-seco-5,7,10(19),24-cholestatetraene-1,3,25-triol	VVD0697	Sachiko Yamada		C₂₉H₄₆O₃	442.674
691		(24aE)-1a,25-dihydroxy-24a,24b-didehydro-24a,24b-dihomovitamin D₃ /(24aE)-1a,25-dihydroxy-24a,24b-didehydro-24a,24b-dihomocholecalciferol	(5Z,7E,24aE)-(1S,3R)-24a,24b-dihomo-9,10-seco-5,7,10(19),24a-cholestatetraene-1,3,25-triol	VVD0698	Sachiko Yamada		C₂₉H₄₆O₃	442.674
692		(24S)-1a,24-dihydroxyvitamin D₂ / (24S)-1a,24-dihydroxyergocalciferol	(5Z,7E,22E)-(1S,3R,24S)-9,10-seco-5,7,10(19),22-ergostatetraene-1,3,24-triol	VVD0699	Sachiko Yamada		C₂₈H₄₄O₃	428.647
693		(10S)-1a,19,25-trihydroxy-10,19-dihydrovitamin D₃ / (10S)-1a,19,25-trihydroxy-10,19-dihydrocholecalciferol	(5Z,7E)-(1S,3R,10S)-9,10-seco-5,7-cholestadiene-1,3,19,25-tetrol	VVD0700	Sachiko Yamada		C₂₇H₄₆O₄	434.652									(EtOH)lmax (nm) 243, 251.5, 261 (Ref. 0355)		¹H-NMR(d,CDCl3) 0.544(3H, s, 18-H₃), 0.943(3H, d, J = 6.5 Hz, 21-H₃), 1.219(6H, s, 26- and 27-H₃), 2.14(1H, br d, J = 14 Hz, 4b-H), 2.47(1H, br d, J = 14 Hz, 4a-H), 2.80(2H, br d, J = 12.7 Hz, 9b-H), 3.52(1H, m, W/2 = 17 Hz, 10b-H), 3.64(1H, dd, J = 10.4, 5.4 Hz, one of 19-H₂), 4.18(2H, br m, 3aH and one of 19-H₂), 4.29(1H, -dt, J = 12.2, 4.3 Hz, 1b-H), 5.96 and 6.33(1H and 1H, each d, J = 11.2 Hz, 7- and 6-H), 5.89 and 6.37(1H and 1H, each d, J = 11.3 Hz, 7- and 6-H) (Ref. 0355)	m/z 434 (M⁺,36), 416(38), 398(21), 383(9), 305(14), 287(18), 245(33), 81(100) (Ref. 0355)				Hydroboration of 1,25-(OH)₂D₃ followed by oxidation gave a mixture of epimers at C(10). The C(10) epimers were separated by flash column chromatography. (Ref. 0355)				[0355]
694		(10R)-1a,19,25-trihydroxy-10,19-dihydrovitamin D₃ / (10R)-1a,19,25-trihydroxy-10,19-dihydrocholecalciferol	(5Z,7E)-(1S,3R,10R)-9,10-seco-5,7-cholestadiene-1,3,19,25-tetrol	VVD0701	Sachiko Yamada		C₂₇H₄₆O₄	434.652									(EtOH)lmax (nm) 243, 251, 261 (Ref. 0355)		¹H-NMR(d,CDCl3) 0.543(3H, s, 18-H₃), 0.940(3H, d, J = 6.4 Hz, 21-H₃), 1.215(6H, s, 26- and 27-H₃), 2.23(1H,-t, J = 12 Hz, 4b-H), 2.51(1H, dd, J = 12.6, 4.1 Hz, 4a-H), 2.81(1H, br d, J = 13 Hz, 9b-H), 3.13(1H, m, W/2 = 18 Hz, 10a-H), 3.68(2H, m, 19-H₂), 4.04(1H, m, W/2 = 26 Hz, 3aH ), 4.20(1H, m, W/2 = 11 Hz, 1b-H), 5.86 and 6.52(1H and 1H, each d, J = 11.2 Hz, 7- and 6-H) (Ref. 0355)	m/z 434 (M⁺,35), 416(29), 398(14), 383(7), 305(17), 287(16), 245(37), 81(100) (Ref. 0355)				Hydroboration of 1,25-(OH)₂D₃ followed by oxidation gave a mixture of epimers at C(10). The C(10) epimers were separated by flash column chromatography. (Ref. 0355)				[0355]
695		(23S)-1a-hydroxy-25,27-didehydrovitamin D₃ 26,23-lactone	(5Z,7E)-(1S,3R,23S)-1,3-dihydroxy-9,10-seco-5,7,10(19),25(27)-cholestatetraeno-26,23-lactone	VVD0702	Sachiko Yamada		C₂₇H₃₈O₄	426.588		Activity relative to 1,25-(OH)₂D₃ (defined 1): Affinity for chick intestinal receptor, 1/9.8; Affinity for bovine serum vitamin D binding protein, 1/10.7; HL-60 cell differentiation, no effect; Antagonistic activity, yes. (Ref. 0373)														Convergent synthesis from CD-ring plus side chain fragment and enyne A-ring precursor via palladium catalyzed coupling of the upper and the lower half fragments as a key step. (Ref. 0373)				[0373]
696		(23R)-1a-hydroxy-25,27-didehydrovitamin D₃ 26,23-lactone	(5Z,7E)-(1S,3R,23R)-1,3-dihydroxy-9,10-seco-5,7,10(19),25(27)-cholestatetraeno-26,23-lactone	VVD0703	Sachiko Yamada					Activity relative to 1,25-(OH)₂D₃ (defined 1): Affinity for chick intestinal receptor, 1/3.8; Affinity for bovine serum vitamin D binding protein, 1/39.4; HL-60 cell differentiation, no effect; Antagonistic activity, yes. (Ref. 0373)														Convergent synthesis from CD-ring plus side chain fragment and enyne A-ring precursor via palladium catalyzed coupling of the upper and the lower half fragments as a key step. (Ref. 0373)				[0373]
697		2b-chloro-1a,25-dihydroxyvitamin D₃	(5Z,7E)-(1R,2R,3R)-2-chloro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0704	Sachiko Yamada		C₂₇H₄₃ClO₃	451.081		(% of 1,25-(OH)₂D₃ effect) Affinity for chicken intestine vitamin D receptor: 100; Affinity for sheep serum vitamin D binding protein: 140; Inhibition of proliferation of C3H10T(BMP-4) cells: 0.9 (FCS-free), 11 (10% FCS); CAT assay (osteocalcin): 130; Inhibition of adipogenesis: 8. (Ref. 0374)														From C(22) steroid precursor via photochemical method. The C(2) substituent was introduced by nucleophilic opening of 1a,2a-epoxide. (Ref. 0374)				[0374]
698		2b-fluoro-1a,25-dihydroxyvitamin D₃	(5Z,7E)-(1R,2R,3R)-2-fluoro-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0705	Sachiko Yamada		C₂₇H₄₃FO₃	434.627		(% of 1,25-(OH)₂D₃ effect) Affinity for chicken intestine vitamin D receptor: 667; Affinity for sheep serum vitamin D binding protein: 160; Inhibition of proliferation of C3H10T(BMP-4) cells: 133 (FCS-free), 900 (10% FCS); CAT assay (osteocalcin): 130; Inhibition of adipogenesis: 500. (Ref. 0374)														From C(22) steroid precursor via photochemical method. The C(2) substituent was introduced by nucleophilic opening of 1a,2a-epoxide. (Ref. 0374)				[0374]
699		2b-methoxy-1a,25-dihydroxyvitamin D₃	(5Z,7E)-(1R,2R,3R)-2-methoxy-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol	VVD0706	Sachiko Yamada		C₂₈H₄₆O₄	446.662		(% of 1,25-(OH)₂D₃ effect) Affinity for chicken intestine vitamin D receptor: 9; Affinity for sheep serum vitamin D binding protein: 3500; Inhibition of proliferation of C3H10T(BMP-4) cells: 11 (FCS-free), 1.5 (10% FCS); CAT assay (osteocalcin): 70; Inhibition of adipogenesis: 0.08. (Ref. 0374)														From C(22) steroid precursor via photochemical method. The C(2) substituent was introduced by nucleophilic opening of 1a,2a-epoxide. (Ref. 0374)				[0374]

Reference

[0001]

AUTHOR	:	Huber, W.; Ewing, G. W.; Kriger, J.
TITLE	:	The Absorption Spectra of the Vitamins and Provitamins D.
JOURNAL	:	J. Amer. Chem. Soc.
VOL	:	67 PAGE : 609-617 (1945)

[TOP]

[0002]

AUTHOR	:	Wing, R. M., Okamura, W. H., Rego, A., Pirio, M. R., and Norman, A. W.
TITLE	:	Studies on vitamin D and its analogs. VIII. Solution conformations of vitamin D3 and 1 alpha, 25-dihydroxyvitamin D3 by high-resolution proton magnetic resonance spectroscopy PubMed ID:170323
JOURNAL	:	J Am Chem Soc.
VOL	:	97 PAGE : 4980-4985 (1975)

[TOP]

[0003]

AUTHOR	:	Tsukida, K., Akutsu, K., and Saiki, K.
TITLE	:	Carbon-13 nuclear magnetic resonance spectra of vitamins D and related compounds PubMed ID:178846
JOURNAL	:	J Nutr Sci Vitaminol (Tokyo).
VOL	:	21 PAGE : 411-420 (1975)

[TOP]

[0004]

AUTHOR	:	Wing, R. M., Okamura, W. H., Pirio, M. R., Sine, S. M., and Norman, A. W.
TITLE	:	Vitamin D in solution: conformations of vitamin D3, 1alpha,25-dihydroxyvitamin D3, and dihydrotachysterol3 PubMed ID:4377759
JOURNAL	:	Science.
VOL	:	186 PAGE : 939-941 (1974)

[TOP]

[0005]

AUTHOR	:	Holick, M. F., Richtand, N. M., McNeill, S. C., Holick, S. A., Frommer, J. E., Henley, J. W., and Potts, J. T., Jr.
TITLE	:	Isolation and identification of previtamin D3 from the skin of rats exposed to ultraviolet irradiation PubMed ID:218609
JOURNAL	:	Biochemistry.
VOL	:	18 PAGE : 1003-1008 (1979)

[TOP]

[0006]

AUTHOR	:	Holick, M. F., MacLaughlin, J. A., Clark, M. B., Holick, S. A., Potts, J. T., Jr., Anderson, R. R., Blank, I. H., Parrish, J. A., and Elias, P.
TITLE	:	Photosynthesis of previtamin D3 in human skin and the physiologic consequences PubMed ID:6251551
JOURNAL	:	Science.
VOL	:	210 PAGE : 203-205 (1980)

[TOP]

[0007]

AUTHOR	:	Windaus, A.; Lettre, H.; Schenck, F.
TITLE	:	Uder das 7-Dehydro-cholesterin.
JOURNAL	:	Ann.
VOL	:	520 PAGE : 98-106 (1935)

[TOP]

[0008]

AUTHOR	:	Shaw, W. H. C.; Jefferies, J. P.; Holt, T. E.
TITLE	:	The Determination of Vitamin D and Related Compounds : Part I. Introduction and Preparation of Compounds in the Irradiation Series.
JOURNAL	:	Analyst
VOL	:	82 PAGE : 2-7 (1957)

[TOP]

[0009]

AUTHOR	:	Pelc, B., and Marshall, D. H.
TITLE	:	Thermal transformation of cholecalciferol between 100--170 degrees C PubMed ID:208197
JOURNAL	:	Steroids.
VOL	:	31 PAGE : 23-29 (1978)

[TOP]

[0010]

AUTHOR	:	Dauben, W. G.; Fonken, G. J.
TITLE	:	The Structure of Photoisopyrocalciferol and Photopyrocalciferol.
JOURNAL	:	J. Amer. Chem. Soc.
VOL	:	81 PAGE : 4060-4068 (1959)

[TOP]

[0011]

AUTHOR	:	Boomsma, F.; Jacobs, H. J. C.; Havinga, E.; van der Gen, A.
TITLE	:	The 'overirradiation products' of previtamin D and tachysterol : toxisterols.
JOURNAL	:	J. R. Neth. Chem. Soc.
VOL	:	96 PAGE : 104-111 (1977)

[TOP]

[0012]

AUTHOR	:	Boomsma, F.; Jacobs, H. J. C.; Havinga, E.; van der Gen, A.
TITLE	:	Studies on Vitamin D and Related Compounds XXIV New Irradiation Products of Previtamin D₃ : Toxisterols.
JOURNAL	:	Tetrahedron Lett.
VOL	:	7 PAGE : 427-430 (1975)

[TOP]

[0013]

AUTHOR	:	Bakker, S. A.; Lugtenburg, J.; Havinga, E.
TITLE	:	Studies on Vitamin D and Related Compounds XXII.
JOURNAL	:	RECUEIL
VOL	:	91 PAGE : 1459-1464 (1972)

[TOP]

[0014]

AUTHOR	:	Blunt, J. W., and DeLuca, H. F.
TITLE	:	The synthesis of 25-hydroxycholecalciferol. A biologically active metabolite of vitamin D3 PubMed ID:4307413
JOURNAL	:	Biochemistry.
VOL	:	8 PAGE : 671-675 (1969)

[TOP]

[0015]

AUTHOR	:	Blunt, J. W., DeLuca, H. F., and Schnoes, H. K.
TITLE	:	25-hydroxycholecalciferol. A biologically active metabolite of vitamin D3 PubMed ID:4300699
JOURNAL	:	Biochemistry.
VOL	:	7 PAGE : 3317-3322 (1968)

[TOP]

[0016]

AUTHOR	:	Masumoto, O., Ohyama, Y., and Okuda, K.
TITLE	:	Purification and characterization of vitamin D 25-hydroxylase from rat liver mitochondria PubMed ID:2844763
JOURNAL	:	J Biol Chem.
VOL	:	263 PAGE : 14256-14260 (1988)

[TOP]

[0017]

AUTHOR	:	DeLuca, H. F., and Schnoes, H. K.
TITLE	:	Metabolism and mechanism of action of vitamin D PubMed ID:183601
JOURNAL	:	Annu Rev Biochem.
VOL	:	45 PAGE : 631-666 (1976)

[TOP]

[0018]

AUTHOR	:	DeLuca, H. F., and Schnoes, H. K.
TITLE	:	Vitamin D: recent advances PubMed ID:6311080
JOURNAL	:	Annu Rev Biochem.
VOL	:	52 PAGE : 411-439 (1983)

[TOP]

[0019]

AUTHOR	:	Holick, M. F., DeLuca, H. F., and Avioli, L. V.
TITLE	:	Isolation and identification of 25-hydroxycholecalciferol from human plasma PubMed ID:4332591
JOURNAL	:	Arch Intern Med.
VOL	:	129 PAGE : 56-61 (1972)

[TOP]

[0020]

AUTHOR	:	Wang, X.; Shimizu, M.; Numano, F.; Asaoka, H.; Yamada, S.
TITLE	:	Multiple Fluorometric Assay of Three Major Vitamin D₃ Metabolites (25-Hydroxyvitamin D₃, 24,25-Dihydroxyvitamin D₃ and 1,25-Dihydroxyvitamin D₃) in Plasma and Its Application to Clinical Studies.
JOURNAL	:	Anal. Sci.
VOL	:	13 PAGE : 255-262 (1997)

[TOP]

[0021]

AUTHOR	:	Blunt, J. W.; DeLuca, H. F.; Schnoes, H. K.
TITLE	:	25-Hydroxycholecalciferol : A Biologically Active Metabolite of Cholecalciferol.
JOURNAL	:	Chem. Comm.
VOL	:	PAGE : 801- (1968)

[TOP]

[0022]

AUTHOR	:	Fraser, D. R., and Kodicek, E.
TITLE	:	Unique biosynthesis by kidney of a biological active vitamin D metabolite PubMed ID:4319631
JOURNAL	:	Nature.
VOL	:	228 PAGE : 764-766 (1970)

[TOP]

[0023]

AUTHOR	:	Shimizu, M.; Iwasaki, Y.; Ishida, H.; Yamada, S.
TITLE	:	Determination of 25-hydroxyvitamin D₃ in human plasma using a non-radioactive tetranorvitamin D analogue as an internal standard. PubMed ID:8590938
JOURNAL	:	J. Chromatogr. B.
VOL	:	672 PAGE : 63-71 (1995)

[TOP]

[0024]

AUTHOR	:	Barton, D. H. R.; Hesse, R. H.; Pechet, M. M.; Rizzardo, E.
TITLE	:	Convenient Synthesis of Crystalline 1a,25-Dihydroxyvitamin D₃.
JOURNAL	:	J. Chem. Soc. Chem. Comm.
VOL	:	PAGE : 203-204 (1974)

[TOP]

[0025]

AUTHOR	:	Eguchi, T.; Ikekawa, N.
TITLE	:	Conformational Analysis of 1a,25-Dihydroxyvitamin D₃ by Nuclear Magnetic Resonance.
JOURNAL	:	Bioorg. Chem.
VOL	:	18 PAGE : 19-29 (1990)

[TOP]

[0026]

AUTHOR	:	Holick, M. F., Schnoes, H. K., DeLuca, H. F., Suda, T., and Cousins, R. J.
TITLE	:	Isolation and identification of 1,25-dihydroxycholecalciferol. A metabolite of vitamin D active in intestine PubMed ID:4326883
JOURNAL	:	Biochemistry.
VOL	:	10 PAGE : 2799-2804 (1971)

[TOP]

[0027]

AUTHOR	:	Holick, M. F., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Identification of 1,25-dihydroxycholecalciferol, a form of vitamin D3 metabolically active in the intestine PubMed ID:4323790
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	68 PAGE : 803-804 (1971)

[TOP]

[0028]

AUTHOR	:	Lawson, D. E., Fraser, D. R., Kodicek, E., Morris, H. R., and Williams, D. H.
TITLE	:	Identification of 1,25-dihydroxycholecalciferol, a new kidney hormone controlling calcium metabolism PubMed ID:4323313
JOURNAL	:	Nature.
VOL	:	230 PAGE : 228-230 (1971)

[TOP]

[0029]

AUTHOR	:	Shimizu, M., Wang, X., and Yamada, S.
TITLE	:	Fluorimetric assay of 1 alpha,25-dihydroxyvitamin D3 in human plasma PubMed ID:9106025
JOURNAL	:	J Chromatogr B Biomed Sci Appl.
VOL	:	690 PAGE : 15-23 (1997)

[TOP]

[0030]

AUTHOR	:	Takeyama, K., Kitanaka, S., Sato, T., Kobori, M., Yanagisawa, J., and Kato, S.
TITLE	:	25-Hydroxyvitamin D3 1alpha-hydroxylase and vitamin D synthesis PubMed ID:9295274
JOURNAL	:	Science.
VOL	:	277 PAGE : 1827-1830 (1997)

[TOP]

[0031]

AUTHOR	:	Shinki, T., Shimada, H., Wakino, S., Anazawa, H., Hayashi, M., Saruta, T., DeLuca, H. F., and Suda, T.
TITLE	:	Cloning and expression of rat 25-hydroxyvitamin D3-1alpha-hydroxylase cDNA PubMed ID:9371776
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	94 PAGE : 12920-12925 (1997)

[TOP]

[0032]

AUTHOR	:	Ohyama, Y., Noshiro, M., and Okuda, K.
TITLE	:	Cloning and expression of cDNA encoding 25-hydroxyvitamin D3 24-hydroxylase PubMed ID:1991512
JOURNAL	:	FEBS Lett.
VOL	:	278 PAGE : 195-198 (1991)

[TOP]

[0033]

AUTHOR	:	Chen, K. S., Prahl, J. M., and DeLuca, H. F.
TITLE	:	Isolation and expression of human 1,25-dihydroxyvitamin D3 24-hydroxylase cDNA PubMed ID:8506296
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	90 PAGE : 4543-4547 (1993)

[TOP]

[0034]

AUTHOR	:	Kleiner-Bossaller, A.; DeLuca, H. F.
TITLE	:	Formation of 1,24,25-Trihydroxyvitamin D₃ from 1,25-Dihydroxyvitamin D₃.
JOURNAL	:	Biochim. Biophys. Acta
VOL	:	338 PAGE : 489-495 (1974)

[TOP]

[0035]

AUTHOR	:	Semmler, E. J.; Holick, M. F.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	The Synthesis of 1a,25-Dihydroxycholecalciferol : A Metabolically Active from of Vitamin D₃.
JOURNAL	:	Tetrahedron Lett.
VOL	:	40 PAGE : 4147-4150 (1972)

[TOP]

[0036]

AUTHOR	:	Onisko, B. L., Esvelt, R. P., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Metabolites of 1 alpha, 25-dihydroxyvitamin D3 in rat bile PubMed ID:6996717
JOURNAL	:	Biochemistry.
VOL	:	19 PAGE : 4124-4130 (1980)

[TOP]

[0037]

AUTHOR	:	McDonnell, D. P., Mangelsdorf, D. J., Pike, J. W., Haussler, M. R., and O'Malley, B. W.
TITLE	:	Molecular cloning of complementary DNA encoding the avian receptor for vitamin D PubMed ID:3029866
JOURNAL	:	Science.
VOL	:	235 PAGE : 1214-1217 (1987)

[TOP]

[0038]

AUTHOR	:	Pike, J. W., Sleator, N. M., and Haussler, M. R.
TITLE	:	Chicken intestinal receptor for 1,25-dihydroxyvitamin D3. Immunologic characterization and homogeneous isolation of a 60,000-dalton protein PubMed ID:3027085
JOURNAL	:	J Biol Chem.
VOL	:	262 PAGE : 1305-1311 (1987)

[TOP]

[0039]

AUTHOR	:	Elaroussi, M. A., Prahl, J. M., and DeLuca, H. F.
TITLE	:	The avian vitamin D receptors: primary structures and their origins PubMed ID:7972109
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	91 PAGE : 11596-11600 (1994)

[TOP]

[0040]

AUTHOR	:	Baker, A. R., McDonnell, D. P., Hughes, M., Crisp, T. M., Mangelsdorf, D. J., Haussler, M. R., Pike, J. W., Shine, J., and O'Malley, B. W.
TITLE	:	Cloning and expression of full-length cDNA encoding human vitamin D receptor PubMed ID:2835767
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	85 PAGE : 3294-3298 (1988)

[TOP]

[0041]

AUTHOR	:	Burmester, J. K., Maeda, N., and DeLuca, H. F.
TITLE	:	Isolation and expression of rat 1,25-dihydroxyvitamin D3 receptor cDNA PubMed ID:2829212
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	85 PAGE : 1005-1009 (1988)

[TOP]

[0042]

AUTHOR	:	Burmester, J. K., Wiese, R. J., Maeda, N., and DeLuca, H. F.
TITLE	:	Structure and regulation of the rat 1,25-dihydroxyvitamin D3 receptor PubMed ID:2849110
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	85 PAGE : 9499-9502 (1988)

[TOP]

[0043]

AUTHOR	:	Kamei, Y., Kawada, T., Fukuwatari, T., Ono, T., Kato, S., and Sugimoto, E.
TITLE	:	Cloning and sequencing of the gene encoding the mouse vitamin D receptor PubMed ID:7835717
JOURNAL	:	Gene.
VOL	:	152 PAGE : 281-282 (1995)

[TOP]

[0044]

AUTHOR	:	Darwish, H. M.; DeLuca, H. F.
TITLE	:	Identification of a 1,25-dihydroxyvitamin D₃-response element in the 5'-flanking region of the rat calbindin D-9k gene. PubMed ID:1309950
JOURNAL	:	Proc. Natl. Acad. Sci. U.S.A.
VOL	:	89 PAGE : 603-607 (1992)

[TOP]

[0045]

AUTHOR	:	Demay, M. B., Gerardi, J. M., DeLuca, H. F., and Kronenberg, H. M.
TITLE	:	DNA sequences in the rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer responsiveness to 1,25-dihydroxyvitamin D3 PubMed ID:2153298
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	87 PAGE : 369-373 (1990)

[TOP]

[0046]

AUTHOR	:	Morrison, N. A., Shine, J., Fragonas, J. C., Verkest, V., McMenemy, M. L., and Eisman, J. A.
TITLE	:	1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene PubMed ID:2588000
JOURNAL	:	Science.
VOL	:	246 PAGE : 1158-1161 (1989)

[TOP]

[0047]

AUTHOR	:	Ozono, K., Liao, J., Kerner, S. A., Scott, R. A., and Pike, J. W.
TITLE	:	The vitamin D-responsive element in the human osteocalcin gene. Association with a nuclear proto-oncogene enhancer PubMed ID:2174889
JOURNAL	:	J Biol Chem.
VOL	:	265 PAGE : 21881-21888 (1990)

[TOP]

[0048]

AUTHOR	:	Noda, M., Vogel, R. L., Craig, A. M., Prahl, J., DeLuca, H. F., and Denhardt, D. T.
TITLE	:	Identification of a DNA sequence responsible for binding of the 1,25-dihydroxyvitamin D3 receptor and 1,25-dihydroxyvitamin D3 enhancement of mouse secreted phosphoprotein 1 (SPP-1 or osteopontin) gene expression PubMed ID:2175918
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	87 PAGE : 9995-9999 (1990)

[TOP]

[0049]

AUTHOR	:	Zierold, C., Darwish, H. M., and DeLuca, H. F.
TITLE	:	Identification of a vitamin D-response element in the rat calcidiol (25-hydroxyvitamin D3) 24-hydroxylase gene PubMed ID:8302863
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	91 PAGE : 900-902 (1994)

[TOP]

[0050]

AUTHOR	:	Chen, K. S., and DeLuca, H. F.
TITLE	:	Cloning of the human 1 alpha,25-dihydroxyvitamin D-3 24-hydroxylase gene promoter and identification of two vitamin D-responsive elements PubMed ID:7632726
JOURNAL	:	Biochim Biophys Acta.
VOL	:	1263 PAGE : 1-9 (1995)

[TOP]

[0051]

AUTHOR	:	Ohyama, Y., Ozono, K., Uchida, M., Shinki, T., Kato, S., Suda, T., Yamamoto, O., Noshiro, M., and Kato, Y.
TITLE	:	Identification of a vitamin D-responsive element in the 5'-flanking region of the rat 25-hydroxyvitamin D3 24-hydroxylase gene PubMed ID:8144641
JOURNAL	:	J Biol Chem.
VOL	:	269 PAGE : 10545-10550 (1994)

[TOP]

[0052]

AUTHOR	:	Demay, M. B.; Kiernan, M. S.; DeLuca, H. F.; Kronenberg, H. M.
TITLE	:	Sequences in the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D₃ receptor and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D₃.
JOURNAL	:	Proc. Natl. Acad. Sci. U.S.A.
VOL	:	89 PAGE : 8097-8101 (1992)

[TOP]

[0053]

AUTHOR	:	Takeda, T., Arakawa, M., and Kuwano, R.
TITLE	:	Organization and expression of the mouse spot35/calbindin-D28k gene: identification of the vitamin D-responsive promoter region PubMed ID:7980557
JOURNAL	:	Biochem Biophys Res Commun.
VOL	:	204 PAGE : 889-897 (1994)

[TOP]

[0054]

AUTHOR	:	Quelo, I., Kahlen, J. P., Rascle, A., Jurdic, P., and Carlberg, C.
TITLE	:	Identification and characterization of a vitamin D3 response element of chicken carbonic anhydrase-II PubMed ID:7811384
JOURNAL	:	DNA Cell Biol.
VOL	:	13 PAGE : 1181-1187 (1994)

[TOP]

[0055]

AUTHOR	:	Schrader, M., Nayeri, S., Kahlen, J. P., Muller, K. M., and Carlberg, C.
TITLE	:	Natural vitamin D3 response elements formed by inverted palindromes: polarity-directed ligand sensitivity of vitamin D3 receptor-retinoid X receptor heterodimer-mediated transactivation PubMed ID:7862109
JOURNAL	:	Mol Cell Biol.
VOL	:	15 PAGE : 1154-1161 (1995)

[TOP]

[0056]

AUTHOR	:	Gill, R. K., and Christakos, S.
TITLE	:	Identification of sequence elements in mouse calbindin-D28k gene that confer 1,25-dihydroxyvitamin D3- and butyrate-inducible responses PubMed ID:8464915
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	90 PAGE : 2984-2988 (1993)

[TOP]

[0057]

AUTHOR	:	Yoshizawa, T., Handa, Y., Uematsu, Y., Takeda, S., Sekine, K., Yoshihara, Y., Kawakami, T., Arioka, K., Sato, H., Uchiyama, Y., et al.
TITLE	:	Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning PubMed ID:9241280
JOURNAL	:	Nat Genet.
VOL	:	16 PAGE : 391-396 (1997)

[TOP]

[0058]

AUTHOR	:	DeLuca, H. F.
TITLE	:	The vitamin D story: a collaborative effort of basic science and clinical medicine PubMed ID:3280376
JOURNAL	:	Faseb J.
VOL	:	2 PAGE : 224-236 (1988)

[TOP]

[0059]

AUTHOR	:	Reichel, H., Koeffler, H. P., and Norman, A. W.
TITLE	:	The role of the vitamin D endocrine system in health and disease PubMed ID:2648151
JOURNAL	:	N Engl J Med.
VOL	:	320 PAGE : 980-991 (1989)

[TOP]

[0060]

AUTHOR	:	Abe, E., Miyaura, C., Sakagami, H., Takeda, M., Konno, K., Yamazaki, T., Yoshiki, S., and Suda, T.
TITLE	:	Differentiation of mouse myeloid leukemia cells induced by 1 alpha,25-dihydroxyvitamin D3 PubMed ID:6946446
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	78 PAGE : 4990-4994 (1981)

[TOP]

[0061]

AUTHOR	:	Miyaura, C., Abe, E., Kuribayashi, T., Tanaka, H., Konno, K., Nishii, Y., and Suda, T.
TITLE	:	1 alpha,25-Dihydroxyvitamin D3 induces differentiation of human myeloid leukemia cells PubMed ID:6946774
JOURNAL	:	Biochem Biophys Res Commun.
VOL	:	102 PAGE : 937-943 (1981)

[TOP]

[0062]

AUTHOR	:	Parren, H. E.; DeLuca, H. F.; Schnoes, H. K.
TITLE	:	Direct C(1) Hydroxylation of Vitamin D₃ and Related Compounds.
JOURNAL	:	J. Org. Chem.
VOL	:	45 PAGE : 3253-3258 (1980)

[TOP]

[0063]

AUTHOR	:	Corradino, R. A., and Wasserman, R. H.
TITLE	:	1,25-Dihydroxycholecalciferol-like activity of Solanum malacoxylon extract on calcium transport PubMed ID:4437623
JOURNAL	:	Nature.
VOL	:	252 PAGE : 716-718 (1974)

[TOP]

[0064]

AUTHOR	:	Ikekawa,N.; Morisaki, M.; Koizumi, N.; Kato, Y.; Takeshita, T.
TITLE	:	Synthesis of Active Forms of Vitamin D. VIII. Synthesis of [24R]-and [24S]-1a,24,25-Trihydroxyvitamin D₃.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	23 PAGE : 695-697 (1975)

[TOP]

[0065]

AUTHOR	:	Holick, M. F., Kleiner-Bossaller, A., Schnoes, H. K., Kasten, P. M., Boyle, I. T., and DeLuca, H. F.
TITLE	:	1,24,25-Trihydroxyvitamin D3. A metabolite of vitamin D3 effective on intestine PubMed ID:4355503
JOURNAL	:	J Biol Chem.
VOL	:	248 PAGE : 6691-6696 (1973)

[TOP]

[0066]

AUTHOR	:	Tanaka, Y., Castillo, L., and DeLuca, H. F.
TITLE	:	The 24-hydroxylation of 1,25-dihydroxyvitamin D3 PubMed ID:838723
JOURNAL	:	J Biol Chem.
VOL	:	252 PAGE : 1421-1424 (1977)

[TOP]

[0067]

AUTHOR	:	Mayer, E., Bishop, J. E., Chandraratna, R. A., Okamura, W. H., Kruse, J. R., Popjak, G., Ohnuma, N., and Norman, A. W.
TITLE	:	Isolation and identification of 1,25-dihydroxy-24-oxo-vitamin D3 and 1,23,25-trihydroxy-24-oxo-vitamin D3. New metabolites of vitamin D3 produced by a C-24 oxidation pathway of metabolism for 1,25-dihydroxyvitamin D3 present in intestine and kidney PubMed ID:6315697
JOURNAL	:	J Biol Chem.
VOL	:	258 PAGE : 13458-13465 (1983)

[TOP]

[0068]

AUTHOR	:	Napoli, J. L., Pramanik, B. C., Royal, P. M., Reinhardt, T. A., and Horst, R. L.
TITLE	:	Intestinal synthesis of 24-keto-1,25-dihydroxyvitamin D3. A metabolite formed in vivo with high affinity for the vitamin D cytosolic receptor PubMed ID:6307992
JOURNAL	:	J Biol Chem.
VOL	:	258 PAGE : 9100-9107 (1983)

[TOP]

[0069]

AUTHOR	:	Reddy, G. S., Tserng, K. Y., Thomas, B. R., Dayal, R., and Norman, A. W.
TITLE	:	Isolation and identification of 1,23-dihydroxy-24,25,26,27-tetranorvitamin D3, a new metabolite of 1,25-dihydroxyvitamin D3 produced in rat kidney PubMed ID:3828305
JOURNAL	:	Biochemistry.
VOL	:	26 PAGE : 324-331 (1987)

[TOP]

[0070]

AUTHOR	:	Esvelt, R. P., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Isolation and characterization of 1 alpha-hydroxy-23-carboxytetranorvitamin D: a major metabolite of 1,25-dihydroxyvitamin D3 PubMed ID:486408
JOURNAL	:	Biochemistry.
VOL	:	18 PAGE : 3977-3983 (1979)

[TOP]

[0071]

AUTHOR	:	Esvelt, R. P.; Fivizzani, M. A.; Parren, H. E.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Synthesis of Calcitroic Acid, a Metabolite of 1a, 25-Dihydroxycholecalciferol.
JOURNAL	:	J. Org. Chem.
VOL	:	46 PAGE : 456-458 (1981)

[TOP]

[0072]

AUTHOR	:	Esvelt, R. P., and De Luca, H. F.
TITLE	:	Calcitroic acid: biological activity and tissue distribution studies PubMed ID:6261697
JOURNAL	:	Arch Biochem Biophys.
VOL	:	206 PAGE : 403-413 (1981)

[TOP]

[0073]

AUTHOR	:	Reddy, G. S., and Tserng, K. Y.
TITLE	:	Calcitroic acid, end product of renal metabolism of 1,25-dihydroxyvitamin D3 through C-24 oxidation pathway PubMed ID:2719932
JOURNAL	:	Biochemistry.
VOL	:	28 PAGE : 1763-1769 (1989)

[TOP]

[0074]

AUTHOR	:	DeCosta, B. R.; Makk, N.; Midgley, J. M.; Modi, N. T.; Watt, R. A.; Whalley, W. B.
TITLE	:	Unsaturated Steroids. Part 12. Synthesis of 1a, 3b-Dihydroxy-24-nor-9,10-secochola-5,7,10(19) trien-23-oic (Calcitroic) Acid and of the Cholic-and 25-Homocholic Acid Analogues.
JOURNAL	:	J. Chem. Soc. Perkin Trans I
VOL	:	PAGE : 1331-1336 (1985)

[TOP]

[0075]

AUTHOR	:	Morisaki, M.; Koizumi, N.; Ikekawa, N.; Takeshita, T.; Ishimoto, S.
TITLE	:	Synthesis of Active Forms of Vitamin D. Part IX. Synthesis of 1a,24-Dihydroxycholecalciferol.
JOURNAL	:	J. Chem. Soc. Perkin I
VOL	:	PAGE : 1421-1424 (1975)

[TOP]

[0076]

AUTHOR	:	Napoli, J. L., and Horst, R. L.
TITLE	:	(23S)-1,23,25-Trihydroxycholecalciferol, an intestinal metabolite of 1,25-dihydroxycholecalciferol PubMed ID:6688522
JOURNAL	:	Biochem J.
VOL	:	214 PAGE : 261-264 (1983)

[TOP]

[0077]

AUTHOR	:	Ohnuma, N., Bannai, K., Yamaguchi, H., Hashimoto, Y., and Norman, A. W.
TITLE	:	Isolation of a new metabolite of vitamin D produced in vivo, 1 alpha,25-dihydroxyvitamin D3-26,23-lactone PubMed ID:6252850
JOURNAL	:	Arch Biochem Biophys.
VOL	:	204 PAGE : 387-391 (1980)

[TOP]

[0078]

AUTHOR	:	Yamamoto, K.; Shimizu, M.; Yamada, S.; Iwata, S.; Hoshino, O.
TITLE	:	Facile Stereoselective Synthesis of (23S,25R)-1a,25-Dihydroxyvitamin D₃ 26,23-Lactone, a Major Metabolite of 1a,25-Dihydroxyvitamin D₃.
JOURNAL	:	J. Org. Chem.
VOL	:	57 PAGE : 33-39 (1992)

[TOP]

[0079]

AUTHOR	:	Wovkulich, P. M.; Baggiolini, E. G.; Hennessy, B. M.; Uskokovic, M. R.; Mayer, E.; Norman, A. W.
TITLE	:	Total Synthesis of 1a,25(R)-Dihydroxy Vitamin D₃ 26,23(S)-Lactone (Calcitriol Lactone), a Natural Metabolite of Vitamin D₃.
JOURNAL	:	J. Org. Chem.
VOL	:	48 PAGE : 4433-4436 (1983)

[TOP]

[0080]

AUTHOR	:	Johnson, W. S.; Chan, M. F.
TITLE	:	A Highly Stereoselective Route to Calcitriol Lactone.
JOURNAL	:	J. Org. Chem.
VOL	:	50 PAGE : 2598-2600 (1985)

[TOP]

[0081]

AUTHOR	:	Hatakeyama, S.; Sugawara, M.; Kawamura, M.; Takano, S.
TITLE	:	A Practical Convergent Route to (23S,25R)-1a,25-Dihydroxyvitamin D₃ 26,23-Lactone.
JOURNAL	:	J. Chem. Soc. Chem. Comm.
VOL	:	PAGE : 1229-1230 (1992)

[TOP]

[0082]

AUTHOR	:	Conrow, R. E.
TITLE	:	A Convergent Route to Calcitriol Lactone via Reductive Cleavage of an Enantiopure Glycidyl Ether.
JOURNAL	:	Tetrahedron Lett.
VOL	:	34 PAGE : 5553-5554 (1993)

[TOP]

[0083]

AUTHOR	:	Ishizuka, S., Kurihara, N., Hakeda, S., Maeda, N., Ikeda, K., Kumegawa, M., and Norman, A. W.
TITLE	:	1 alpha,25-Dihydroxyvitamin D3[1 alpha,25-(OH)2D3]-26,23-lactone inhibits 1,25-(OH)2D3-mediated fusion of mouse bone marrow mononuclear cells PubMed ID:3396507
JOURNAL	:	Endocrinology.
VOL	:	123 PAGE : 781-786 (1988)

[TOP]

[0084]

AUTHOR	:	Ishizuka, S., and Norman, A. W.
TITLE	:	Metabolic pathways from 1 alpha,25-dihydroxyvitamin D3 to 1 alpha,25-dihydroxyvitamin D3-26,23-lactone. Stereo-retained and stereo-selective lactonization PubMed ID:3034884
JOURNAL	:	J Biol Chem.
VOL	:	262 PAGE : 7165-7170 (1987)

[TOP]

[0085]

AUTHOR	:	Ishizuka, S.; Ohba, T.; Norman, A. W.; (1988) Vitamin D Molecular, Cellular and Clinical Endocrinology. Proceeding of the Vitamin D Rancho Mirage, California, USA April. 1a,25(OH)₂D₃-26,23-Lactone is a Major Metabolite of 1a,25(OH)₂D₃ Under Physiological Conditions. (Norman, A. W.; Schaefer, K.; Grigoleit, H. G.; v.
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0086]

AUTHOR	:	Partrige, J. J.; Shiuey, S-J.; Chadha, N. K.; Baggiolini, E. G.; Hennessy, B. M.; Uskokovic, M. R.; Napoli, J. L.; Reinhardt, T. A.; Horst, R. L.
TITLE	:	(25S)-1a,25,26-Trihydroxycholecalciferol, a New Vitamin D₃ Metabolite : Synthesis and Absolute Stereochemistry at C(25).
JOURNAL	:	Helvetica Chimica Acta
VOL	:	64 PAGE : 2138-2141 (1981)

[TOP]

[0087]

AUTHOR	:	Tanaka, Y., Schnoes, H. K., Smith, C. M., and DeLuca, H. F.
TITLE	:	1,25,26-trihydroxyvitamin D3: isolation, identification, and biological activity PubMed ID:6895295
JOURNAL	:	Arch Biochem Biophys.
VOL	:	210 PAGE : 104-109 (1981)

[TOP]

[0088]

AUTHOR	:	Holick, M. F., Schnoes, H. K., DeLuca, H. F., Gray, R. W., Boyle, I. T., and Suda, T.
TITLE	:	Isolation and identification of 24,25-dihydroxycholecalciferol, a metabolite of vitamin D made in the kidney PubMed ID:4342902
JOURNAL	:	Biochemistry.
VOL	:	11 PAGE : 4251-4255 (1972)

[TOP]

[0089]

AUTHOR	:	Tanaka, Y., DeLuca, H. F., Ikekawa, N., Morisaki, M., and Koizumi, N.
TITLE	:	Determination of stereochemical configuration of the 24-hydroxyl group of 24,25-dihydroxyvitamin D3 and its biological importance PubMed ID:1190783
JOURNAL	:	Arch Biochem Biophys.
VOL	:	170 PAGE : 620-626 (1975)

[TOP]

[0090]

AUTHOR	:	Takayama, H.; Ohmori, M.; Yamada, S.
TITLE	:	Facile, Stereoselective Synthesis of (24R)-24,25-Dihydroxyvitamin D₃ Using D-Glyceric Acid as A Chiral Synthon.
JOURNAL	:	Tetrahedron Lett.
VOL	:	21 PAGE : 5027-5028 (1980)

[TOP]

[0091]

AUTHOR	:	Lam, H. Y., Schnoes, H. K., DeLuca, H. F., and Chen, T. C.
TITLE	:	24,25-Dihydroxyvitamin D3. Synthesis and biological activity PubMed ID:4761971
JOURNAL	:	Biochemistry.
VOL	:	12 PAGE : 4851-4855 (1973)

[TOP]

[0092]

AUTHOR	:	Yamada, S., Ino, E., Takayama, H., Horiuchi, N., Shinki, T., Suda, T., Jones, G., and DeLuca, H. F.
TITLE	:	Differences in the side-chain metabolism of vitamin D3 between chickens and rats PubMed ID:2999764
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	82 PAGE : 7485-7489 (1985)

[TOP]

[0093]

AUTHOR	:	Boyle, I. T., Omdahl, J. L., Gray, R. W., and DeLuca, H. F.
TITLE	:	The biological activity and metabolism of 24,25-dihydroxyvitamin D 3 PubMed ID:4711602
JOURNAL	:	J Biol Chem.
VOL	:	248 PAGE : 4174-4180 (1973)

[TOP]

[0094]

AUTHOR	:	Holick, M. F., Baxter, L. A., Schraufrogel, P. K., Tavela, T. E., and DeLuca, H. F.
TITLE	:	Metabolism and biologica PubMed ID:1245479
JOURNAL	:	J Biol Chem.
VOL	:	251 PAGE : 397-402 (1976)

[TOP]

[0095]

AUTHOR	:	Seki, M.; Koizumi, N.; Morisaki, M.; Ikekawa, N.
TITLE	:	Synthesis of Active Forms of Vitamin D : Synthesis of (24R)- and (24S)-24,25-Dihydroxyvitamin D₃.
JOURNAL	:	Tetrahedron Lett.
VOL	:	1 PAGE : 15-18 (1975)

[TOP]

[0096]

AUTHOR	:	Takasaki, Y., Suda, T., Yamada, S., Takayama, H., and Nishii, Y.
TITLE	:	Isolation, identification, and biological activity of 25-hydroxy-24-oxovitamin D3: a new metabolite of vitamin D3 generated by in vitro incubations with kidney homogenates PubMed ID:7225351
JOURNAL	:	Biochemistry.
VOL	:	20 PAGE : 1681-1686 (1981)

[TOP]

[0097]

AUTHOR	:	Takasaki, Y., Suda, T., Yamada, S., Ohmori, M., Takayama, H., and Nishii, Y.
TITLE	:	Chemical synthesis, biological activity, and metabolism of 25-hydroxy-24-oxovitamin D3 PubMed ID:7061507
JOURNAL	:	J Biol Chem.
VOL	:	257 PAGE : 3732-3738 (1982)

[TOP]

[0098]

AUTHOR	:	Jones, G., Kung, M., and Kano, K.
TITLE	:	The isolation and identification of two new metabolites of 25-hydroxyvitamin D3 produced in the kidney PubMed ID:6630213
JOURNAL	:	J Biol Chem.
VOL	:	258 PAGE : 12920-12928 (1983)

[TOP]

[0099]

AUTHOR	:	Horst, R. L., Reinhardt, T. A., Pramanik, B. C., and Napoli, J. L.
TITLE	:	23-Keto-25-hydroxyvitamin D3: a vitamin D3 metabolite with high affinity for the 1,25-dihydroxyvitamin D specific cytosol receptor PubMed ID:6297543
JOURNAL	:	Biochemistry.
VOL	:	22 PAGE : 245-250 (1983)

[TOP]

[0100]

AUTHOR	:	Wichmann, J. K., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	23,24,25-Trihydroxyvitamin D3, 24,25,26-trihydroxyvitamin D3, 24-keto-25-hydroxyvitamin D3, and 23-dehydro-25-hydroxyvitamin D3: new in vivo metabolites of vitamin D3 PubMed ID:6275880
JOURNAL	:	Biochemistry.
VOL	:	20 PAGE : 7385-7391 (1981)

[TOP]

[0101]

AUTHOR	:	Takasaki, Y., Horiuchi, N., Takahashi, N., Abe, E., Shinki, T., Suda, T., Yamada, S., Takayama, H., Horikawa, H., Masumura, T., et al.
TITLE	:	Isolation and identificaton of 25-hydroxy-24-oxocholecalciferol: a metabolite of 25-hydroxycholecalciferol PubMed ID:7417247
JOURNAL	:	Biochem Biophys Res Commun.
VOL	:	95 PAGE : 177-181 (1980)

[TOP]

[0102]

AUTHOR	:	Yamada, S., Ohmori, M., Takayama, H., Takasaki, Y., and Suda, T.
TITLE	:	Isolation and identification of 1 alpha- and 23-hydroxylated metabolites of 25-hydroxy-24-oxovitamin D3 from in vitro incubates of chick kidney homogenates PubMed ID:6848514
JOURNAL	:	J Biol Chem.
VOL	:	258 PAGE : 457-463 (1983)

[TOP]

[0103]

AUTHOR	:	Yamada, S.; Yamamoto, K.; Ino, E.; Sakaida, K.; Takayama, H.; Shinki, T.; Suda, T.; Iitaka, Y.; Itai, A.
TITLE	:	Synthesis and Determination of the Stereochemistry of 23,25-Dihydroxy-24-oxovitamin D₃, a Major Metabolite of 24(R),25-Dihydroxyvitamin D₃.
JOURNAL	:	Biochemistry
VOL	:	28 PAGE : 4551-4556 (1989)

[TOP]

[0104]

AUTHOR	:	Mayer, E., Reddy, G. S., Chandraratna, R. A., Okamura, W. H., Kruse, J. R., Popjak, G., Bishop, J. E., and Norman, A. W.
TITLE	:	23,25-Dihydroxy-24-oxovitamin D3: a metabolite of vitamin D3 made in the kidney PubMed ID:6849888
JOURNAL	:	Biochemistry.
VOL	:	22 PAGE : 1798-1805 (1983)

[TOP]

[0105]

AUTHOR	:	Jones, G., Kano, K., Yamada, S., Furusawa, T., Takayama, H., and Suda, T.
TITLE	:	Identification of 24,25,26,27-tetranor-23-hydroxyvitamin D3 as a product of the renal metabolism of 24,25-dihydroxyvitamin D3 PubMed ID:6332645
JOURNAL	:	Biochemistry.
VOL	:	23 PAGE : 3749-3754 (1984)

[TOP]

[0106]

AUTHOR	:	Shimoyamada, A., Tomiyama, S., Shimizu, M., Yamamoto, K., Kunii, S., and Yamada, S.
TITLE	:	In vivo metabolism of 24R,25-dihydroxyvitamin D3: structure of its major bile metabolite PubMed ID:9219897
JOURNAL	:	Biochim Biophys Acta.
VOL	:	1346 PAGE : 147-157 (1997)

[TOP]

[0107]

AUTHOR	:	Tanaka, Y., Wichmann, J. K., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Isolation and identification of 23,25-dihydroxyvitamin D3, an in vivo metabolite of vitamin D3 PubMed ID:6268149
JOURNAL	:	Biochemistry.
VOL	:	20 PAGE : 3875-3879 (1981)

[TOP]

[0108]

AUTHOR	:	Ikewada, N.; Eguchi, T.; Hirano, Y.; Tanaka, Y.; DeLuca, H. F.; Itai, A.; Iitaka, Y.
TITLE	:	Synthesis and Determination of the Configuration of 23,25-Dihydroxyvitamin D₃ ; a New Metabolite of Vitamin D₃ ; X-Ray Crystal Structure of a 3,23,25-Triol Precursor.
JOURNAL	:	J. Chem. Soc. Chem. Comm.
VOL	:	PAGE : 1157-1159 (1981)

[TOP]

[0109]

AUTHOR	:	Tanaka, Y., DeLuca, H. F., Schnoes, H. K., Ikekawa, N., and Eguchi, T.
TITLE	:	23,25-Dihydroxyvitamin D3: a natural precursor in the biosynthesis of 25-hydroxyvitamin D3-26,23-lactone PubMed ID:6975475
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	78 PAGE : 4805-4808 (1981)

[TOP]

[0110]

AUTHOR	:	Napoli, J. L., and Horst, R. L.
TITLE	:	23, 25, 26-trihydroxycholecalciferol. A 25-hydroxycholecalciferol-26,23-lactone precursor PubMed ID:7126191
JOURNAL	:	Biochem J.
VOL	:	206 PAGE : 173-176 (1982)

[TOP]

[0111]

AUTHOR	:	Wichmann, J. K., DeLuca, H. F., Schnoes, H. K., Horst, R. L., Shepard, R. M., and Jorgensen, N. A.
TITLE	:	25-Hydroxyvitamin D3 26,23-lactone: a new in vivo metabolite of vitamin D PubMed ID:228698
JOURNAL	:	Biochemistry.
VOL	:	18 PAGE : 4775-4780 (1979)

[TOP]

[0112]

AUTHOR	:	Ishizuka, S., Ishimoto, S., and Norman, A. W.
TITLE	:	Biological activity assessment of 25-hydroxyvitamin D3-26,23-lactone in the rat PubMed ID:6896189
JOURNAL	:	FEBS Lett.
VOL	:	139 PAGE : 267-270 (1982)

[TOP]

[0113]

AUTHOR	:	Yamada, S.; Nakayama, K.; Takayama, H.
TITLE	:	Stereoselective Synthesis and Structure Proof of a Metabolite of Vitamin D₃, (23S,25R)-25-Hydroxyvitamin D₃ 26,23-Lactone (Calcidiol Lactone).
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	29 PAGE : 2393-2396 (1981)

[TOP]

[0114]

AUTHOR	:	Eguchi, T.; Takatsuto, S.; Ishiguro, M.; Ikekawa, N.; Tanaka, Y.; DeLuca, H. F.
TITLE	:	Synthesis and determination of configuration of natural 25-hydroxyvitamin D₃ 26,23-lactone.
JOURNAL	:	Proc. Natl. Acad. Sci. U.S.A.
VOL	:	78 PAGE : 6579-6583 (1981)

[TOP]

[0115]

AUTHOR	:	Wichmann, J. K.; Porn, H. E.; Fivizzani, M. A.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Synthesis of 25-Hydroxyvitamin D₃-26,23-Lactone.
JOURNAL	:	Tetrahedron Lett.
VOL	:	21 PAGE : 4667-4670 (1980)

[TOP]

[0116]

AUTHOR	:	Morris, D. S.; Williams, D. H.; Norris, A. F.
TITLE	:	Structure and Synthesis of 25-Hydroxycholecalciferol-26,23-lactone, a Metabolite of Vitamin D₃.
JOURNAL	:	J. Chem. Soc. Chem. Comm.
VOL	:	122 PAGE : 424-425 (1981)

[TOP]

[0117]

AUTHOR	:	Morris, D. S.; Williams, D. H.; Norris, A. F.
TITLE	:	Structure and Synthesis of 25-Hydroxycholecalciferol-26,23-lactone, a Metabolite of Vitamin D.
JOURNAL	:	J. Org. Chem.
VOL	:	46 PAGE : 3422-3428 (1981)

[TOP]

[0118]

AUTHOR	:	DeLuca, H. F.; Schnoes, H. K.; (1979) Vitamin D, Basic Research and its Clinical Application. Recent Developments in The Metabolism of Vitamin D., pp445-458, Walter de Gruyter & Co., Berlin New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0119]

AUTHOR	:	Horst, R. L., Reinhardt, T. A., and Williams, D. H.
TITLE	:	Stereochemistry of naturally-occurring 25-hydroxyvitamin D3-26,23 lactone as determined by radioligand binding analysis and high-performance liquid chromatography PubMed ID:6293494
JOURNAL	:	Biochem Biophys Res Commun.
VOL	:	108 PAGE : 541-546 (1982)

[TOP]

[0120]

AUTHOR	:	Tanaka, Y., Wichmann, J. K., Paaren, H. E., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Role of kidney tissue in the production of 25-hydroxyvitamin D3-26,23-lactone and 1 alpha, 25-dihydroxyvitamin D3-26,23-lactone PubMed ID:6935655
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	77 PAGE : 6411-6414 (1980)

[TOP]

[0121]

AUTHOR	:	Wichmann, J. K.; Paaren, H. E.; Fivizzani, M. A.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Synthesis of 25-Hydroxyvitamin D₃-26,23-Lactone.
JOURNAL	:	Tetrshedron Lett.
VOL	:	21 PAGE : 4667-4670 (1980)

[TOP]

[0122]

AUTHOR	:	Nishizawa, M.; Yamagishi, T.; Nonaka, G.; Nishioka, I.
TITLE	:	Synthesis of (23R)-Calcidiol Lactone (25-Hydroxyvitamin D₃ 26,23-Lactone).
JOURNAL	:	Chem. Pham. Bull.
VOL	:	28 PAGE : 2852-2854 (1980)

[TOP]

[0123]

AUTHOR	:	Yamada, S.; Nakayama, K.; Takayama, H.
TITLE	:	Stereoselective Synthesis of (25S)-25-Hydroxyvitamin D₃ 26,23-Lactone.
JOURNAL	:	Tetrahedron Lett.
VOL	:	22 PAGE : 2591-2594 (1981)

[TOP]

[0124]

AUTHOR	:	Yamada, S., Nakayama, K., Takayama, H., Shinki, T., Takasaki, Y., and Suda, T.
TITLE	:	Isolation, identification, and metabolism of (23S,25R)-25-hydroxyvitamin D3 26,23-lactol. A biosynthetic precursor of (23S,25R)-25-hydroxyvitamin D3 26,23-lactone PubMed ID:6693401
JOURNAL	:	J Biol Chem.
VOL	:	259 PAGE : 884-889 (1984)

[TOP]

[0125]

AUTHOR	:	Yamada, S.; Nakayama, K.; Takayama, H.
TITLE	:	Stereoselective Synthesis of (23S,25R)-23,25,26-Trihydroxyvitamin D₃ 26,23-Lactol, Presumed Vitamin D₃ Metabolites.
JOURNAL	:	J. Org. Chem.
VOL	:	47 PAGE : 4770-4772 (1982)

[TOP]

[0126]

AUTHOR	:	DeLuca, H. F., Suda, T., Schnoes, H. K., Tanaka, Y., and Holick, M. F.
TITLE	:	25,26-dihydroxycholecalciferol, a metabolite of vitamin D3 with intestinal calcium transport activity PubMed ID:4319987
JOURNAL	:	Biochemistry.
VOL	:	9 PAGE : 4776-4780 (1970)

[TOP]

[0127]

AUTHOR	:	Ikekawa, N., Koizumi, N., Ohshima, E., Ishizuka, S., Takeshita, T., Tanaka, Y., and DeLuca, H. F.
TITLE	:	Natural 25,26-dihydroxyvitamin D3 is an epimeric mixture PubMed ID:6577424
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	80 PAGE : 5286-5288 (1983)

[TOP]

[0128]

AUTHOR	:	Lam, H. Y., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Synthesis and biological activity of 25xi,26-dihydroxycholecalciferol PubMed ID:1118866
JOURNAL	:	Steroids.
VOL	:	25 PAGE : 247-256 (1975)

[TOP]

[0129]

AUTHOR	:	Koizumi, N.; Iahiguro, M.; Yasuda, M.; Ikekawa, N.
TITLE	:	Stereoselective Introduction of Hydroxy Groups into the Cholesterol Side Chain. Preparation of (24R)- and (24S)-24,25-Dihydroxy- and (25R)- and (25S)-25,26-Dihydroxyvitamin D₃ by Asymmetric Synthesis.
JOURNAL	:	J. Chem. Soc. Perkin Trans I
VOL	:	PAGE : 1401-1410 (1983)

[TOP]

[0130]

AUTHOR	:	Redel, J., Bell, P. A., Bazely, N., Calando, Y., Delbarre, F., and Kodicek, E.
TITLE	:	The synthesis and biological activity of 25,26-dihydroxy-cholecalciferol, a polar metabolite of vitamin D3 PubMed ID:4371613
JOURNAL	:	Steroids.
VOL	:	24 PAGE : 463-476 (1974)

[TOP]

[0131]

AUTHOR	:	Partrige, J. J.; Shiuey, S-J.; Chadha, N. K.; Baggiolini, E. G.; Blount, J. F.; Uskokovic, M. R.
TITLE	:	Synthesis and Structure Proof of a Vitamin D₃ Metabolite, 25(S),26-Dihydroxycholecalciferol.
JOURNAL	:	J. Am. Chem. Soc.
VOL	:	103 PAGE : 1253-1255 (1981)

[TOP]

[0132]

AUTHOR	:	Barner, R.; Hubscher, J.; Daly, J. J.; Schonholzer, P.
TITLE	:	Zur Konfiguration des Vitamin D₃-Metaboliten 25,26-Dihydroxycholecalciferol : Synthese von (25S,26)-und (25R,26)-Dihydroxycholecalciferol.
JOURNAL	:	Helvetica Chimica Acta
VOL	:	64 PAGE : 915-938 (1981)

[TOP]

[0133]

AUTHOR	:	Wichmann, J., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Isolation of identification of 24(R)-hydroxyvitamin D3 from chicks give large doses of vitamin D3 PubMed ID:6263312
JOURNAL	:	Biochemistry.
VOL	:	20 PAGE : 2350-2353 (1981)

[TOP]

[0134]

AUTHOR	:	Tanaka, Y., DeLuca, H. F., Akaiwa, A., Morisaki, M., and Ikekawa, N.
TITLE	:	Synthesis of 24S and 24R-hydroxy-[24-3H]vitamin D3 and their metabolism in rachitic rats PubMed ID:1015836
JOURNAL	:	Arch Biochem Biophys.
VOL	:	177 PAGE : 615-621 (1976)

[TOP]

[0135]

AUTHOR	:	Ishizuka, S., Ishimoto, S., and Norman, A. W.
TITLE	:	Isolation and identification of 25-hydroxyvitamin D3-26,23-peroxylactone. A novel in vivo metabolite of vitamin D3 PubMed ID:6294074
JOURNAL	:	J Biol Chem.
VOL	:	257 PAGE : 14708-14713 (1982)

[TOP]

[0136]

AUTHOR	:	Yamada, S., Yamamoto, K., Takayama, H., Hayashi, T., Miyaura, C., Tanaka, H., Abe, E., and Suda, T.
TITLE	:	Isolation, identification, and chemical synthesis of 8 alpha,25-dihydroxy-9,10-seco-4,6,10(19)-cholestatrien-3-one. A new metabolite of 25-hydroxyvitamin D3 produced by mouse myeloid leukemia cells (M1) PubMed ID:3477540
JOURNAL	:	J Biol Chem.
VOL	:	262 PAGE : 12939-12944 (1987)

[TOP]

[0137]

AUTHOR	:	Hayashi, T., Yamada, S., Miyaura, C., Tanaka, H., Yamamoto, K., Abe, E., Takayama, H., and Suda, T.
TITLE	:	Phagocytic cells metabolize 25-hydroxyvitamin D3 to 10-oxo-19-nor-25-hydroxyvitamin D3 and a new metabolite, 8 alpha,25-dihydroxy-9,10-seco-4,6,10(19)-cholestatrien-3-one PubMed ID:3595867
JOURNAL	:	FEBS Lett.
VOL	:	218 PAGE : 200-204 (1987)

[TOP]

[0138]

AUTHOR	:	Thierry-Palmer, M., Richardson, K. A., Schnoes, H. K., Yamada, S., and Free, A. L.
TITLE	:	Identification of 8 alpha,25-dihydroxy-9,10-seco-4,6,10(19)-cholestatrien-3-one as a product of metabolism of 25-hydroxycholecalciferol by liver microsomes PubMed ID:2310195
JOURNAL	:	Arch Biochem Biophys.
VOL	:	277 PAGE : 277-282 (1990)

[TOP]

[0139]

AUTHOR	:	Inhoffen, H. H.; Quinkert, G.; Hess, H. J.; Erdnann, H. M.
TITLE	:	Studien in der Vitamin D-Reihe XVI.
JOURNAL	:	Chem. Ber.
VOL	:	89 PAGE : 2273-2284 (1956)

[TOP]

[0140]

AUTHOR	:	La Mar, G. N., and Budd, D. L.
TITLE	:	Elucidation of the solution conformation of the A ring in vitamin D using proton coupling constants and a shift reagent PubMed ID:4547774
JOURNAL	:	J Am Chem Soc.
VOL	:	96 PAGE : 7317-7324 (1974)

[TOP]

[0141]

AUTHOR	:	Verloop, A.; Koevoet, A. L.; Havinga, E.
TITLE	:	Studies on Vitamin D and Related Compound III.
JOURNAL	:	RECUEIL
VOL	:	74 PAGE : 1125-1130 (1955)

[TOP]

[0142]

AUTHOR	:	Inhoffen, H. H.; Bruckner, K.; Grundel, R.
TITLE	:	Studien in der Vitamin D-Reihe : Umlagerung des Vitamin D₂ zu einem iso-Tachysterin und Partialsynthese eines iso-Vitamin D₂.
JOURNAL	:	Chem. Ber.
VOL	:	87 PAGE : 1-13 (1954)

[TOP]

[0143]

AUTHOR	:	Kobayashi, T., Yoshimoto, S., and Yasumura, M.
TITLE	:	An improved procedure for the isolation of suprasterol2 I and II from a photochemical reaction mixture of ergocalciferol (vitamin D2) PubMed ID:303285
JOURNAL	:	J Nutr Sci Vitaminol (Tokyo).
VOL	:	23 PAGE : 291-298 (1977)

[TOP]

[0144]

AUTHOR	:	Saundersn, C. P.; Hodgkin, D. C.
TITLE	:	The Crystal Structure of Suprasterol II.
JOURNAL	:	Tetrahedron Lett.
VOL	:	16 PAGE : 573-578 (1961)

[TOP]

[0145]

AUTHOR	:	Werder, F. V. Z.
TITLE	:	Uber Dihydro-tachysterin.
JOURNAL	:	Physiol.
VOL	:	260 PAGE : 119-134 (1939)

[TOP]

[0146]

AUTHOR	:	Jones, G., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Isolation and identification of 1,25-dihydroxyvitamin D2 PubMed ID:1078978
JOURNAL	:	Biochemistry.
VOL	:	14 PAGE : 1250-1256 (1975)

[TOP]

[0147]

AUTHOR	:	Jones, G., Baxter, L. A., DeLuca, H. F., and Schnoes, H. K.
TITLE	:	Biological activity of 1,25-dihydroxyvitamin D2 in the chick PubMed ID:1252421
JOURNAL	:	Biochemistry.
VOL	:	15 PAGE : 713-716 (1976)

[TOP]

[0148]

AUTHOR	:	Sicinski, R. R.; Tanaka, Y.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Synthesis of 1a,25-Dihydroxyvitamin D₂, Its 24 Epimer and Related Isomers, and Their Binding Affinity for the 1,25-Dihydroxyvitamin D₃ Receptor.
JOURNAL	:	Bioorg. Chem.
VOL	:	13 PAGE : 158-169 (1985)

[TOP]

[0149]

AUTHOR	:	Jones, G.; Schnoes, H. K.; Levan, L.; DeLuca, H. F.
TITLE	:	Isolation and Identification of 24-Hydroxyvitamin D₂ and 24,25-Dihydroxyvitamin D₂. PubMed ID:6970013
JOURNAL	:	Arch Biochem. Biophys.
VOL	:	202 PAGE : 450-457 (1980)

[TOP]

[0150]

AUTHOR	:	Jones, G., Rosenthal, A., Segev, D., Mazur, Y., Frolow, F., Halfon, Y., Rabinovich, D., and Shakked, Z.
TITLE	:	Isolation and identification of 24,25-dihydroxyvitamin D2 using the perfused rat kidney PubMed ID:311655
JOURNAL	:	Biochemistry.
VOL	:	18 PAGE : 1094-1011 (1979)

[TOP]

[0151]

AUTHOR	:	Jones, G.; Rosenthal, A.; Segev, D.; Mazur, Y.; Frolow, F.; Halfon, Y.; Rabinovich, D.; Shakked, Z.
TITLE	:	24(R),25-Dihydroxyvitamin D₂ Synthesis, Determination of Absolute Configuration by X-Ray Analysis and Identification as a Kidney Metabolite of Vitamin D₂.
JOURNAL	:	Tetrahedron Lett.
VOL	:	2 PAGE : 177-180 (1979)

[TOP]

[0152]

AUTHOR	:	Katsumi, K.; Okano, T.; Kobayashi, T.; Miyata, O.; Naito, T.; Ninomiya, I.
TITLE	:	Synthesis of Diastereomeric 24,25-Dihydroxyvitamin D₂ and Separation of Its (24R)-and (24S)-Isomers.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	32 PAGE : 3744-3746 (1984)

[TOP]

[0153]

AUTHOR	:	Schering AG, Int. Pat. Appl. No. WO 94/00428
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0154]

AUTHOR	:	LeVan, L. W., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Isolation and identification of 25-hydroxyvitamin D2 25-glucuronide: a biliary metabolite of vitamin D2 in the chick PubMed ID:6970592
JOURNAL	:	Biochemistry.
VOL	:	20 PAGE : 222-226 (1981)

[TOP]

[0155]

AUTHOR	:	Reddy, G. S., and Tserng, K. Y.
TITLE	:	Isolation and identification of 1,24,25-trihydroxyvitamin D2, 1,24,25,28-tetrahydroxyvitamin D2, and 1,24,25,26-tetrahydroxyvitamin D2: new metabolites of 1,25-dihydroxyvitamin D2 produced in rat kidney PubMed ID:3490274
JOURNAL	:	Biochemistry.
VOL	:	25 PAGE : 5328-5336 (1986)

[TOP]

[0156]

AUTHOR	:	Horst, R. L., Reinhardt, T. A., Ramberg, C. F., Koszewski, N. J., and Napoli, J. L.
TITLE	:	24-Hydroxylation of 1,25-dihydroxyergocalciferol. An unambiguous deactivation process PubMed ID:3013880
JOURNAL	:	J Biol Chem.
VOL	:	261 PAGE : 9250-9256 (1986)

[TOP]

[0157]

AUTHOR	:	Koszewski, N. J., Reinhardt, T. A., Napoli, J. L., Beitz, D. C., and Horst, R. L.
TITLE	:	24,26-Dihydroxyvitamin D2: a unique physiological metabolite of vitamin D2 PubMed ID:3263145
JOURNAL	:	Biochemistry.
VOL	:	27 PAGE : 5785-5790 (1988)

[TOP]

[0158]

AUTHOR	:	Perlman, K., Kutner, A., Prahl, J., Smith, C., Inaba, M., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	24-homologated 1,25-dihydroxyvitamin D3 compounds: separation of calcium and cell differentiation activities PubMed ID:2322540
JOURNAL	:	Biochemistry.
VOL	:	29 PAGE : 190-196 (1990)

[TOP]

[0159]

AUTHOR	:	Moriarty, R. M.; Kim, J.; Penmasta, R.
TITLE	:	A Convenient Synthesis of 1a,25-Dihydroxy-28-norvitamin D₂.
JOURNAL	:	Tetrahedron Lett.
VOL	:	33 PAGE : 3741-3744 (1992)

[TOP]

[0160]

AUTHOR	:	Sai, H., Takatsuto, S., and Ikekawa, N.
TITLE	:	Synthesis and biological activity of 1 alpha-hydroxy-24,24-dimethyl-22E-dehydrovitamin D3 and 1 alpha, 25-dihydroxy-24,24-dimethyl-22E-dehydrovitamin D3 PubMed ID:3006936
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	33 PAGE : 4815-4820 (1985)

[TOP]

[0161]

AUTHOR	:	Schwarz, K.; Neef, G.; Kirsch, G.; Muller-Fahrnow, A.; Steinmeyer, A.
TITLE	:	Synthesis of 20-Fluorovitamin D Analogues.
JOURNAL	:	Tetrahedron
VOL	:	51 PAGE : 9543-9550 (1995)

[TOP]

[0162]

AUTHOR	:	Gill, H. S., Londowski, J. M., Corradino, R. A., and Kumar, R.
TITLE	:	The synthesis and biological activity of 22-fluorovitamin D3: a new vitamin D analog PubMed ID:2821660
JOURNAL	:	Steroids.
VOL	:	48 PAGE : 93-108 (1986)

[TOP]

[0163]

AUTHOR	:	Hirano, Y., Ikekawa, N., Tanaka, Y., and DeLuca, H. F.
TITLE	:	Synthesis of (22R)- and (22S)-22,25-Dihydroxyvitamin D3 and determination of their biological activity PubMed ID:7318035
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	29 PAGE : 2254-2260 (1981)

[TOP]

[0164]

AUTHOR	:	Okamura, W. H., Hammond, M. L., Rego, A., Norman, A. W., and Wing, R. M.
TITLE	:	Studies on vitamin D (calciferol) and its analogues. 12. Structural and synthetic studies of 5,6-trans-vitamin D3 and the stereoisomers of 10,19-dihydrovitamin D3 including dihydrotachysterol3 PubMed ID:195026
JOURNAL	:	J Org Chem.
VOL	:	42 PAGE : 2284-2291 (1977)

[TOP]

[0165]

AUTHOR	:	Berman, E., Luz, Z., Mazur, Y., and Sheves, M.
TITLE	:	Conformational analysis of vitamin D and analogues. 13C and 1H nuclear magnetic resonance study PubMed ID:198519
JOURNAL	:	J Org Chem.
VOL	:	42 PAGE : 3325-3330 (1977)

[TOP]

[0166]

AUTHOR	:	Barton, D. H., Hesse, R. H., Pechet, M. M., and Rizzardo, E.
TITLE	:	A convenient synthesis of 1 -hydroxy-vitamin D 3 PubMed ID:4348493
JOURNAL	:	J Am Chem Soc.
VOL	:	95 PAGE : 2748-2749 (1973)

[TOP]

[0167]

AUTHOR	:	Harrison, R. G., Lythgoe, B., and Wright, P. W.
TITLE	:	Calciferol and its relatives. (part)XVIII. Total synthesis of 1alpha-hydroxy vitamin D3 PubMed ID:4376813
JOURNAL	:	J Chem Soc [Perkin 1].
VOL	:	PAGE : 2654-2657 (1974)

[TOP]

[0168]

AUTHOR	:	Kaneko, C., Yamada, S., Sugimoto, A., Eguchi, Y., and Ishikawa, M.
TITLE	:	Synthesis and biological activity of 1alpha-hydroxyvitamin D3 PubMed ID:4813304
JOURNAL	:	Steroids.
VOL	:	23 PAGE : 75-92 (1974)

[TOP]

[0169]

AUTHOR	:	Kaneko, C.; Sugimoto, A.; Eguchi, Y.; Yamada, S.; Ishikawa, M.
TITLE	:	A New Synthetic Method of 1a-Hydroxy-7-dehydrocholecalciferol.
JOURNAL	:	Tetrahedron
VOL	:	30 PAGE : 2701-2705 (1974)

[TOP]

[0170]

AUTHOR	:	Guest, D.; W.; Williams, D. H.
TITLE	:	A Modified Synthesis of 1a-Hydroxyvitamin D₃.
JOURNAL	:	J. Chem. Soc. Perkin I
VOL	:	PAGE : 1695-1697 (1979)

[TOP]

[0171]

AUTHOR	:	Paaren, H. E., Hamer, D. E., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Direct C-1 hydroxylation of vitamin D compounds: convenient preparation of 1alpha-hydroxyvitamin D3, 1alpha, 25-dihydroxyvitamin D3, and 1alpha-hydroxyvitamin D2 PubMed ID:209448
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	75 PAGE : 2080-2081 (1978)

[TOP]

[0172]

AUTHOR	:	Holick, M. F., Semmler, E. J., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	1 -Hydroxy derivative of vitamin D 3: a highly potent analog of 1,25-dihydroxyvitamin D 3 PubMed ID:4348463
JOURNAL	:	Science.
VOL	:	180 PAGE : 190-191 (1973)

[TOP]

[0173]

AUTHOR	:	Lam, H. Y., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	1alpha-Hydroxyvitamin D2: a potent synthetic analog of vitamin D2 PubMed ID:4549739
JOURNAL	:	Science.
VOL	:	186 PAGE : 1038-1040 (1974)

[TOP]

[0174]

AUTHOR	:	Lam, H. Y., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Synthesis of 1alpha-hydroxyergocalciferol PubMed ID:306145
JOURNAL	:	Steroids.
VOL	:	30 PAGE : 671-677 (1977)

[TOP]

[0175]

AUTHOR	:	Parren, H. E.; Mellon, W. S.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Ring A-Stereoisomers of 1-Hydroxyvitamin D₃ and Their Relative Binding Affinities for the Intestinal 1a,25-Dihydroxyvitamin D₃ Receptor Protein.
JOURNAL	:	Bioorg. Chem.
VOL	:	13 PAGE : 62-75 (1985)

[TOP]

[0176]

AUTHOR	:	Parren, H. E.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Synthesis of 1b-Hydroxyvitamin D₃ and 1b,25-Dihydroxyvitamin D₃.
JOURNAL	:	J. Chem. Soc. Chem. Comm.
VOL	:	PAGE : 890-892 (1977)

[TOP]

[0177]

AUTHOR	:	Okamura, W. H.; Pirio, M. R.
TITLE	:	Studies on Vitamin D (Calciferol) and Its Analogs. IX. 1$alpha-Hydroxy-3-epivitamin D₃ : Its Synthesis and Conformational Analysis.
JOURNAL	:	Tetrahedron Lett.
VOL	:	49 PAGE : 4317-4320 (1975)

[TOP]

[0178]

AUTHOR	:	Sheves, M., Friedman, N., and Mazur, Y.
TITLE	:	Conformational equilibria in vitamin D. Synthesis of 1beta-hydroxyvitamin D3 PubMed ID:915580
JOURNAL	:	J Org Chem.
VOL	:	42 PAGE : 3597-3599 (1977)

[TOP]

[0179]

AUTHOR	:	Lam, H. Y., Onisko, B. L., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Synthesis and biological activity of 3-deoxy-1alpha-hydroxyvitamin D3 PubMed ID:4370422
JOURNAL	:	Biochem Biophys Res Commun.
VOL	:	59 PAGE : 845-849 (1974)

[TOP]

[0180]

AUTHOR	:	Okamura, W. H., Mitra, M. N., Pirio, M. R., Mourino, A., Carey, S. C., and Norman, A. W.
TITLE	:	Studies on vitamin D (calciferol) and its analogues. 13. 3-Deoxy-3alpha-methyl-1alpha-hydroxyvitamin D3, 3-deoxy-3alpha-methyl-1alpha,25-dihydroxyvitamin D3, and 1alpha-hydroxy-3-epivitamin D3. Analogues with conformationally biased a rings PubMed ID:632961
JOURNAL	:	J Org Chem.
VOL	:	43 PAGE : 574-580 (1978)

[TOP]

[0181]

AUTHOR	:	Ishida, H.; Shimizu, M.; Yamamoto, K.; Iwasaki, Y.; Yamada, S.; Yamaguchi, K.
TITLE	:	Synthesis of 1-Alkyl-1,25-dihydroxyvitamin D₃.
JOURNAL	:	J. Org. Chem.
VOL	:	60 PAGE : 1828-1833 (1995)

[TOP]

[0182]

AUTHOR	:	Muralidharan, K. R.; de Lera, A. R.; Isaeff, S. D.; Norman, A. W.; Okamura, W. H.
TITLE	:	Studies on the A-Ring Diastereomers of 1a,25-Dihydroxyvitamin D₃.
JOURNAL	:	J. Org. Chem.
VOL	:	58 PAGE : 1895-1899 (1993)

[TOP]

[0183]

AUTHOR	:	Norman, A. W., Bouillon, R., Farach-Carson, M. C., Bishop, J. E., Zhou, L. X., Nemere, I., Zhao, J., Muralidharan, K. R., and Okamura, W. H.
TITLE	:	Demonstration that 1 beta,25-dihydroxyvitamin D3 is an antagonist of the nongenomic but not genomic biological responses and biological profile of the three A-ring diastereomers of 1 alpha,25-dihydroxyvitamin D3 PubMed ID:8397195
JOURNAL	:	J Biol Chem.
VOL	:	268 PAGE : 20022-20030 (1993)

[TOP]

[0184]

AUTHOR	:	Haussler, M. R.
TITLE	:	Vitamin D receptors: nature and function PubMed ID:3015172
JOURNAL	:	Annu Rev Nutr.
VOL	:	6 PAGE : 527-562 (1986)

[TOP]

[0185]

AUTHOR	:	Morrison, N. A., Qi, J. C., Tokita, A., Kelly, P. J., Crofts, L., Nguyen, T. V., Sambrook, P. N., and Eisman, J. A.
TITLE	:	Prediction of bone density from vitamin D receptor alleles PubMed ID:8161378
JOURNAL	:	Nature.
VOL	:	367 PAGE : 284-287 (1994)

[TOP]

[0186]

AUTHOR	:	Suwinska, K.; Kutner, A.
TITLE	:	Crystal and Molecular Structure of 1,25-Dihydroxycholecalciferol.
JOURNAL	:	Acta Cryst.
VOL	:	52 PAGE : 550-554 (1996)

[TOP]

[0187]

AUTHOR	:	Hogness, T. R.; Sidwell, A. E. Jr.; Zscheile, F. P. Jr.
TITLE	:	The Absorption Spectra of Compounds Related to The Sterols.
JOURNAL	:	J. Biol. Chem.
VOL	:	120 PAGE : 239-257 (1937)

[TOP]

[0188]

AUTHOR	:	Koch, E. M.; Koch, F. C.
TITLE	:	Provitamin D Potency of Some Sterol Derivatives.
JOURNAL	:	J. Biol. Chem.
VOL	:	116 PAGE : 757-769 (1936)

[TOP]

[0189]

AUTHOR	:	Bills, C. E.; Honeywell, E. M.
TITLE	:	Antiricketic Substances. VIII. Studies on Highly Purified Ergosterol and Its esters.
JOURNAL	:	J. Biol. Chem.
VOL	:	80 PAGE : 15-23 (1928)

[TOP]

[0190]

AUTHOR	:	Windaus, A.; Bock, F.
TITLE	:	Uber das Provitamin aus dem Sterin der Schweineschwarte.
JOURNAL	:	Z. Physiol. Chem.
VOL	:	245 PAGE : 168-170 (1937)

[TOP]

[0191]

AUTHOR	:	Shiuey, S. J.; Partridge, J. J.; Uskokovic, M. R.
TITLE	:	Triply Convergent Synthesis of 1a,25-Dihydroxy-24(R)-fluorocholecalciferol.
JOURNAL	:	J. Org. Chem.
VOL	:	53 PAGE : 1040-1046 (1988)

[TOP]

[0192]

AUTHOR	:	Kutner, A.; Perlman, K. L.; Lago, A.; Sicinski, R. R.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Novel Convergent Synthesis of Side-Chain-Modified Analogues of 1a,25-Dihydroxycholecalciferol and 1a,25-Dihydroxyergocalciferol.
JOURNAL	:	J. Org. Chem.
VOL	:	53 PAGE : 3450-3457 (1988)

[TOP]

[0193]

AUTHOR	:	Katsumi, K., Okano, T., Ono, Y., Maegaki, E., Nishimura, K., Baba, M., Kobayashi, T., Miyata, O., Naito, T., and Ninomiya, I.
TITLE	:	Syntheses of 24,25-dihydroxyvitamin D2, 24,25-dihydroxy-22-dehydrovitamin D3, 25-hydroxy-24-oxo-22-dehydrovitamin D3 and 22,24,25-trihydroxyvitamin D3 PubMed ID:3496978
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	35 PAGE : 970-979 (1987)

[TOP]

[0194]

AUTHOR	:	Sai, H.; Takatsuto, S.; Ikekawa, N.; Tanaka, Y.; Smith, C.; DeLuca, H. F.
TITLE	:	Synthesis and Biological Activity of (22E,24R)- and (22E,24S)-1a,24-Dihydroxy-22-dehydrovitamin D₃. PubMed ID:6529792
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	32 PAGE : 3866-3872 (1984)

[TOP]

[0195]

AUTHOR	:	Sestelo, J. P.; Mascarenas, J. L.; Castedo, L.; Mourino, A.
TITLE	:	Ultrasonically Induced Conjugate Addition of Iodides to Electron-Deficient Olefins and Its Application to the Synthesis of Side-Chain Analogs of the Hormone 1a,25-Dihydroxyvitamin D₃.
JOURNAL	:	J. Org. Chem.
VOL	:	58 PAGE : 118-123 (1993)

[TOP]

[0196]

AUTHOR	:	Sai, H., Takatsuto, S., Ikekawa, N., Tanaka, Y., and DeLuca, H. F.
TITLE	:	Synthesis of some side-chain homologues of 1 alpha,25-dihydroxyvitamin D3 and investigation of their biological activities PubMed ID:3829179
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	34 PAGE : 4508-4515 (1986)

[TOP]

[0197]

AUTHOR	:	Taguchi, T.; Namba, R.; Nakazawa, M.; Nakajima, M.; Nakama, Y.; Kobayashi, Y.; Hara, N.; Ikekawa, N.
TITLE	:	Preparation of Fluorine-Modified 25-Hydroxyvitamin D₂ : 28,28,28-Trifluoro-, 26,26,26,27,27,27-Hexafluoro- and 28-Nor-26,26,26,27,27,27-Hexafluoro-25-Hydroxyvitamin D₂.
JOURNAL	:	Tetrahedron Lett.
VOL	:	29 PAGE : 227-230 (1988)

[TOP]

[0198]

AUTHOR	:	Sai, H., Takatsuto, S., Hara, N., and Ikekawa, N.
TITLE	:	Synthesis of 1 alpha,25-dihydroxy-26,27-dimethylvitamin D3, a highly active analogue of 1 alpha,25-dihydroxyvitamin D3 PubMed ID:3839441
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	33 PAGE : 878-881 (1985)

[TOP]

[0199]

AUTHOR	:	Kobayashi, Y.; Taguchi, T.; Terada, T.; Oshida, J.; Morisaki, M.; Ikekawa, N.
TITLE	:	Studies on Organic Fluorine Compounds. Part 37. Studies on Steroids. Part 78. Synthesis of 24,24-Difluoro- and 24x-Fluoro-25-hydroxyvitamin D₃.
JOURNAL	:	J. Chem. Soc. Perkin I
VOL	:	PAGE : 85-91 (1982)

[TOP]

[0200]

AUTHOR	:	Kobayashi, Y.; Taguchi, T.; Kanuma, N.; Ikekawa, N.; Oshida, J.
TITLE	:	Synthesis of 26,26,26,27,27,27-Hexafluoro-25-hydroxyvitamin D₃.
JOURNAL	:	J. Chem. Soc. Chem. Comm.
VOL	:	PAGE : 459-460 (1980)

[TOP]

[0201]

AUTHOR	:	Kobayashi, Y.; Taguchi, T.; Kanuma, N.; Ikekawa, N.; Oshida, J.
TITLE	:	Synthesis of 26,26,26-Trifluoro-25-Hydroxy and 27-Nor-26,26,26-Trifluoro-25-Hydroxyvitamin D₃.
JOURNAL	:	Tetrahedron Lett.
VOL	:	22 PAGE : 4309-4312 (1981)

[TOP]

[0202]

AUTHOR	:	Taguchi, T.; Mitsuhashi, S.; Yamanouchi, A.; Kobayashi, Y.; Sai, H.; Ikekawa, N.
TITLE	:	Synthesis of 23,23-Difluoro-25-Hydroxyvitamin D₃.
JOURNAL	:	Tetrahedron Lett.
VOL	:	25 PAGE : 4933-4936 (1984)

[TOP]

[0203]

AUTHOR	:	Kubodera, N., Watanabe, H., Kawanishi, T., and Matsumoto, M.
TITLE	:	Synthetic studies of vitamin D analogues. XI. Synthesis and differentiation-inducing activity of 1 alpha,25-dihydroxy-22-oxavitamin D3 analogues PubMed ID:1327561
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	40 PAGE : 1494-1499 (1992)

[TOP]

[0204]

AUTHOR	:	Kobayashi, N., Asano, T., Kitahori, J., Shimada, K., Kubodera, N., and Watanabe, H.
TITLE	:	Production and specificity of anti-22-oxacalcitriol antisera PubMed ID:1394671
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	40 PAGE : 1520-1522 (1992)

[TOP]

[0205]

AUTHOR	:	Kubodera, N.; Watanabe, H.; Miyamoto, K.; Matsumoto, M.
TITLE	:	Synthesis and Differentiation-Inducing Activity of 1a,24-Dihydroxy-22-oxavitamin D₃ Analogues.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	3 PAGE : 1869-1872 (1993)

[TOP]

[0206]

AUTHOR	:	Kubodera, N., Watanabe, H., Miyamoto, K., Matsumoto, M., Matsuoka, S., and Kawanishi, T.
TITLE	:	Synthetic studies of vitamin D analogues. XVII. Synthesis and differentiation-inducing activity of 1 alpha,24-dihydroxy-22-oxavitamin D3 analogues and their 20(R)-epimers PubMed ID:8221979
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	41 PAGE : 1659-1663 (1993)

[TOP]

[0207]

AUTHOR	:	Kubodera, N.; Miyamoto, K.; Ochi, K.; Matsunaga, I.
TITLE	:	Synthetic Studies of Vitamin D Analogues. VII. Synthesis of 20-oxa-21-norvitamin D₃ analogues.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	34 PAGE : 2286-2289 (1986)

[TOP]

[0208]

AUTHOR	:	Murayama, E., Miyamoto, K., Kubodera, N., Mori, T., and Matsunaga, I.
TITLE	:	Synthetic studies of vitamin D3 analogues. VIII. Synthesis of 22-oxavitamin D3 analogues PubMed ID:3829173
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	34 PAGE : 4410-4413 (1986)

[TOP]

[0209]

AUTHOR	:	Kubodera, N., Miyamoto, K., Matsumoto, M., Kawanishi, T., Ohkawa, H., and Mori, T.
TITLE	:	Synthetic studies of vitamin D analogues. X. Synthesis and biological activities of 1 alpha,25-dihydroxy-21-norvitamin D3 PubMed ID:1319286
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	40 PAGE : 648-651 (1992)

[TOP]

[0210]

AUTHOR	:	Kubodera, N., Miyamoto, K., Akiyama, M., Matsumoto, M., and Mori, T.
TITLE	:	Synthetic studies of vitamin D analogues. IX. Synthesis and differentiation-inducing activity of 1 alpha,25-dihydroxy-23-oxa-, thia-, and azavitamin D3 PubMed ID:1814615
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	39 PAGE : 3221-3224 (1991)

[TOP]

[0211]

AUTHOR	:	Murayama, E.; Miyamoto, K.; Ochi, K.; Kubodera, N.
TITLE	:	Synthesis and Immunoregulating Activity of Vitamin D Analogues Bearing Pregnane Side Chain.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	2 PAGE : 1289-1292 (1992)

[TOP]

[0212]

AUTHOR	:	Kubodera, N.; Watanabe, H.; Hatakeyama, S.; Tazumi, K.; Takano S.
TITLE	:	Synthesis of Postulated Metabolites of 1a,25-Dihydroxy-22-oxavitamin D₃.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	4 PAGE : 753-756 (1994)

[TOP]

[0213]

AUTHOR	:	Watanabe, H., Hatakeyama, S., Tazumi, K., Takano, S., Masuda, S., Okano, T., Kobayashi, T., and Kubodera, N.
TITLE	:	Synthetic studies of vitamin D analogs. XXII. Synthesis and antiproliferation activity of putative metabolites of 1 alpha, 25-dihydroxy-22-oxavitamin D3 PubMed ID:8996858
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	44 PAGE : 2280-2286 (1996)

[TOP]

[0214]

AUTHOR	:	Ono, Y.; Watanabe, H.; Kawase, A.; Kubodera, N.; Okano, T.; Tsugawa, N.; Kobayashi, T.; Hatakeyama, S.
TITLE	:	Synthesis and Biological Character of 1b-Hydroxylated Vitamin D₃ Analogues.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	4 PAGE : 1523-1526 (1994)

[TOP]

[0215]

AUTHOR	:	Kawase, A.; Hirata, M.; Endo, K.; Kubodera, N.
TITLE	:	Synthesis of 1a,25-Dihydroxy-22-thiavitamin D₃ and Related Analogs.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	5 PAGE : 279-282 (1995)

[TOP]

[0216]

AUTHOR	:	Miyamoto, K., Murayama, E., Ochi, K., Watanabe, H., and Kubodera, N.
TITLE	:	Synthetic studies of vitamin D analogues. XIV. Synthesis and calcium regulating activity of vitamin D3 analogues bearing a hydroxyalkoxy group at the 2 beta-position PubMed ID:8396500
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	41 PAGE : 1111-1113 (1993)

[TOP]

[0217]

AUTHOR	:	Ono, Y., Watanabe, H., Shiraishi, A., Takeda, S., Higuchi, Y., Sato, K., Tsugawa, N., Okano, T., Kobayashi, T., and Kubodera, N.
TITLE	:	Synthetic studies of vitamin D analogs. XXIV. Synthesis of active vitamin D3 analogs substituted at the 2 beta-position and their preventive effects on bone mineral loss in ovariectomized rats PubMed ID:9353890
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	45 PAGE : 1626-1630 (1997)

[TOP]

[0218]

AUTHOR	:	Watanabe, H.; Akiyama, M.; Kawanishi, T.; Kubodera, N.
TITLE	:	Synthesis of tritiated 1a,25-dihydroxy-22-oxavitamin D₃.
JOURNAL	:	J. Labelled Compd. Radiopharm.
VOL	:	36 PAGE : 645-654 (1994)

[TOP]

[0219]

AUTHOR	:	Watanabe, H., Kawanishi, T., Miyamoto, K., Kubodera, N., Sasahara, K., and Ochi, K.
TITLE	:	Novel procedure for the preparation of 1 alpha,3 beta-dihydroxy-2 beta-tritiated steroidal compounds PubMed ID:1455462
JOURNAL	:	Steroids.
VOL	:	57 PAGE : 444-446 (1992)

[TOP]

[0220]

AUTHOR	:	Steinmeyer, A., Neef, G., Kirsch, G., Schwarz, K., Rach, P., Haberey, M., and Thieroff-Ekerdt, R.
TITLE	:	Synthesis and biological activities of 8(14)a-homocalcitriol PubMed ID:1333655
JOURNAL	:	Steroids.
VOL	:	57 PAGE : 447-452 (1992)

[TOP]

[0221]

AUTHOR	:	Wecksler, W. R., and Norman, A. W.
TITLE	:	Studies on the mode of action of calciferol XXV. 1 alpha,25-dihydroxy-5,6-trans-vitamin D3, the 5E-isomer of 1 alpha,25-dihydroxyvitamin D3 PubMed ID:6246662
JOURNAL	:	Steroids.
VOL	:	35 PAGE : 419-425 (1980)

[TOP]

[0222]

AUTHOR	:	Bouillon, R., Sarandeses, L. A., Allewaert, K., Zhao, J., Mascarenas, J. L., Mourino, A., Vrielynck, S., de Clercq, P., and Vandewalle, M.
TITLE	:	Biologic activity of dihydroxylated 19-nor-(pre)vitamin D3 PubMed ID:8213251
JOURNAL	:	J Bone Miner Res.
VOL	:	8 PAGE : 1009-1015 (1993)

[TOP]

[0223]

AUTHOR	:	Posner, G. H., Nelson, T. D., Guyton, K. Z., and Kensler, T. W.
TITLE	:	New vitamin D3 derivatives with unexpected antiproliferative activity: 1-(hydroxymethyl)-25-hydroxyvitamin D3 homologs PubMed ID:1324319
JOURNAL	:	J Med Chem.
VOL	:	35 PAGE : 3280-3287 (1992)

[TOP]

[0224]

AUTHOR	:	Bouillon, R., Allewaert, K., van Leeuwen, J. P., Tan, B. K., Xiang, D. Z., De Clercq, P., Vandewalle, M., Pols, H. A., Bos, M. P., Van Baelen, H., et al.
TITLE	:	Structure function analysis of vitamin D analogs with C-ring modifications PubMed ID:1310680
JOURNAL	:	J Biol Chem.
VOL	:	267 PAGE : 3044-3051 (1992)

[TOP]

[0225]

AUTHOR	:	Okamura, W. H.; Aurrecoechea, J. M.; Gibbs, R. A.; Norman, A. W.
TITLE	:	Synthesis and Biological Activity of 9,11-Dehydrovitamin D₃ Analogues : Stereoselective Preparation of 6b-Vitamin D Vinylallenes and a Concise Enynol Synthesis for Preparing the A-Ring.
JOURNAL	:	J. Org. Chem.
VOL	:	54 PAGE : 4072-4083 (1989)

[TOP]

[0226]

AUTHOR	:	Norman, A. W., Okamura, W. H., Farach-Carson, M. C., Allewaert, K., Branisteanu, D., Nemere, I., Muralidharan, K. R., and Bouillon, R.
TITLE	:	Structure-function studies of 1,25-dihydroxyvitamin D3 and the vitamin D endocrine system. 1,25-dihydroxy-pentadeuterio-previtamin D3 (as a 6-s-cis analog) stimulates nongenomic but not genomic biological responses PubMed ID:8390978
JOURNAL	:	J Biol Chem.
VOL	:	268 PAGE : 13811-13819 (1993)

[TOP]

[0227]

AUTHOR	:	Kobayashi, T.; Okano, T.; Tsugawa, N.; Murano, M.; Masuda, S.; Takeuchi, A.; Sato, K.; Nishii, Y.
TITLE	:	2b-(3-Hydroxypropoxy)-1a,25-dihydroxyvitamin D₃ (ED-71), Preventive and Therapeutic Effects on Bone Mineral Loss in Ovbariectomized Rats.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	3 PAGE : 1815-1819 (1993)

[TOP]

[0228]

AUTHOR	:	Ostrem, V. K., Lau, W. F., Lee, S. H., Perlman, K., Prahl, J., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Induction of monocytic differentiation of HL-60 cells by 1,25-dihydroxyvitamin D analogs PubMed ID:3477545
JOURNAL	:	J Biol Chem.
VOL	:	262 PAGE : 14164-14171 (1987)

[TOP]

[0229]

AUTHOR	:	Napoli, J. L., Fivizzani, M. A., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	1 alpha-hydroxy-25-fluorovitamin D3: a potent analogue of 1 alpha,25-dihydroxyvitamin D3 PubMed ID:678516
JOURNAL	:	Biochemistry.
VOL	:	17 PAGE : 2387-2392 (1978)

[TOP]

[0230]

AUTHOR	:	Sarandeses, L. A.; Mascarenas, J. L.; Castedo, L.; Mourino, A.
TITLE	:	Synthesis of 1a,25-Dihydroxy-19-norprevitamin D₃.
JOURNAL	:	Tetrahedron Lett.
VOL	:	33 PAGE : 5445-5448 (1992)

[TOP]

[0231]

AUTHOR	:	Curtin, M. L.; Okamura, W. H.
TITLE	:	1a,25-Dihydroxyprevitamin D₃ : Synthesis of the 9,14,19,19,19-Pentadeuterio Derivative and a Kinetic Study of Its [1,7]-Sigmatropic Shift to 1a,25-Dihydroxyvitamin D₃.
JOURNAL	:	J. Amer. Chem. Soc.
VOL	:	113 PAGE : 6958-6966 (1991)

[TOP]

[0232]

AUTHOR	:	Morzycki, J. W.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Synthesis of 25-Hydroxyvitamin D₂ and Its 24-Epimer.
JOURNAL	:	J. Org. Chem.
VOL	:	49 PAGE : 2148-2151 (1984)

[TOP]

[0233]

AUTHOR	:	U.S.Pat., 3,006,932., (1961), Green. et al.
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0234]

AUTHOR	:	Tanaka, Y., Sicinski, R. R., DeLuca, H. F., Sai, H., and Ikekawa, N.
TITLE	:	Unique rearrangement of ergocalciferol side chain in vitro: production of a biologically highly active homologue of 1,25-dihydroxyvitamin D3 PubMed ID:3022793
JOURNAL	:	Biochemistry.
VOL	:	25 PAGE : 5512-5518 (1986)

[TOP]

[0235]

AUTHOR	:	Napoli, J. L., Mellon, W. S., Fivizzani, M. A., Schnoes, H. K., and DeLuca, H. F.
TITLE	:	Direct chemical synthesis of 1 alpha,25-dihydroxy[26,27-3H]vitamin D3 with high specific activity: its use in receptor studies PubMed ID:6892993
JOURNAL	:	Biochemistry.
VOL	:	19 PAGE : 2515-2521 (1980)

[TOP]

[0236]

AUTHOR	:	Maynard, D. F.; Norman, A. W.; Okamura, W. H.
TITLE	:	18-Substituted Derivative of Vitamin D : 18-Acetoxy-1a,25-dihydroxyvitamin D₃ and Related Analogues.
JOURNAL	:	J. Org. Chem.
VOL	:	57 PAGE : 3214-3217 (1992)

[TOP]

[0237]

AUTHOR	:	Chen, T. C.; Persons, K.; Uskokovic, M. R.; Horst, R. L.; Holick, M. F.
TITLE	:	An Evaluation of 1,25-Dihydroxyvitamin D₃ and analogues on the proliferation and differentiation of cultured human keratinocytes, calcium metabolism and the differentiation of human HL-60 cells.
JOURNAL	:	J. Nutr. Biochem.
VOL	:	4 PAGE : 49-57 (1993)

[TOP]

[0238]

AUTHOR	:	Zhou, J. Y., Norman, A. W., Akashi, M., Chen, D. L., Uskokovic, M. R., Aurrecoechea, J. M., Dauben, W. G., Okamura, W. H., and Koeffler, H. P.
TITLE	:	Development of a novel 1,25(OH)2-vitamin D3 analog with potent ability to induce HL-60 cell differentiation without modulating calcium metabolism PubMed ID:1648977
JOURNAL	:	Blood.
VOL	:	78 PAGE : 75-82 (1991)

[TOP]

[0239]

AUTHOR	:	Norman, A. W., Zhou, J. Y., Henry, H. L., Uskokovic, M. R., and Koeffler, H. P.
TITLE	:	Structure-function studies on analogues of 1 alpha,25-dihydroxyvitamin D3: differential effects on leukemic cell growth, differentiation, and intestinal calcium absorption PubMed ID:2208153
JOURNAL	:	Cancer Res.
VOL	:	50 PAGE : 6857-6864 (1990)

[TOP]

[0240]

AUTHOR	:	Allewaert, K., Zhao, X. Y., Zhao, J., Glibert, F., Branisteanu, D., De Clercq, P., Vandewalle, M., and Bouillon, R.
TITLE	:	Biological evaluation of epoxy analogs of 1 alpha,25-dihydroxyvitamin D3 PubMed ID:8539786
JOURNAL	:	Steroids.
VOL	:	60 PAGE : 324-332 (1995)

[TOP]

[0241]

AUTHOR	:	Sai, H.; Takatsuto, S.; Ikekawa, N.; Tanaka, Y.; Smith, C.; DeLuca, H. F.
TITLE	:	Synthesis and Biological Activity of (22E, 24R)- and (22E,24S)-1a,24-Dihydroxy-22-dehydrovitamin D₃. PubMed ID:6529792
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	32 PAGE : 3866-3872 (1984)

[TOP]

[0242]

AUTHOR	:	Ishizuka, S., Sumitani, K., Hiura, K., Kawata, T., Okawa, M., Hakeda, Y., and Kumegawa, M.
TITLE	:	Biological activity assessment of 1 alpha,25-dihydroxyvitamin D3-26,23-lactone and its intermediate metabolites in vivo and in vitro PubMed ID:2373050
JOURNAL	:	Endocrinology.
VOL	:	127 PAGE : 695-701 (1990)

[TOP]

[0243]

AUTHOR	:	Zhao, X-y.; De Clercq, P.; Vandewalle, M.; Allewaert, K.; Van Baelen, H.; Bouillon, R.
TITLE	:	Synthesis and Biological Evaluation of some 25,26-epoxy-1a,24-dihydroxyvitamin D₃ Analogues.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	3 PAGE : 1863-1867 (1993)

[TOP]

[0244]

AUTHOR	:	Sicinski, R. R.; DeLuca, H. F.; Schnoes, H. K.; Tanaka, Y.; Smith, C. M.
TITLE	:	D²²-Unsaturated Analogs of Vitamin D₃ and Their C(1)-Hydroxylated Derivatives.
JOURNAL	:	Bioorg. Chem.
VOL	:	15 PAGE : 152-166 (1987)

[TOP]

[0245]

AUTHOR	:	Ikekawa, N., Eguchi, T., Hara, N., Takatsuto, S., Honda, A., Mori, Y., and Otomo, S.
TITLE	:	26,27-Diethyl-1 alpha,25-dihydroxyvitamin D3 and 24,24-difluoro-24-homo-1 alpha,25-dihydroxyvitamin D3: highly potent inducer for differentiation of human leukemia cells HL-60 PubMed ID:3435961
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	35 PAGE : 4362-4365 (1987)

[TOP]

[0246]

AUTHOR	:	Harada, M., Miyahara, T., Miyata, M., Komiyama, H., Sugure, A., Ikemoto, Y., Kondo, S., Takamura, T., Higuchi, S., Otomo, S., et al.
TITLE	:	Calcium regulating activity of 24a-homo-24,24-difluoro-1 alpha,25-dihydroxyvitamin D3 and 26,27-dimethyl-24,24-difluoro-1 alpha,25-dihydroxyvitamin D3 PubMed ID:8287319
JOURNAL	:	Calcif Tissue Int.
VOL	:	53 PAGE : 318-323 (1993)

[TOP]

[0247]

AUTHOR	:	Inaba, M., Okuno, S., Nishizawa, Y., Yukioka, K., Otani, S., Matsui-Yuasa, I., Morisawa, S., DeLuca, H. F., and Morii, H.
TITLE	:	Biological activity of fluorinated vitamin D analogs at C-26 and C-27 on human promyelocytic leukemia cells, HL-60 PubMed ID:2823715
JOURNAL	:	Arch Biochem Biophys.
VOL	:	258 PAGE : 421-425 (1987)

[TOP]

[0248]

AUTHOR	:	Morimoto, S., and Kumahara, Y.
TITLE	:	A patient with psoriasis cured by 1 alpha-hydroxyvitamin D3 PubMed ID:4069059
JOURNAL	:	Med J Osaka Univ.
VOL	:	35 PAGE : 51-54 (1985)

[TOP]

[0249]

AUTHOR	:	Hayashi, T.; Ojima, K.; Konno, K.; Manaka, A.; Yamaguchi, K.; Yamada, S.; Takayama, H.
TITLE	:	A New Synthesis of 24-Fluoro-1a,25-dihydroxyvitamin D₂ and its 24-Epimer, and Determination of the C-24 Configuration.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	40 PAGE : 2932-2936 (1992)

[TOP]

[0250]

AUTHOR	:	Imae, Y., Manaka, A., Yoshida, N., Ishimi, Y., Shinki, T., Abe, E., Suda, T., Konno, K., Takayama, H., and Yamada, S.
TITLE	:	Biological activities of 24-fluoro-1 alpha,25-dihydroxyvitamin D-2 and its 24-epimer PubMed ID:8049243
JOURNAL	:	Biochim Biophys Acta.
VOL	:	1213 PAGE : 302-308 (1994)

[TOP]

[0251]

AUTHOR	:	Kondo, F.; Maki, S.; Konno, K.; Takayama, H.
TITLE	:	The First Synthesis of 24,24-Difluoro-1a-hydroxyvitamin D₃ by Means of Radical Deoxygenation of Alcohols.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	44 PAGE : 62-66 (1996)

[TOP]

[0252]

AUTHOR	:	Yamada, S.; Ohmori, M.; Takayama, H.
TITLE	:	Synthesis of 24,24-Difluoro-1a,25-dihydroxyvitamin D₃.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	27 PAGE : 3196-3198 (1979)

[TOP]

[0253]

AUTHOR	:	Kabakoff, B. D., Kendrick, N. C., Faber, D., Deluca, H. F., Yamada, S., and Takayama, H.
TITLE	:	Determination of biological activity of 24,24-difluoro-1,25-dihydroxyvitamin D3 in the chick using a new method for assessing intestinal calcium uptake PubMed ID:6896415
JOURNAL	:	Arch Biochem Biophys.
VOL	:	215 PAGE : 582-588 (1982)

[TOP]

[0254]

AUTHOR	:	Shiina, Y., Abe, E., Miyaura, C., Tanaka, H., Yamada, S., Ohmori, M., Nakayama, K., Takayama, H., Matsunaga, I., Nishii, Y., et al.
TITLE	:	Biological activity of 24,24-difluoro-1 alpha, 25-dihydroxyvitamin D3 and 1 alpha, 25-dihydroxyvitamin D3-26,23-lactone in inducing differentiation of human myeloid leukemia cells PubMed ID:6572492
JOURNAL	:	Arch Biochem Biophys.
VOL	:	220 PAGE : 90-94 (1983)

[TOP]

[0255]

AUTHOR	:	Koeffler, H. P., Amatruda, T., Ikekawa, N., Kobayashi, Y., and DeLuca, H. F.
TITLE	:	Induction of macrophage differentiation of human normal and leukemic myeloid stem cells by 1,25-dihydroxyvitamin D3 and its fluorinated analogues PubMed ID:6594194
JOURNAL	:	Cancer Res.
VOL	:	44 PAGE : 5624-5628 (1984)

[TOP]

[0256]

AUTHOR	:	Goff, J. P., Horst, R. L., Littledike, E. T., Boris, A., and Uskokovic, M. R.
TITLE	:	Bone resorption, renal function and mineral status in cows treated with 1,25-dihydroxycholecalciferol and its 24-fluoro analogues PubMed ID:3761006
JOURNAL	:	J Nutr.
VOL	:	116 PAGE : 1500-1510 (1986)

[TOP]

[0257]

AUTHOR	:	Ando, K.; Kondo, F.; Koike, F.; Takayama, H.
TITLE	:	An Improved Synthesis of 24,24-Difluoro-1a,25-dihydroxyvitamin D₃ from Vitamin D₂.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	40 PAGE : 1662-1664 (1992)

[TOP]

[0258]

AUTHOR	:	Ando, K.; Koike, F.; Kondo, F.; Takayama, H.
TITLE	:	An Improved Synthesis of 24,24-Difluoro-1a,25-dihydroxyvitamin D₃ from Readily Available Vitamin D₂.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	43 PAGE : 189-192 (1995)

[TOP]

[0259]

AUTHOR	:	Konno, K., Ojima, K., Hayashi, T., Tanabe, M., and Takayama, H.
TITLE	:	Synthesis and biological activity of a 1 alpha,25-dihydroxyvitamin D2 analog bearing an amide group in the side-chain PubMed ID:9023979
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	45 PAGE : 185-188 (1997)

[TOP]

[0260]

AUTHOR	:	Konno, K.; Maki, S.; Fujishima, T.; Liu, Z. P.; Miura, D.; Chokki, M.; Takayama, H.
TITLE	:	A Novel and Practical Route to A-ring Enyne Synthon for 1a,25-Dihydroxyvitamin D₃ Analogs : Synthesis of A-ring Diastereomers of 1a,25-Dihydroxyvitamin D₃ and 2-Methyl-1,25-Dihydroxyvitamin D₃.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	8 PAGE : 151-156 (1998)

[TOP]

[0261]

AUTHOR	:	Fujishima, T.; Liu, Z.; Miura, D.; Chokki, M.; Ishizuka, S.; Konno, K.; Takayama, H.
TITLE	:	Synthesis and Biological Activity of 2-Methyl-20-epi Analogues of 1a,25-Dihydroxyvitamin D₃.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	8 PAGE : 2145-2148 (1998)

[TOP]

[0262]

AUTHOR	:	Kabat, M. M.; Kiegiel, J.; Cohen, N.; Toth, K.; Wovkulich, P. M.; Uskokovic, M. R.
TITLE	:	Convergent Synthesis of Vitamin D₃ Metabolites. Control of the Stereoselectivity in Samarium-Induced Cyclopropanations of Cyclopentenes.
JOURNAL	:	J. Org. Chem.
VOL	:	61 PAGE : 118-124 (1996)

[TOP]

[0263]

AUTHOR	:	Suda, T., DeLuca, H. F., Schnoes, H. K., and Blunt, J. W.
TITLE	:	The isolation and identification of 25-hydroxyergocalciferol PubMed ID:5307049
JOURNAL	:	Biochemistry.
VOL	:	8 PAGE : 3515-3520 (1969)

[TOP]

[0264]

AUTHOR	:	Jones, G.; Schnoes, H. K.; Levan, L.; DeLuca, H. F.
TITLE	:	Isolation and Identification of 24-Hydroxyvitamin D₂ and 24,25-Dihydroxyvitamin D₂. PubMed ID:6970013
JOURNAL	:	Arch. Biochem. Biophys.
VOL	:	202 PAGE : 450-457 (1980)

[TOP]

[0265]

AUTHOR	:	Yamada, S.; Suzuki, T.; Takayama, H.
TITLE	:	Novel Regioselective C-6 and C-19 Alkylation of Vitamin D₃ via Its Sulfur-Dioxide Adducts.
JOURNAL	:	Tetrahedron Lett.
VOL	:	22 PAGE : 3085-3088 (1981)

[TOP]

[0266]

AUTHOR	:	Beckman, M. J., Tadikonda, P., Werner, E., Prahl, J., Yamada, S., and DeLuca, H. F.
TITLE	:	Human 25-hydroxyvitamin D3-24-hydroxylase, a multicatalytic enzyme PubMed ID:8679605
JOURNAL	:	Biochemistry.
VOL	:	35 PAGE : 8465-8472 (1996)

[TOP]

[0267]

AUTHOR	:	Yamada, S.; Takayama, H.
TITLE	:	Studies on The Adducts of Sulfur Dioxide with Vitamin D.
JOURNAL	:	Chem. Lett.
VOL	:	PAGE : 583-586 (1979)

[TOP]

[0268]

AUTHOR	:	Takahashi, T.; Yamamoto, R.
TITLE	:	1969, Studies on the Stability of Vitamin D₂ Powder Preparations. III. Structure of a New Isomer of Vitamin D₂. PubMed ID:5307139
JOURNAL	:	Yakugaku Zasshi
VOL	:	89 PAGE : 919-924 (1969)

[TOP]

[0269]

AUTHOR	:
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0270]

AUTHOR	:	Nagata, A.; Hamma, N.; Katsumata, T.; Sato, R.; Komuro, S.; Iba, K.; Yoshitake, A.; Kiriyama, T.; Okamoto, S.; Nagataki, S.; (1988) Vitamin D Molecular, Cellular and Clinical Endocrinology. Proceeding of the Vitamin D Rancho Mirage, California, USA April. Mechanism of Action of 26,27-Hexafluoro-1,25-(OH)₂D₃. (Norman, A. W.; Schaefer, K.; Grigoleit, H. G.; v. Herrath, D.; eds), pp141-142, Walter de Gruyter Berlin New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0271]

AUTHOR	:	Lee, N. E., Reddy, G. S., Brown, A. J., and Williard, P. G.
TITLE	:	Synthesis, stereochemistry, and biological activity of 1alpha,23,25-trihydroxy-24-oxovitamin D3, a major natural metabolite of 1alpha,25-dihydroxyvitamin D3 PubMed ID:9235987
JOURNAL	:	Biochemistry.
VOL	:	36 PAGE : 9429-9437 (1997)

[TOP]

[0272]

AUTHOR	:	Windaus, von A.; Linsert, O.; Luttringhaus, A.; Weidlich, G.
TITLE	:	Uber das krystallisierte Vitamin D₂.
JOURNAL	:	Ann.
VOL	:	492 PAGE : 226-241 (1932)

[TOP]

[0273]

AUTHOR	:	Chen, P. S., Jr., and Bosmann, H. B.
TITLE	:	Effect Of Vitamins D2 And D3 On Serum Calcium And Phosphorus In Rachitic Chicks PubMed ID:14171311
JOURNAL	:	J Nutr.
VOL	:	83 PAGE : 133-139 (1964)

[TOP]

[0274]

AUTHOR	:	Trinh-Toan.; Ryan, R. C.; Simon, G. L.; Calabrese, J. C.; Dahl, L. F.; DeLuca, H. F.
TITLE	:	Crystal Structure of 25-Hydroxy-vitamin D₃ Monohydrate : A Stereochemical Analysis of Vitamin D Molecules.
JOURNAL	:	J. Chem. Soc. Perkin Trans II
VOL	:	PAGE : 393-401 (1977)

[TOP]

[0275]

AUTHOR	:	Honda, A., Mori, Y., Otomo, S., Ishizuka, S., and Ikekawa, N.
TITLE	:	Effects of novel 26,27-dialkyl analogs of 1 alpha,25-dihydroxyvitamin D3 on differentiation-inducing activity of human promyelocytic leukemia (HL-60) cells in serum-supplemented or serum-free culture PubMed ID:1645892
JOURNAL	:	Steroids.
VOL	:	56 PAGE : 142-147 (1991)

[TOP]

[0276]

AUTHOR	:	Miyahara, T., Harada, M., Miyata, M., Sugure, A., Ikemoto, Y., Takamura, T., Higuchi, S., Otomo, S., Kozuka, H., and Ikekawa, N.
TITLE	:	Calcium regulating activity of 26,27-dialkyl analogs of 1 alpha,25-dihydroxyvitamin D3 PubMed ID:1330237
JOURNAL	:	Calcif Tissue Int.
VOL	:	51 PAGE : 218-222 (1992)

[TOP]

[0277]

AUTHOR	:	Eguchi, T., Sai, H., Takatsuto, S., Hara, N., and Ikekawa, N.
TITLE	:	Synthesis of 26,27-dialkyl analogues of 1 alpha,25-dihydroxyvitamin D3 PubMed ID:3240463
JOURNAL	:	Chem Pharm Bull (Tokyo).
VOL	:	36 PAGE : 2303-2311 (1988)

[TOP]

[0278]

AUTHOR	:	Binderup, L., Latini, S., Binderup, E., Bretting, C., Calverley, M., and Hansen, K.
TITLE	:	20-epi-vitamin D3 analogues: a novel class of potent regulators of cell growth and immune responses PubMed ID:1656990
JOURNAL	:	Biochem Pharmacol.
VOL	:	42 PAGE : 1569-1575 (1991)

[TOP]

[0279]

AUTHOR	:	Hansen, K.; Hansen, C. M.; (1994) Vitamin D A Pluripotent Steroid Hormone : Structural Studies, Molecular Endocrinology and Clinical Applications. Proceedings of the Ninth Workshop on Vitamin D Orlando, Florida (USA) May 28-June 2. Synthesis and Biological Activity of 20-Hydroxylated Vitamin D Analogues. (Norman, A. W.; Bouillon, R.; Thomasset, M.; eds), pp95-96, Walter de Gruyter Berlin New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0280]

AUTHOR	:	Ishizuka, S., Oshida, J., Tsuruta, H., and Norman, A. W.
TITLE	:	The stereochemical configuration of the natural 1 alpha,25-dihydroxyvitamin D3-26,23-lactone PubMed ID:2996437
JOURNAL	:	Arch Biochem Biophys.
VOL	:	242 PAGE : 82-89 (1985)

[TOP]

[0281]

AUTHOR	:	Lee, A. S.; Norman, A. W.; Okamura, W. H.
TITLE	:	3-Deoxy-3-thia-1a,25-dihydroxyvitamin D₃ and Its 1b-Epimer : Synthesis and Biological Evaluation.
JOURNAL	:	J. Org. Chem.
VOL	:	57 PAGE : 3846-3854 (1992)

[TOP]

[0282]

AUTHOR	:	Ishizuka, S., and Norman, A. W.
TITLE	:	The difference of biological activity among four diastereoisomers of 1 alpha,25-dihydroxycholecalciferol-26,23-lactone PubMed ID:3022075
JOURNAL	:	J Steroid Biochem.
VOL	:	25 PAGE : 505-510 (1986)

[TOP]

[0283]

AUTHOR	:	Dauben, W. G.; Ollmann, Jr. R. R.; Funhoff, A. S.; Leung, S. S.; Norman, A. W.; Bishop, J. E.
TITLE	:	25-Phosphorus Analogs of Vitamin D₃.
JOURNAL	:	Tetrahedron Lett.
VOL	:	32 PAGE : 4643-4646 (1991)

[TOP]

[0284]

AUTHOR	:	Calverley, M. J.; Binderup, E.; Binderup, L.; (1991) Gene Regulation, Structure-Function Analysis and Clinical Application. Proceedings of the Eighth Workshop on Vitamin D Paris, France July 5-10. The 20-Epi Modification in The Vitamin D Series : Selective Enhancement of 'Non-Classical' Receptpr-Mediated Effects. (Norman, A. W.; Bouillon, R.; Thomasset, M.; eds), pp163-164, Walter de Gruyter Berlin New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0285]

AUTHOR	:	Bretting, C.; Calverley, M. J.; Binderup, L.; (1991) Gene Regulation, Structure-Function Analysis and Clinical Application. Proceedings of the Eighth Workshop on Vitamin D Paris, France July 5-10. Synthesis and Biological Activity of 1a-Hydroxylated Vitamin D₃ Analogues with Hydroxylated Side Chains, Multi-Homologated in The 24- or 24,26,27-Positions. (Norman, A. W.; Bouillon, R.; Thomasset, M.; eds), pp159-160, Walter de Gruyter Berlin
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0286]

AUTHOR	:	Lythgoe, B.; Moran, T. A.; Nambudiry, M. E. N.; Tideswell, J.; Wright, P. W.
TITLE	:	Calciferol and its Relatives. Part 22. A Direct Total Synthesis of Vitamin D₂ and Vitamin D₃.
JOURNAL	:	J. C. S. Perkin I
VOL	:	PAGE : 590-595 (1978)

[TOP]

[0287]

AUTHOR	:	Kobayashi, Y.; Taguchi, T.; Mitsuhashi, S.; Eguchi, T.; Ohshima, E.; Ikekawa, N.
TITLE	:	Studies on Organic Fluorine Compounds. XXXIX. Studies on Steroids. LXXIX. Synthesis of 1a,25-Dihydroxy-26,26,26,27,27,27-hexafluoro vitamin D₃.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	30 PAGE : 4297-4303 (1982)

[TOP]

[0288]

AUTHOR	:	Binderup, E.; Calverley, M. J.; Binderup, L.; (1991) Gene Regulation, Structure-Function Analysis and Clinical Application. Proceedings of the Eighth Workshop on Vitamin D Paris, France July 5-10. Synthesis and Biological Activity of 1a-hydroxylated Vitamin D Analogues with Poly-unsaturated Side Chains. (Norman, A. W.; Bouillon, R.; Thomasset, M.; eds), pp192-193, Walter de Gruyter Berlin New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0289]

AUTHOR	:	Calverley, M. J.
TITLE	:	Synthesis of MC 903, A Biologically Active Vitamin D Metabolite Analogue.
JOURNAL	:	Tetrahedron
VOL	:	43 PAGE : 4609-4619 (1987)

[TOP]

[0290]

AUTHOR	:	Askew, F. A.; Bourdillon, R. B.; Bruce, H. M.; Callow, R. K.; Philpot, J. St. L.; Webster, T. A.
TITLE	:	Crystalline Vitamin D.
JOURNAL	:	Proc. Roy. Soc. (London)
VOL	:	109 PAGE : 488-506 (1932)

[TOP]

[0291]

AUTHOR	:	Wovkulich, P. M.; Barcelos, F.; Batcho, A. D.; Sereno, J. F.; Baggiolini, E. G.; Hennessy, B. M.; Uskokovic, M. R.
TITLE	:	Stereoselective Total Synthesis of 1a,25S,26-Trihydroxycholecalciferol.
JOURNAL	:	Tetrahedron
VOL	:	40 PAGE : 2283-2296 (1984)

[TOP]

[0292]

AUTHOR	:	Calverley, M. J.; Binderup, L.
TITLE	:	Synthesis and Biological Evaluation of MC 1357, A New 20-Epi-23-oxa-1a,25-dihydroxy-vitamin D₃ Analogue with Potent Non-Classical Effects.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	3 PAGE : 1845-1848 (1993)

[TOP]

[0293]

AUTHOR	:	Bretting, C.; Hansen, C. M.; Andersen, N. R.; (1994) Vitamin D A Pluripotent Steroid Hormone : Structural Studies, Molecular Endocrinology and Clinical Applications. Proceedings of the Ninth Workshop on Vitamin D Orlando, Florida (USA) May 28-June 2. Chemistry and Biology of 22,23-Yne Analogs of Calcitriol. (Norman, A. W.; Bouillon, R.; Thomasset, M.; eds), pp73-74, Walter de Gruyter Berlin New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0294]

AUTHOR	:	Wilhelm, F., Dauben, W. G., Kohler, B., Roesle, A., and Norman, A. W.
TITLE	:	6-Fluoro-vitamin D3: a new antagonist of the biological actions of vitamin D3 and its metabolites which interacts with the intestinal receptor for 1 alpha,25(OH)2-vitamin D3 PubMed ID:6087739
JOURNAL	:	Arch Biochem Biophys.
VOL	:	233 PAGE : 127-132 (1984)

[TOP]

[0295]

AUTHOR	:	Dauben, W. G.; Kohler, B.; Roesle, A.
TITLE	:	Synthesis of 6-Fluorovitamin D₃.
JOURNAL	:	J, Org, Chem.
VOL	:	50 PAGE : 2007-2010 (1985)

[TOP]

[0296]

AUTHOR	:	Paaren, H. E., Fivizzani, M. A., Schnoes, H. K., and De Luca, H. F.
TITLE	:	1 alpha, 25-difluorovitamin D3: an inert vitamin D analog PubMed ID:6271060
JOURNAL	:	Arch Biochem Biophys.
VOL	:	209 PAGE : 579-583 (1981)

[TOP]

[0297]

AUTHOR	:	Wovkulich, P. M.; Batcho, A. D.; Baggiolini, E. G.; Boris, A.; Truitt, G.; Uskokovic, M. R.; (1985) Vitamin D Chemical, Biochemical and Clinical Update. Proceedings of the Sixth Workshop on Vitamin D Merano, Italy, March. Synthesis of 1a,25S,26-Trihydroxy-D²²-cholecalciferol, A Potent Inducer of Cell Differentiation. (Norman, A. W.; Schaefer, K.; Grigoleit, H. G.; v. Herrath, D.;
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0298]

AUTHOR	:	Halkes, S. J.; Van Vliet, N. P.
TITLE	:	Investigations on Sterols. XXXV. Synthesis of 25-Hydroxycholecalciferol.
JOURNAL	:	Recueil
VOL	:	88 PAGE : 1080-1083 (1969)

[TOP]

[0299]

AUTHOR	:	Steinmeyer, A.; Haberey, M.; Kirsch, G.; Neef, G.; Schwarz, K.; Thieroff-Ekerdt, R.; Wiesinger, H.; (1994) Vitamin D A Pluripotent Steroid Hormone : Structural Studies, Molecular Endocrinology and Clinical Applications. Proceedings of the Ninth Workshop on Vitamin D Orlando, Florida (USA) May 28-June 2. Synthesis and Biological Activity of 23-Oxa Vitamin D Analogues. (Norman, A. W.; Bouillon, R.; Thomasset, M.; eds), pp93-94, Walter de Gruyter Berlin New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0300]

AUTHOR	:	Neef, G.; Steinmeyer, A.
TITLE	:	Synthesis of 23-Oxa-Calcitriol Derivatives.
JOURNAL	:	Tetrahedron Lett.
VOL	:	32 PAGE : 5073-5076 (1991)

[TOP]

[0301]

AUTHOR	:	Nakada, M., Tanaka, Y., DeLuca, H. F., Kobayashi, Y., and Ikekawa, N.
TITLE	:	Biological activities and binding properties of 23,23-difluoro-25-hydroxyvitamin D3 and its 1 alpha-hydroxy derivative PubMed ID:3839644
JOURNAL	:	Arch Biochem Biophys.
VOL	:	241 PAGE : 173-178 (1985)

[TOP]

[0302]

AUTHOR	:	Colston, K. W., Mackay, A. G., James, S. Y., Binderup, L., Chander, S., and Coombes, R. C.
TITLE	:	EB1089: a new vitamin D analogue that inhibits the growth of breast cancer cells in vivo and in vitro PubMed ID:1472092
JOURNAL	:	Biochem Pharmacol.
VOL	:	44 PAGE : 2273-2280 (1992)

[TOP]

[0303]

AUTHOR	:	Yamada, S.; Ohmori, M.; Takayama, H.
TITLE	:	Synthesis of 24,24-Difluoro-25-hydroxyvitamin D₃.
JOURNAL	:	Tetrahedron Lett.
VOL	:	21 PAGE : 1859-1862 (1979)

[TOP]

[0304]

AUTHOR	:	Perlman, K. L.; Darwish, H. M.; DeLuca, H. F.
TITLE	:	20-Oxopregnacalciferols : Vitamin D Compounds That Bind The Progesterone Receptor.
JOURNAL	:	Tetrahedron Lett.
VOL	:	35 PAGE : 2295-2298 (1994)

[TOP]

[0305]

AUTHOR	:	Tanaka, Y., Pahuja, D. N., Wichmann, J. K., De Luca, H. F., Kobayashi, Y., Taguchi, T., and Ikekawa, N.
TITLE	:	25-hydroxy-26, 26,26,27,27,27-hexafluorovitamin D3: biological activity in the rat PubMed ID:7149723
JOURNAL	:	Arch Biochem Biophys.
VOL	:	218 PAGE : 134-141 (1982)

[TOP]

[0306]

AUTHOR	:	Muralidharan, K. R., Rowland-Goldsmith, M., Lee, A. S., Park, G., Norman, A. W., Henry, H. L., and Okamura, W. H.
TITLE	:	Inhibitors of 25-hydroxyvitamin D3-1alpha-hydroxylase: thiavitamin D analogs and biological evaluation PubMed ID:9366500
JOURNAL	:	J Steroid Biochem Mol Biol.
VOL	:	62 PAGE : 73-78 (1997)

[TOP]

[0307]

AUTHOR	:	Hara, N., Eguchi, T., Ikekawa, N., Ishizuka, S., and Sato, J.
TITLE	:	Synthesis and biological activity of (22E,25R)- and (22,25S)-22-dehydro- 1 alpha,25-dihydroxy-26-methylvitamin D3 PubMed ID:2163469
JOURNAL	:	J Steroid Biochem.
VOL	:	35 PAGE : 655-664 (1990)

[TOP]

[0308]

AUTHOR	:	Koizumi, T., Nakao, Y., Ishizuka, S., Oshida, J., Hara, N., Ikekawa, N., and Fijita, T.
TITLE	:	Novel vitamin D3 derivatives, 26-homo-delta 22-dehydro-1 alpha,25(S)-dihydroxyvitamin D3 and 26-homo-delta 22-dehydro-1 alpha,25(R)-dihydroxyvitamin D3: preferential activity in c-myc mRNA production and in induction of phenotypic differentiation of HL-60 cells PubMed ID:2407190
JOURNAL	:	Arch Biochem Biophys.
VOL	:	276 PAGE : 310-316 (1990)

[TOP]

[0309]

AUTHOR	:	Binderup, L., and Bramm, E.
TITLE	:	Effects of a novel vitamin D analogue MC903 on cell proliferation and differentiation in vitro and on calcium metabolism in vivo PubMed ID:2830885
JOURNAL	:	Biochem Pharmacol.
VOL	:	37 PAGE : 889-895 (1988)

[TOP]

[0310]

AUTHOR	:	Okamura, W. H., Mitra, M. N., Procsal, D. A., and Norman, A. W.
TITLE	:	Studies on vitamin D and its analogs. VIII. 3-Deoxy-1alpha, 25-dihydroxyvitamin D3, a potent new analog of 1alpha, 25-(OH) 2-D3 PubMed ID:167766
JOURNAL	:	Biochem Biophys Res Commun.
VOL	:	65 PAGE : 24-30 (1975)

[TOP]

[0311]

AUTHOR	:	Gill, H. S., Londowski, J. M., Corradino, R., and Kumar, R.
TITLE	:	Synthesis, biologic activity, and protein binding characteristics of a new vitamin D analog, 22-hydroxyvitamin D3 PubMed ID:3041108
JOURNAL	:	J Steroid Biochem.
VOL	:	28 PAGE : 147-153 (1987)

[TOP]

[0312]

AUTHOR	:	Gill, H. S., Londowski, J. M., Corradino, R. A., Zinsmeister, A. R., and Kumar, R.
TITLE	:	The synthesis and biological activity of 25-hydroxy-26,27-dimethylvitamin D3 and 1,25-dihydroxy-26,27-dimethylvitamin D3: highly potent novel analogs of vitamin D3 PubMed ID:3404985
JOURNAL	:	J Steroid Biochem.
VOL	:	31 PAGE : 147-160 (1988)

[TOP]

[0313]

AUTHOR	:	Valles, M. J.; Castedo, L.; Mourino, A.
TITLE	:	Functionalization of Vitamin D Metabolites at C-18 and Application to The Synthesis of 1a,18,25-Trihydroxyvitamin D₃ and 18,25-Dihydroxyvitamin D₃.
JOURNAL	:	Tetrahedron Lett.
VOL	:	33 PAGE : 1503-1506 (1992)

[TOP]

[0314]

AUTHOR	:	Maynard, D. F., Trankle, W. G., Norman, A. W., and Okamura, W. H.
TITLE	:	14-epi stereoisomers of 25-hydroxy- and 1 alpha,25-dihydroxyvitamin D3: synthesis, isomerization to previtamins, and biological studies PubMed ID:8057286
JOURNAL	:	J Med Chem.
VOL	:	37 PAGE : 2387-2393 (1994)

[TOP]

[0315]

AUTHOR	:	Martinez-Perez, J. A.; Sarandeses, L.; Granja, J.; Palenzuela, J. A.; Mourino, A.
TITLE	:	Design and Synthesis of 1a,25-Dihydroxyvitamin D₃ Analogues with Fixed Torsion Angle C(16-17-20-22).
JOURNAL	:	Tetrahedron Lett.
VOL	:	39 PAGE : 4725-4728 (1998)

[TOP]

[0316]

AUTHOR	:	Sala, G. D.; Izzo, I.; De Riccardis, F.; Sodano, G.
TITLE	:	Synthesis of Calicoferol E and Astrogorgiadiol, Two Marine 9,10-Secosteroids.
JOURNAL	:	Tetrahedron Lett.
VOL	:	39 PAGE : 4741-4744 (1998)

[TOP]

[0317]

AUTHOR	:	Faulkner, D. J.
TITLE	:	Marine Natural Product.
JOURNAL	:	Nat. Prod. Rep.
VOL	:	14 PAGE : 259-302 (1997)

[TOP]

[0318]

AUTHOR	:	Ochi, M.; Yamada, K.; Kotsuki, H.; Shibata, K.
TITLE	:	Calicoferols A and B, Two Novel Secosterols Possessing Brine-Shrimp Lethality from the Gorgonian Calicogorgia sp.
JOURNAL	:	Chem. Lett.
VOL	:	PAGE : 427-430 (1991)

[TOP]

[0319]

AUTHOR	:	Fusetani, N.; Nagata, H.; Hirota, H.; Tsuyuki, T.
TITLE	:	Astrogorgiadiol and Astrogorgin, Inhibitors of Cell Division in Fertilized Starfish Eggs, from a Gorgonian Astrogorgia sp.
JOURNAL	:	Tetrahedron Lett.
VOL	:	30 PAGE : 7079-7082 (1989)

[TOP]

[0320]

AUTHOR	:	Seo, Y., Shin, J., and Song, J. I.
TITLE	:	New secosteroids from an undescribed gorgonian of the genus Muricella PubMed ID:7595595
JOURNAL	:	J Nat Prod.
VOL	:	58 PAGE : 1291-1295 (1995)

[TOP]

[0321]

AUTHOR	:	Calverley, M. J.; Grue-Sorensen, G.; Bretting, C.; Binderup, L.; (1994) Vitamin D A Pluripotent Steroid Hormone : Structural Studies, Molecular Endocrinology and Clinical Applications. Proceedings of the Ninth Workshop on Vitamin D Orlando, Florida (USA) May 28-June 2. Chemistry and Biology of Highly Active 22-Oxy Analogs of 20-Epi Calcitriol with very low Binding Affinity to the Vitaamin D Receptor. (Norman, A. W.; Bouillon, R.; Thomasset, M.; eds), pp85-86, Walter de Gruyter Berlin New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0322]

AUTHOR	:	Masuda, S., Strugnell, S., Calverley, M. J., Makin, H. L., Kremer, R., and Jones, G.
TITLE	:	In vitro metabolism of the anti-psoriatic vitamin D analog, calcipotriol, in two cultured human keratinocyte models PubMed ID:8106449
JOURNAL	:	J Biol Chem.
VOL	:	269 PAGE : 4794-4803 (1994)

[TOP]

[0323]

AUTHOR	:	Masuda, S., Byford, V., Kremer, R., Makin, H. L., Kubodera, N., Nishii, Y., Okazaki, A., Okano, T., Kobayashi, T., and Jones, G.
TITLE	:	In vitro metabolism of the vitamin D analog, 22-oxacalcitriol, using cultured osteosarcoma, hepatoma, and keratinocyte cell lines PubMed ID:8621502
JOURNAL	:	J Biol Chem.
VOL	:	271 PAGE : 8700-8708 (1996)

[TOP]

[0324]

AUTHOR	:	Dilworth, F. J., Calverley, M. J., Makin, H. L., and Jones, G.
TITLE	:	Increased biological activity of 20-epi-1,25-dihydroxyvitamin D3 is due to reduced catabolism and altered protein binding PubMed ID:8147918
JOURNAL	:	Biochem Pharmacol.
VOL	:	47 PAGE : 987-993 (1994)

[TOP]

[0325]

AUTHOR	:	Schonecker, B., Reichenbacher, M., Gliesing, S., Gonschior, M., Griebenow, S., Scheddin, D., and Mayer, H.
TITLE	:	Synthesis and biological activities of 2 alpha-chloro-1-epicalcitriol and 1-epicalcitriol PubMed ID:9437792
JOURNAL	:	Steroids.
VOL	:	63 PAGE : 28-36 (1998)

[TOP]

[0326]

AUTHOR	:	Shankar, V. N., Dilworth, F. J., Makin, H. L., Schroeder, N. J., Trafford, D. J., Kissmeyer, A. M., Calverley, M. J., Binderup, E., and Jones, G.
TITLE	:	Metabolism of the vitamin D analog EB1089 by cultured human cells: redirection of hydroxylation site to distal carbons of the side-chain PubMed ID:9113099
JOURNAL	:	Biochem Pharmacol.
VOL	:	53 PAGE : 783-793 (1997)

[TOP]

[0327]

AUTHOR	:	Kragballe, K., Gjertsen, B. T., De Hoop, D., Karlsmark, T., van de Kerkhof, P. C., Larko, O., Nieboer, C., Roed-Petersen, J., Strand, A., and Tikjob, G.
TITLE	:	Double-blind, right/left comparison of calcipotriol and betamethasone valerate in treatment of psoriasis vulgaris PubMed ID:1670840
JOURNAL	:	Lancet.
VOL	:	337 PAGE : 193-196 (1991)

[TOP]

[0328]

AUTHOR	:	Zhou, J. Y., Norman, A. W., Chen, D. L., Sun, G. W., Uskokovic, M., and Koeffler, H. P.
TITLE	:	1,25-Dihydroxy-16-ene-23-yne-vitamin D3 prolongs survival time of leukemic mice PubMed ID:2339131
JOURNAL	:	Proc Natl Acad Sci U S A.
VOL	:	87 PAGE : 3929-3932 (1990)

[TOP]

[0329]

AUTHOR	:	Uskokovic, M. R.; Baggiolini, E.; Batcho, A.; Shiuey, S. J.; Wovkulich, P.; Horst, R. L.; (1988) Vitamin D Molecular, Cellular and Clinical Endocrinology. Proceeding of the Vitamin D Rancho Mirage, California, USA April. Synthesis of 26,27-Hexadeutero and Epimeric 26-Trideutero 1,25-Dihydroxycholecalciferols. (Norman, A. W.; Schaefer, K.; Grigoleit, H. G.; v. Herrath, D.; eds), pp22-24, Walter de Gruyter Berlin New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0330]

AUTHOR	:	Barrack, S. A.; Gibbs, R. A.; Okamura, W. H.
TITLE	:	Potential Inhibitors of Vitamin D Metabolism : An Oxa Analogue of Vitamin D.
JOURNAL	:	J. Org. Chem.
VOL	:	53 PAGE : 1790-1796 (1988)

[TOP]

[0331]

AUTHOR	:	Yamada, S.; Suzuki, T.; Takayama, H.; Miyamoto, K.; Matsunaga, I.; Nawata, Y.
TITLE	:	Stereoselective Synthesis of (5E)- and (5Z)-Vitamin D₃ 19-Alkanoic Acids via Vitamin D₃-Sulfur Dioxide Adducts.
JOURNAL	:	J. Org. Chem.
VOL	:	48 PAGE : 3483-3488 (1983)

[TOP]

[0332]

AUTHOR	:	Yamada, S., Shimizu, M., Fukushima, K., Niimura, K., and Maeda, Y.
TITLE	:	Syntheses of 24R,25-dihydroxy-[6,19,19-3H]vitamin D3 and 24R,25-dihydroxy-[6,19,19-2H]vitamin D3 PubMed ID:2588294
JOURNAL	:	Steroids.
VOL	:	54 PAGE : 145-157 (1989)

[TOP]

[0333]

AUTHOR	:	Data in papers in preparation : Shimizu, M.; Iwasaki, Y.; Ohno, A.; Yamada, S.; Institute for Medical and Dental Engineering, Tokyo Medical and Dental University.
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0334]

AUTHOR	:	Shimizu, M.; Iwasaki, Y.; Ishida, H.; Yamada, S.
TITLE	:	Determination of 25-Hydroxyvitamin D₃ in Human Plasma Using a Non-radioactive Tetranorvitamin D Analogue as an Internal Standard. PubMed ID:8590938
JOURNAL	:	J. Chromat. B
VOL	:	672 PAGE : 63-71 (1995)

[TOP]

[0335]

AUTHOR	:	Yamada, S.; Nakayama, K.; Takayama, H.; Itai, A.; Iitaka, Y.
TITLE	:	Studies of Vitamin D Oxidation. 3. Dye-Sensitized Photooxidation of Vitamin D and Chemical Behavior of Vitamin D 6,19-Epidioxides.
JOURNAL	:	J. Org. Chem.
VOL	:	48 PAGE : 3477-3483 (1983)

[TOP]

[0336]

AUTHOR	:	Moriuchi, S., Tsuruki, F., Otawara, Y., Hosoya, N., Yamada, S., Nakayama, K., and Takayama, H.
TITLE	:	Biological activity of the endoperoxides derived from vitamin D derivatives by dye-sensitized photo-oxidation PubMed ID:232156
JOURNAL	:	J Nutr Sci Vitaminol (Tokyo).
VOL	:	25 PAGE : 455-458 (1979)

[TOP]

[0337]

AUTHOR	:	Yamada, S.; Nakayama, K.; Takayama, H.
TITLE	:	Synthesis of 6,19-Epidioxy-9,10-secoergosta-5(10),7,22-trien-3b-ols from Vitamin D Derivatives by Oxidation with singlet Oxygen.
JOURNAL	:	Tetrahedron Lett.
VOL	:	49 PAGE : 4895-4898 (1978)

[TOP]

[0338]

AUTHOR	:	Yamada, S.; Nakayama, K.; Takayama, H.; Itai, A.; Iitaka, Y.
TITLE	:	Structure of the Endoperoxides derived from Vitamin D Derivatives by Dye Sensitized Photo-oxidation : X-Ray Crystal Structure of 6,19-Epidioxy-9,10-seco-5(10),7,22-ergostatrien-3b-ol Benzoate.
JOURNAL	:	Chem. Pharm. Bull.
VOL	:	27 PAGE : 1949-1950 (1979)

[TOP]

[0339]

AUTHOR	:	Yamada, S., Yamamoto, K., Naito, H., Suzuki, T., Ohmori, M., Takayama, H., Shiina, Y., Miyaura, C., Tanaka, H., Abe, E., et al.
TITLE	:	Syntheses and differentiating action of vitamin D endoperoxides. Singlet oxygen adducts of vitamin D derivatives in human myeloid leukemia cells (HL-60) PubMed ID:2993611
JOURNAL	:	J Med Chem.
VOL	:	28 PAGE : 1148-1153 (1985)

[TOP]

[0340]

AUTHOR	:	Aberhart, D. J., and Chi-Tung Hsu, A.
TITLE	:	Studies on the adduct of 4-phenyl-1,2,4-triazoline-3,5-dione with vitamin D3 PubMed ID:180271
JOURNAL	:	J Org Chem.
VOL	:	41 PAGE : 2098-2102 (1976)

[TOP]

[0341]

AUTHOR	:	Reischl, W.; Zbiral, E.
TITLE	:	Strukturelle Abwandlung am Vitamin D₃ via 4-Phenyl-1,2,4-triazolin-3,5-dion-Addukte.
JOURNAL	:	Ann. Chem.
VOL	:	PAGE : 745-756 (1978)

[TOP]

[0342]

AUTHOR	:	Reischl, W.; Altmann, E.; Zbiral, E.
TITLE	:	Zur gezielten Oxidation der D7-Doppelbindung in den 4-Phenyl-1,2,4-triazolin-3,5-dion-Addekten des Vitamin D₃.
JOURNAL	:	Monatsh. Chem.
VOL	:	113 PAGE : 427-438 (1982)

[TOP]

[0343]

AUTHOR	:	Shimizu, M.; Yamazaki, T.; Yamada, S.
TITLE	:	Fluorescence-Labeling Reaction of Vitamin D Metabolites and Analogs with Fluorescent 1,2,4-Triazoline-3,5-dione (DMEQ-TAD).
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	3 PAGE : 1809-1814 (1993)

[TOP]

[0344]

AUTHOR	:	Shimizu, M., Kamachi, S., Nishii, Y., and Yamada, S.
TITLE	:	Synthesis of a reagent for fluorescence-labeling of vitamin D and its use in assaying vitamin D metabolites PubMed ID:1867383
JOURNAL	:	Anal Biochem.
VOL	:	194 PAGE : 77-81 (1991)

[TOP]

[0345]

AUTHOR	:	Shimizu, M.; Iwasaki, Y.; Ohno, A.; Yamada, S.; (1997) Vitamin D Chemistry, Biology and Clinical Applications of the Steroid Hormone. Proceedings of the Tenth Workshop on Vitamin D Strasbourg, France-May. Synthesis of Fluorovitamin D Analogs for Conformational Analysis of Ligand Bound to Vitamin D Receptor. (Norman, A. W.; Bouillon, R.; Thomasset, M.; eds), pp24-25, Printing and Reprographics University of California, Riverside
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0346]

AUTHOR	:	Iwasaki, Y.; Shimizu, M.; Hirosawa, T.; Yamada, S.
TITLE	:	Regioselective Synthesis of 19-Fluorovitamin D via Fluorination of Vitamin D-Sulfur Dioxide Adducts.
JOURNAL	:	Tetrahedron Lett.
VOL	:	37 PAGE : 6753-6754 (1996)

[TOP]

[0347]

AUTHOR	:	Perlman, K. L.; Sicinski, R. R.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	1a,25-Dihydroxy-19-nor-vitamin D₃, A Novel Vitamin D-Related Compound with Potential Therapeutic Activity.
JOURNAL	:	Tetrahedron Lett.
VOL	:	31 PAGE : 1823-1824 (1990)

[TOP]

[0348]

AUTHOR	:	Perlman, K. L.; DeLuca, H. F.
TITLE	:	1a-Hydroxy-19-nor-vitamin D C-22 Aldehyde. A Valuable Intermediate in the Synthesis of Side Chain Modified 1a,25-Dihydroxy-19-nor-vitamin D₃.
JOURNAL	:	Tetrahedron Lett.
VOL	:	33 PAGE : 2937-2940 (1992)

[TOP]

[0349]

AUTHOR	:	Slatopolsky, E.; Stoll, R.; DeLuca, H. F.
TITLE	:	Biological Activity of 19-Nor(19-Nor-1,25-(OH)₂D₂):A New Vitamin D Drug for Renal Osteodystrophy.
JOURNAL	:	?????
VOL	:	PAGE : 863-865 ()

[TOP]

[0350]

AUTHOR	:	Mikami, K.; Osaka, A.; Isaka, A.; Sawa, E.; Shimizu, M.; Terada, M.; Kubodera, N.; Nakagawa, K.; Tsugawa, N.; Okano, T.
TITLE	:	Symmetry in the Synthesis of the A-Ring of a Vitamin D Hybrid Analog with Significant Transactivation Activity: A Combinatorial Sequence of Regioselective Propiolate-Ene, Catalytic Enantioselective Epoxidation and Carbonyl-Ene Cyclization Reactions.
JOURNAL	:	Tetrahedron Lett.
VOL	:	39 PAGE : 3359-3362 (1998)

[TOP]

[0351]

AUTHOR	:	Campbell, M. J., Park, S., Uskokovic, M. R., Dawson, M. I., and Koeffler, H. P.
TITLE	:	Expression of retinoic acid receptor-beta sensitizes prostate cancer cells to growth inhibition mediated by combinations of retinoids and a 19-nor hexafluoride vitamin D3 analog PubMed ID:9528984
JOURNAL	:	Endocrinology.
VOL	:	139 PAGE : 1972-1980 (1998)

[TOP]

[0352]

AUTHOR	:	Fioravanti, L., Miodini, P., Cappelletti, V., and DiFronzo, G.
TITLE	:	Synthetic analogs of vitamin D3 have inhibitory effects on breast cancer cell lines PubMed ID:9673393
JOURNAL	:	Anticancer Res.
VOL	:	18 PAGE : 1703-1708 (1998)

[TOP]

[0353]

AUTHOR	:	Sicinski, R. R., Perlman, K. L., and DeLuca, H. F.
TITLE	:	Synthesis and biological activity of 2-hydroxy and 2-alkoxy analogs of 1 alpha,25-dihydroxy-19-norvitamin D3 PubMed ID:7966133
JOURNAL	:	J Med Chem.
VOL	:	37 PAGE : 3730-3738 (1994)

[TOP]

[0354]

AUTHOR	:	Okano, T., Nakagawa, K., Tsugawa, N., Ozono, K., Kubodera, N., Osawa, A., Terada, M., and Mikami, K.
TITLE	:	Singly dehydroxylated A-ring analogues of 19-nor-1alpha,25-dihydroxyvitamin D3 and 19-nor-22-oxa-1alpha,25-dihydroxyvitamin D3: novel vitamin D3 analogues with potent transcriptional activity but extremely low affinity for vitamin D receptor PubMed ID:9881643
JOURNAL	:	Biol Pharm Bull.
VOL	:	21 PAGE : 1300-1305 (1998)

[TOP]

[0355]

AUTHOR	:	Sicinski, R. R., Prahl, J. M., Smith, C. M., and DeLuca, H. F.
TITLE	:	New 1alpha,25-dihydroxy-19-norvitamin D3 compounds of high biological activity: synthesis and biological evaluation of 2-hydroxymethyl, 2-methyl, and 2-methylene analogues PubMed ID:9804706
JOURNAL	:	J Med Chem.
VOL	:	41 PAGE : 4662-4674 (1998)

[TOP]

[0356]

AUTHOR	:	Uskokovic, M. R.; Studzinski, G. P.; Gardner, J. P.; Reddy, S. G.; Campbell, M.. J.; and Koeffller H. P.
TITLE	:	The 16-Ene Vitamin D Analogs.
JOURNAL	:	Curr. Pharm. Design
VOL	:	3 PAGE : 99-123 (1997)

[TOP]

[0357]

AUTHOR	:	Baggiolini, E. G.; Iacobelli, J. A.; Hennessy, B. M.; Uskokovic, M. R.
TITLE	:	Stereoselective Total Synthesis of 1a,25-Dihydroxycholecalciferol.
JOURNAL	:	J. Am. Chem. Soc.
VOL	:	104 PAGE : 2945-2948 (1982)

[TOP]

[0358]

AUTHOR	:	Uskokovic, M. R.; Baggiolini, E.; Shiuey, S.-J.; Hennessy, B.; Kiegiel, J.; Daniewski, A. R.; Pizzolato, G.; Courtney, L. F. and Horst, R. L. (1991) The 16-Ene Analogs of 1,25-Dihydroxycholecalciferol. Synthesis and Biological Activity. In Vitamin D Gene Regulation Structure-Function Analysis and Clinical Application (Norman, A.W., Bouillon R. and Thomasset, M., eds), pp 210-213, Walter de Gruyter, Berlin/New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - (1991)

[TOP]

[0359]

AUTHOR	:	Bouillon, R., Okamura, W. H., and Norman, A. W.
TITLE	:	Structure-function relationships in the vitamin D endocrine system PubMed ID:7781594
JOURNAL	:	Endocr Rev.
VOL	:	16 PAGE : 200-257 (1995)

[TOP]

[0360]

AUTHOR	:	Onisko, B. L.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Synthesis of Potential Vitamin D Antagonists.
JOURNAL	:	Tetrahedron Lett.
VOL	:	PAGE : 1107-1108 (1977)

[TOP]

[0361]

AUTHOR	:	Havinga, E.; De Kock, R. J.; and Rappoldt, M. P.
TITLE	:	The Photochemical Interconversions of Provitamin D, Lumisterol, Previtamin D and .
JOURNAL	:	Tetrahedron
VOL	:	11 PAGE : 276-284 (1960)

[TOP]

[0362]

AUTHOR	:	Takahashi, T. and Yamamoto, R.
TITLE	:	Studies on the Stability of Vitamin D₂ Powder Preparations. III. Structure of a New Isomer of Vitamin D₂. PubMed ID:5307139
JOURNAL	:	Yakugaku Zasshi
VOL	:	89 PAGE : 919-924 (1969)

[TOP]

[0363]

AUTHOR	:	Yamada, S.; Shiraishi, M.; Ohmori, M. and Takayama, H.
TITLE	:	Facile and Stereoselective Synthesis of 25-Hydroxyvitamin D₂.
JOURNAL	:	Tetrahedron Lett.
VOL	:	25 PAGE : 3347-3350 (1984)

[TOP]

[0364]

AUTHOR	:	Bishop, J. E.; Henry, H. L.; Okamura, W. H.; Koeffler, H. P. and Norman, A. W. (1991) Arocalciferols: A New Class of Side-Chain Analogs of 1,25-(OH)₂ D₃. In Vitamin D Gene Regulation Structure-Function Analysis and Clinical Application (Norman, A.W., Bouillon R. and Thomasset, M., eds), pp 165-166, Walter de Gruyter, Berlin/New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - (1991)

[TOP]

[0365]

AUTHOR	:	Nilsson, K.; Valles, M. J.; Castedo, L.; and Mourino, A.
TITLE	:	Synthesis and Biological Evaluation of 18-Substituted Analogs of 1a,25-Dihydroxyvitamin D₃.
JOURNAL	:	Bioorg. Med. Chem. Lett.
VOL	:	3 PAGE : 1855-1858 (1993)

[TOP]

[0366]

AUTHOR	:	De Clercq, P..J.; De Wilde, H.; D'Halleweyn, C.; Zucker, P.; Van Hijfte, L.; Mijngheer, R.; Van Haver, D. and Vandewallle, M. (1991) Total Synthesis of (C-11)-Substituted Analogues of 1,25-Dihydroxyvitamin D₃. In Vitamin D Gene Regulation Structure-Function Analysis and Clinical Application (Norman, A.W., Bouillon R. and Thomasset, M., eds), pp 165-166, Walter de Gruyter, Berlin/New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - (1991)

[TOP]

[0367]

AUTHOR	:	Partridge J. J.; Shiuey, S. J.; Boris, A.;, Mallon, J. and Uskokovic, M. R. Synthesis and biological activity of 24R-hydroxy-25-fluoro-cholecalciferol and 1a,24-dihydroxy-25-fluorocholecalciferol. In Vitamin D, Basic Research and its Clinical Application (Norman, A. W.; Schaefer, K.; v Herrath, D.; et al., eds), pp 445-458, Walter de Gruyter, Berlin/New York
TITLE	:
JOURNAL	:
VOL	:	PAGE : - ()

[TOP]

[0368]

AUTHOR	:	Windaus, A. and Trautmann, G.
TITLE	:
JOURNAL	:	Hoppe-Seyler's Z Physiol. Chem.
VOL	:	247 PAGE : 185- (1937)

[TOP]

[0369]

AUTHOR	:	Ruigh, W. L.
TITLE	:
JOURNAL	:	J. Am. Chem. Soc.
VOL	:	64 PAGE : 1900- (1942)

[TOP]

[0370]

AUTHOR	:	Linsert, O.
TITLE	:
JOURNAL	:	Hoppe-Seyler's Z Physiol. Chem.
VOL	:	241 PAGE : 125- (1936)

[TOP]

[0371]

AUTHOR	:	Wunderlich, W.
TITLE	:
JOURNAL	:	Hoppe-Seyler's Z Physiol. Chem.
VOL	:	241 PAGE : 116- (1936)

[TOP]

[0372]

AUTHOR	:	Perlman, K. L.; Swenson, R. E.; Paaren, H. E.; Schnoes, H. K.; DeLuca, H. F.
TITLE	:	Novel Synthesis of 19-Nor-vitamin D Compounds.
JOURNAL	:	Tetrahedron Lett.
VOL	:	32 PAGE : 7663-7666 (1991)

[TOP]

[0373]

AUTHOR	:	Manabe, K.; Ishizuka, S.; Tanaka, H.; Gao, Q.; Furuya, M.; Tomimori, K.; Sakuma, Y.; and Hazato, A. (1997) Synthesis and Biological Activity of Novel Vitamin D3-Lactone Analogues. In Vitamin D Chemistry, Biology and Clinical Applications of the Steroid Hormone. (Norman, A. W.; Bouillon, R.; Thomasset, M.; eds), pp79-80, Printing and Reprographics University of California, Riverside
TITLE	:
JOURNAL	:
VOL	:	PAGE : - (1997)

[TOP]

[0374]

AUTHOR	:	Scheddin, D., Mayer, H., Schonecker, B., Gliesing, S., and Reichenbacher, M.
TITLE	:	Synthesis and biological activities of 2 beta-chloro-, 2 beta-fluoro-, and 2 beta-methoxy-1 alpha,25-dihydroxyvitamin D3 PubMed ID:9870260
JOURNAL	:	Steroids.
VOL	:	63 PAGE : 633-643 (1998)

[TOP]